Accepted Manuscript

Effect of polymorphisms in endothelial nitric oxide synthase and folate metabolizinggenes on the concentration of serum nitrate, folate and plasma total homocysteineafter folic acid supplementation. A double-blind cross-over study

Rona Cabo, Sigrunn Hernes, Audun Slettan, Margaretha Haugen, Shu Ye, RuneBlomhoff, M. Azam Mansoor

PII: S0899-9007(14)00398-0

DOI: 10.1016/j.nut.2014.08.009

Reference: NUT 9363

To appear in: Nutrition

Received Date: 14 May 2014

Revised Date: 12 July 2014

Accepted Date: 19 August 2014

Please cite this article as: Cabo R, Hernes S, Slettan A, Haugen M, Ye S, Blomhoff R, Mansoor MA,Effect of polymorphisms in endothelial nitric oxide synthase and folate metabolizing genes on theconcentration of serum nitrate, folate and plasma total homocysteine after folic acid supplementation. Adouble-blind cross-over study, Nutrition (2014), doi: 10.1016/j.nut.2014.08.009.

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service toour customers we are providing this early version of the manuscript. The manuscript will undergocopyediting, typesetting, and review of the resulting proof before it is published in its final form. Pleasenote that during the production process errors may be discovered which could affect the content, and alllegal disclaimers that apply to the journal pertain.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

1

Effect of polymorphisms in endothelial nitric oxide synthase and folate metabolizing genes on the concentration of serum nitrate, folate and plasma total homocysteine after folic acid supplementation. A double-blind cross-over study.

Rona Cabo1*, Sigrunn Hernes2, Audun Slettan1, Margaretha Haugen2, Shu Ye3, Rune Blomhoff4,5 and M. Azam Mansoor1

1. Department of Natural Sciences, University of Agder, Kristiansand, Norway.

2. Department of Public Health, Sport and Nutrition, University of Agder, Kristiansand, Norway.

3. William Harvey Research institute, Queen Mary University London, UK.

4. Department of Nutrition, University of Oslo, Oslo, Norway.

5. Department of Clinical Service, Clinic of Cancer Medicine, Transplantation and Surgery, Oslo University Hospital, Oslo, Norway

Address for correspondence:

*Rona Cabo

Department of Natural Sciences, University of Agder

4604 Kristiansand, Norway.

E-mail:rona.n.cabo@uia.no

Key words: Genetic polymorphisms, HPLC, serum nitrate, serum folate and plasma total

homocysteine.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

2

Abstract

Background and objectives: A number of studies have explored the effects of dietary nitrate on

human health. Nitrate in the blood can be recycled to nitric oxide which is an essential mediator

involved in many important biochemical mechanisms. Nitric oxide is also formed in the body from L-

arginine by nitric oxide synthase. The objective of this study was to investigate whether genetic

polymorphisms in endothelial nitric oxide synthase (eNOS) and genes involved in folate metabolism

affect the concentration of serum nitrate, serum folate and plasma total homocysteine in healthy

subjects after folic acid supplementation.

Methods – In a randomized, double blind, cross over study, the participants were given either folic

acid (0.8mg/day) (n=51) or placebo (n=50) for two weeks. Wash-out period was two weeks. Fasting

blood samples were collected, DNA was extracted by salting-out method and the polymorphisms in

eNOS synthase and folate genes were genotyped by PCR methods. Measurement of serum nitrate and

plasma total homocysteine (p-tHcy) concentration was done by HPLC.

Results – The concentration of serum nitrate did not change in subjects after folic acid supplements

(trial I), however the concentration of serum nitrate increased in the same subjects after placebo

(p=0.01) (trial II). The subjects with three polymorphisms in eNOS gene had increased concentration

of serum folate and decreased concentration of p-tHcy after folic acid supplementation. Among the

seven polymorphisms tested in folate metabolizing genes, serum nitrate concentration was

significantly decreased only in DHFR 19 del gene variant. A significant difference in the concentration

of serum nitrate was detected among subjects with MTHFR C>T677 polymorphisms.

Conclusion –Polymorphisms in eNOS and folate genes affect the concentration of serum folate and p-

tHcy but do not have any impact on the concentration of NO3 in healthy subjects after folic acid

supplementation.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

3

Introduction

Nitric oxide (NO) is synthesized by endothelial nitric oxide synthase (eNOS). Once formed it diffuses

into vascular smooth muscle cells where it activates the enzyme soluble guanylate cyclase (sGC)

resulting in the formation of the cyclic guanosine-3’, 5-monophosphate (cGMP). Increased

concentration of cGMP in the smooth muscle cells leads to their relaxation. NO is involved in the

inhibition of platelet aggregation, cellular adhesion to the endothelium, leucocyte migration, and

vascular smooth cell proliferation and migration [1, 2].

In mammals, three isoforms of nitric oxide synthase gene have been identified: the NOSI neuronal

(nNOS), NOSII inducible (iNOS) and NOSIII endothelial (eNOS) [2]. Three polymorphisms in eNOS

have been widely studied; a single nucleotide polymorphism (SNP) in the promoter region 786-T>C, a

SNP in 894-G>T and VNTR 27-bp repeat polymorphism (4b4a) in Intron 4 [3]. The SNP 786-T>C, is

responsible for a reduction in the promoter activity by approximately 50% and has been associated

with coronary spasm [4]. A G to T substitution in 894-G>T is considered to be a major risk factor for

coronary artery disease (CAD) and hypertension [5, 6]. The 4a allele of the eNOS gene polymorphism

in intron 4 was found to be related to elevate blood pressure in Finnish type II diabetics with coronary

heart disease (CHD). The 4b4a was associated with smoking-dependent coronary disease and essential

hypertension in Japanese [7, 8].

Polymorphisms in genes involved in folate metabolism affect the concentration of serum 5-

methyltetrahydrofolate (5-methylTHF). Folate, as a coenzyme or a methyl-group carrier is essential

for many biochemical reactions in the cell. Since, the bioavailability of folate affects the activity of

nitric oxide synthase, we were interested to investigate whether polymorphisms in genes involved in

folate metabolism will affect the concentration of nitrate in plasma [9-12].

It has been reported that 5-methylTHF supplementation can indirectly restore eNOS activity by

stimulating the enzymes dihydrofolate reductase (DHFR) and dihydropteridine reductase (DHPR),

which convert dihydrobiopterin (BH2) to tetrahydrobiopterin (BH4) (figure 1) [13, 14]. Since, BH4 is

essential for the activity of nitric oxide synthase, a deficiency of 5-methylTHF may cause a reduction

in the formation of NO [9, 10]. Methylenetetrahydrofolate reductase (MTHFR) is responsible for the

reduction of 5, 10-methyleneTHF to 5-methylTHF. MTHFR may act like dihydropterin reductase and

in this case MTHFR may utilize 5-methylTHF as a hydrogen donor. Dihydropterin reductase uses

NADPH as a hydrogen donor. Since MTHFR acts like dihydropterin reductase, can dihydropterin

reductase utilize 5-methylTHF as a hydrogen donor [9-12]. Two of the MTHFR gene polymorphisms

most investigated are MTHFR-677C>T and MTHFR-1298A>C. Reduced folate carrier protein

(RFC1) transports 5-methylTHF into the cell. Methylenetetrahydrofolate dehydrogenase (MTHFD1) is

a trifunctional enzyme that possesses three distinct enzymatic activities; methylenetetrahydrofolate

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

4

dehydrogenase, methenyltetrahydrofolate cyclohydrolase and formyltetrahydrofolate synthase which

is important for purine synthesis [15]. Dihydrofolate reductase (DHFR) reduces folic acid to

tetrahydrofolate (THF) [16]. Thymidylate synthase (TS) supplies deoxynucleotides required for DNA

synthesis [17]. Methionine synthase or 5-methyltetrahydrofolate-homocysteine methyltransferase

(MTR) is responsible for the remethylation of homocysteine to methionine [15].

5-methylTHF modulates the concentration of plasma total homocysteine, and the deficiency of folate

increases the concentration of plasma total homocysteine, a condition called hyperhomocysteinemia

[9,10]. Hyperhomocysteinemia impairs endothelial function by oxidising BH4, with decreased NO

production and increased superoxide (O2-) release [18]. It has been suggested that NO may modulate

homocysteine concentration directly by inhibiting methionine synthase (MTR) or indirectly via folate

catabolism by inhibiting the synthesis of ferritin [19]. These observations may suggest that there are

interactions between hyperhomocysteinemia, deficiency of folate and NO levels. NO in blood is

oxidized to nitrite (NO2), which is rapidly converted to nitrate (NO3). The half-life of NO in whole

blood is approximately 1.8 ms [20].

A number of dietary intervention studies, based on consumption of vegetable juice and NO3 salts, have

been conducted to increase the concentration of NO3 in the blood similarly, various types of herbs

have been tested for increasing the concentration of NO3 in the blood [21-23]. It has been suggested

that NO3 and NO2 are recycled into NO in the blood; however a number of enzymes may be involved

in the process of reduction [24-26]. Dietary nitrates have been used, among others, to explore their

effect on cardiovascular system, endothelial function, blood pressure and vascular homeostasis [27,

28].

In our knowledge, data on the effect of genetic polymorphisms in eNOS, enzymes involved in folate

metabolism and folic acid supplements on the concentration of serum nitrate are very scarce.

Our objective was to explore; whether genetic polymorphisms in eNOS and genes of folate

metabolism and folic acid supplements affect the concentration of serum nitrate in healthy subjects.

Furthermore, we wanted to test whether genetic polymorphisms in eNOS and folic acid supplements

had an impact on the concentration of serum folate and p-tHcy. To achieve our objective we conducted

a randomized, double blind, cross-over study. We tested the effect of three polymorphisms in eNOS

and seven polymorphisms in folate metabolizing genes in 101 healthy subjects after folic acid

supplementations.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

5

Materials and Methods

Study design: The blood samples for this randomized, double blind cross over study were collected

from 101 healthy participants: employees and students from the University of Agder, Kristiansand,

Norway. Blood was collected on day 1, day 15, day 30 and day 45. In the first part of the treatment

(trial I), half of the participants (n=51) were given 800 <mu>g/folic acid (in tablet form) per day and

the other half of the participants (n=50) received placebo. There was a washout period of two weeks.

Then, in the second part of the treatment (trial II), the participants who had been given placebo

previously were supplemented with folic acid at 800 <mu>g/day, and the other group received the

placebo (figure 2).

Blood samples: Blood was collected between 07.30 and 08.30 a.m., after an overnight fast, in

Vacutainer tubes containing heparin for plasma samples and tubes without anticoagulant for serum

samples. The plasma was isolated within 30 min by centrifugation at 2500 rpm at 4°C for 15 minutes.

The serum was isolated by incubating the blood at 4°C for 45 minutes followed by centrifugation of

the vials at 2500 rpm at 4°C for 15 minutes. Plasma and serum were stored at –80 °C.

All participants provided a written consent. This study was approved by the Regional Ethics

Committee (region II) Helse Sør for Ethical Evaluation and the University Data Register.

Sample preparation: The serum was mixed with PBS (1:1) and centrifuged for 60 min at 4°C at

12,000 rpm through Millipore filter (Amicon Ultra).

Chemical analyses: The measurement of serum nitrate and p-tHcy was performed by a previously

published method [29, 30]. A Dionex UVD 170U/340U UV/VIS detector with the program

Chromeleon Software was used to run the HPLC system. The mobile phase consisted of 4%

acetonitrile, 5 mM TBASO4, 20 mM KH2PO4, and 20 mM H3PO4. The flow rate was 1.3 ml/min. All

samples were analysed using a Thermo Scientific 150 x 4.6 mm Hypersil-ODS-C18 column. The

injection volume of the samples was 20 µl. The absorbance was recorded at 214 nm using UV

Detector. The concentration of serum folate was measured by a Cobas 6000 in the laboratory of

Medical Biochemistry, Sørlandet Hospital HF, Arendal, Norway. The coefficient for variation (CV)

for the assay was <10%.

Genotyping of the eNOS genes: DNA was extracted from whole blood by Salting-out method and

was stored at -20oC until analysed [31]. Genetic polymorphism in the three eNOS gene variants, 786-

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

6

T>C in the promoter, 894-G>T in Exon7 and 4b4a in Intron 4 were analysed as described in with

some modifications [3].

786-T>C polymorphism was analysed by PCR followed by restriction fragment length polymorphism

analysis (RFLP) using the primers 5’-TGGAGAGTGCTGGTGTACCCCA-3’ (sense) and 5’-

GCCTCCACCCCCACCCTGTC-3’ (antisense). The PCR was performed in a total volume of 20.0 µl

containing approximately 200 ng of genomic DNA, 2.0 µl of GeneAmp 10X PCR buffer II, 1.5 mM

MgCl2, 500 µM of each dNTP, 0.5 µM of each primer and 1.25 U of AmpliTaq Gold DNA

Polymerase (Applied Biosystems). The PCR parameters were: 95oC for 5 min followed by 45 cycles

with 95 oC for 30 sec, 65 oC for 30 sec and 72 oC for 30 sec and a final extension period of 7 min at 72 oC. 5,0 µl of the amplified product was digested with 5 U restriction enzyme MspI (Promega) at 37oC

overnight producing DNA fragments of 140 and 40 bp for the wild type (allele T) and 90, 50, 40 bp

for the variant (allele C) [3].

894-G>T polymorphism was determined by PCR followed by (RFLP) analysis using the primers 5’-

AAGGCAGGAGACAGTGGATGGA-3’ (sense) and 5’-CCCAGTCAATCCCTTTGGTGCTCA-3’

(antisense). The PCR mixture and temperature profile were the same as described above. 5,0 µl of the

product was digested with restriction enzyme BanII (Promega) at 37oC overnight, producing DNA

fragments of 163 and 85 bp (wild type) and no digestion keeping the original 258 bp fragment when

the variant allele was present [3].

4b4a polymorphism in intron 4 was analysed by PCR amplification using the primers

5’-AGGCCCTATGGTAGTGCCTTT-3’ (sense) and 5’-TCTCTTAGTGCTGTGGTCAC -3’

(antisense). The PCR was performed in a 20 µl reaction volume containing approximately 200 ng of

genomic DNA, 2.0 µl of GeneAmp 10X PCR buffer II, 2.0 mM MgCl2, 500 µM of each dNTP, 0.5

µM of each primer and 1.25 U of AmpliTaq Gold DNA Plolymerase (Applied Biosystems). The PCR

parameters were: 95oC for 5 min followed by 40 cycles with 95 oC for 30 sec, 59 oC for 1 min and 72 oC for1 min and a final extension at 72 oC for 7 min. The DNA fragments were 420 bp for the wild

type allele (4b) and 393 bp for the variant allele (4a) [3].

Genotyping of polymorphisms in folate metabolizing genes: Genotyping of polymorphisms in

folate metabolizing genes were carried out by PCR methods as described previously with some

modifications [15].

MTHFR-677C>T, MTHFR-1298A>C, RFC1-80G>A, MTHFD1-1958G>A and MTR-2756A>G

polymorphisms were analysed by PCR followed by restriction fragment length polymorphism analysis

(RFLP). The primers were; MTHFR-677C>T, TGAAGGAGAAGGTGTCTGCGGGA (sense) and

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

7

AGGACGGTGCGGTGAGAGTG (antisense); MTHFR-1298A>C,

CTTTGGGGAGCTGAAGGACTACTA (sense) and CACTTTGTGACCATTCCGGTTTG

(antisense); RFC1-80G>A, AGTGTCACCTTCGTCCCCTC (sense) and

CTCCCGCGTGAAGTTCTT (antisense); MTHFD1-1958G>A, CACTCCAGTGTTTGTCCATG

(sense) and GCATCTTGAGAGCCCTGAC (antisense); MTR-2756A>G,

TGTTCCCAGCTGTTAGATGAAAATC (sense) and GATCCAAAGCCTTTTACACTCCTC

(antisense). The PCR was performed in a total volume of 20.0 µl containing approximately 200 ng of

genomic DNA, 2.0 µl of GeneAmp 10X PCR buffer II, 3.0 mM MgCl2, 500 µM of each dNTP, 0.5

µM of each primer and 1.25 U of AmpliTaq Gold DNA Polymerase (Applied Biosystems). The PCR

parameters were: 95oC for 5 min followed by 45 cycles with 95 oC for 30 sec, 55 oC for 30 sec and 72 oC for 30 sec and a final extension period of 7 min at 72 oC. 5,0 µl of the amplified product was

digested with 5 U restriction enzyme Hinf, MboII, CfoI, MspI,HaeIII (Promega), respectively, at 37oC

overnight producing DNA fragments of 198, 175, 23 bp; 84, 56, 31, 30, 28, 18 bp; 162, 125, 68, 37 bp;

267, 196, 70, 56, 8 bp and 211, 131, 80 bp respectively [15].

DHFR-19del polymorphism was determined by PCR using the primers

CCACGGTCGGGGTACCTGGG (F1), ACGGTCGGGGTGGCCGAC (F2) and

AAAAGGGGAATCCAGTCGG (R). The PCR mixture was the same as described above except

annealing temperature was 63 oC for 30 sec. The DNA fragments were 113 bp and 92 bp [32].

TS polymorphism was analysed by PCR using primers GTGGCTCCTGCGTTTCCCCC (P1) and

CCAAGCTTGGCTCCGAGCCGGCCACAGGCATGGCGCGG (P2). The PCR was performed in a

20 µl reaction volume containing approximately 200 ng of genomic DNA, 2.0 µl of GeneAmp 10X

PCR buffer II, 1.5 mM MgCl2, 500 µM of each dNTP, 0.5 µM of each primer, dimethyl sulphoxid 6%

and 1.25 U of AmpliTaq Gold DNA Plolymerase (Applied Biosystems). The PCR parameters were:

95oC for 5 min followed by 45 cycles with 95 oC for 30 sec, 62 oC for 30 sec and 72 oC for 30 sec and

a final extension at 72 oC for 7 min. The DNA fragments were 250 bp and 220 bp [17].

We estimated the dietary intakes of all subjects as reported previously [33].

Statistical analysis: Data was analysed by SPSS version 19. Changes in the concentration of

biochemical parameters, from baseline and after folic acid supplementation, were tested by Wilcoxon

for paired samples. We used Mann-Whitney U test for the comparison of biochemical parameters

between two groups and Kruskal-Wallis test was used for the comparison between more than two

groups. A value of p < 0.05 was considered significant. Due to small number of participants, the

participants with heterozygote and variant polymorphisms were treated all together.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

8

Results

The concentration of serum nitrate did not change after 14 days in subjects on folic acid supplements

(trial I), however the concentration of serum nitrate increased in the same subjects after placebo for 14

days (p=0.01) (trial II) (Table 1).

The subjects with eNOS polymorphisms had not significantly difference in intake of proteins, fats,

carbohydrates, riboflavin, vitamin B6, folate, vitamin B12 and vitamin C (table 2).

Subjects with eNOS 786-T>C, 894-G>T and 4b4a+4a4a had increased concentration of serum folate

after folic acid supplementation (p<0.000, p<0.0001 and p=0.003) (trial I). Similar increase in the

concentration of serum folate was recorded after (trial II), table 3A. There was a significant difference

in the concentration of serum folate between 894-G>T GG versus GT+TT polymorphisms (p=0.03).

The concentration of p-tHcy decreased in subjects with polymorphisms 786-T>C (TC+CC) (p=0.002),

894-G>T (GG) and (GT+TT) (p=0.01 and p=0.02) respectively, and in intron 4 (4b4b) and 4b4a+4a4a

p=0.007 and p=0.02 respectively (trial I), table 3B. A significant decrease in the concentration of p-

tHcy was detected in subjects with 786-T>C (TC+CC) polymorphism (p=0.01), in 894-G>T (GT+TT)

p<0.009 and in intron 4 (4b4a+4a4a) p<0.04 after folic acid supplementation. The concentration of p-

tHcy was significantly different between the groups; at baseline and after supplementation (4b4b) and

(4b4a+4a4a) (p=0.04 and p=0.003). After two weeks of placebo, p-tHcy was significantly increased in

subjects with eNOS gene polymorphisms (from p=0.009 to p<0.0001) (table 3 B).

Genetic polymorphisms in eNOS and in the enzymes of folate metabolism had no effect on the

concentration of serum nitrate after folic acid supplementation in healthy subjects (table 4A and 4B).

Only in subjects with DHFR-19 del gene variant (DD), the concentration of serum nitrate was

decreased after folic acid supplementation (p=0.008). At the baseline, the concentration of serum

nitrate was significantly different in subjects with genotypes of MTHFR-677C>T polymorphism, (CC)

and (CT+TT) (p=0.01).

In the placebo group, after trial II, the concentration of serum nitrate was significantly increased in

subjects with 894-G>T (GT+TT) (p=0.03), intron 4 (4b4b) (p=0.01), MTHFR-677C>T (CT+TT)

(p=0.003), MTHFR-1298A>C (AC+CC) (p=0.005), RFC1-80G>A (GG+GA) (p=0.01), MTHFD1-

1958G>A (GA) (p=0.03) and MTR-2756A>G (AG+GG) (p=0.03). A significant difference was

detected in the concentration of nitrate in subjects with MTHFR-677C>T polymorphism after folic

acid supplementation, (p=0.04). At the baseline in the placebo group, significant differences in the

concentration of nitrate was detected between the subjects with polymorphisms 786-T>C (p=0.04).

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

9

Similarly, we detected significant differences in the concentration of nitrate in subjects with MTHFR-

677C>T polymorphism (p=0.02) and MTR-2756A>G polymorphism (p=0.03) (table 4B).

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

10

Discussion

The present study demonstrated that folic acid supplements had no effect on the concentration of

serum folate in healthy subjects. Furthermore, genetic polymorphisms in eNOS and in the enzymes of

folate metabolism had no effect on the concentration of serum nitrate after folic acid supplementation.

Therefore, systematic dose response studies may be initiated to sort out optimal dose and type of

dietary nitrate, which may increase the concentration of serum nitrate without disturbing ion or trace

metal homeostasis in the blood. Increased consumption of leafy vegetables, which contain very high

content of nitrate, may have dual function because these vegetables also contain an increased amount

of folate, which reduces the concentration of p-tHcy.

Individuals with eNOS polymorphisms (786-T>C, 894-G>T and intron4) had a significant increase in

serum folate concentrations after folic acid supplementation, and significant differences in the

concentration of serum folate were detected between the polymorphisms 894-G>T. Our study is novel

in detecting the influence of eNOS polymorphisms on serum folate concentrations after folic acid

supplementation. It has been demonstrated that 894-G>T (TT) genotype is a risk factor for elevated p-

tHcy concentration in healthy non-smoking individuals with low serum folate [34]. Whereas it has

been proposed that hyperhomocysteinemia in MTHFR 677TT homozygote smokers is the

consequence of mild intracellular folate deficiency caused by a reduction in eNOS activity [35]. Thus

our findings may suggest that folic acid supplementation may improve the concentration of serum

folate in subjects with eNOS polymorphisms.

Hyperhomocysteinemia is a result of either reduced enzymatic activity in the enzymes that participate

in homocysteine metabolism and or a reduction in the concentrations of plasma B-vitamins,

particularly, folate. Dietary intake of folate or folic acid supplementation can lower the concentration

of p-tHcy [36]. Previously published data suggest that NO may modulate p-tHcy concentration

directly by inhibiting methionine synthase (MTR) or indirectly by inhibiting the synthesis of ferritin

[19]. Our results showed a significant decrease in the concentration of p-tHcy in subjects with three

eNOS polymorphisms. Previously, the eNOS 786-T>C polymorphism was found to influences p-tHcy

concentration and the eNOS 894-G>Tpolymorphism interacted with elevated p- tHcy levels, whereas

all three eNOS gene polymorphisms were associated with the risk of spontaneously aborted foetuses

[37-39]. Thus folic acid supplementation may have some beneficial effects in subjects with eNOS

polymorphisms.

It has been reported that the 786-T>C mutation in the eNOS gene reduces endothelial nitric oxide

synthesis and predisposes the patients with the coronary spasm [4]. We observed no significant

differences in the concentration of serum nitrate in individuals with 786-T>C polymorphism, our

findings are in accordance with the previously published findings [40].

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

11

The eNOS, 894G>T is associated with reduced basal NO production, whereas another study suggests

that it may enhance eNOS expression and NO production [41, 42]; yet another study reported no

substantial effect of this polymorphism on nitrite/nitrate (NOx) levels [43]. The results of this study

showed no significant differences in the concentration of serum NO3 in individuals with 894-G>T

polymorphisms.

The eNOS4 polymorphism, intron 4, has been reported to be responsible for over 25% of the basal

plasma NO production, while plasma nitrite/nitrate levels in subjects with eNOS4a allele was found to

be significantly higher than in subjects with the eNOS4b allele [44, 45]. We observed no significant

differences in the concentration of serum nitrate in individuals with 4b4a polymorphism.

It has been demonstrated that 5-methyl-THF, can indirectly restore NOS activity by stimulating the

enzyme dihydrofolate reductase (DHFR) to reduce dihydrobiopterin (BH2) to tetrahydrobiopterin

(BH4). Thus, DHFR plays an important role in the regulation of BH4 and NO bioavailability in the

endothelium [13, 14]. We detected a significant decrease in the concentration of serum nitrate in

individuals with a variant of DHFR19del, (P=0.008). It has been suggested that DHFR 19 del DD

(del/del) genotype in mothers is related to increased risk of having a baby born with neural tube

defects (NTD), while another study suggested that the DD genotype is protective and decreases the

risk of having a baby born with NTD, and another study reported no effect at all [42, 46, 47].Thus,

there seems to be a lack of consensus about how this polymorphism may have an effect on NTD. It has

been reported that DHFR polymorphism alters the enzyme activity to reduce folic acid, thereby may

limit the bioavailability of intracellular reduced folate [48].

NO3 in serum is a product of NO formed by eNOS and dietary intake through vegetables and fruits.

Findings shown in table 1 indicate that increased folate in serum after folic acid supplementation does

not affect the concentration of NO3 (trial I).The question is whether increased folate bioavailability in

blood maintains the levels of NO and thus folate functions as an antioxidant and inhibits the formation

of NO2 and NO3 from NO. As a result there is no change in the concentration of NO3 after folic acid

supplementation. Later on, the same individuals had increased concentration of serum NO3 even after

placebo treatment for 2 weeks and wash-out period for two weeks (trial II). Nevertheless, the washout

period for 14 days is probably not sufficient for folic acid to be depleted completely. It was reported

that plasma folate levels fell 60% after about 28 days of depletion period [49]. Thus, our findings may

suggest that increased folate bioavailability may affect the concentration of serum nitrate, but the

biochemical process for this change may require more than two weeks.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

12

Limitations: A limitation in our study was the relatively small number of volunteers (n=101), which

might had limited the power to detect an effect of individual genotypes, especially mutant gene, on the

concentrations of serum nitrate. Wash out period between the two supplementation periods was short,

which might have also affected the concentration of NO3 and folate.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

13

References:

1. Moncada S, Higgs EA (1993) The L-arginine-nitric oxide pathway. N Engl J Med 329:2002–

12. doi: 10.1056/NEJM199312303292706

2. Vallance P, Chan N (2001) Endothelial function and nitric oxide: clinical relevance. Heart 85:

342–350. doi: 10.1136/heart.85.3.342

3. Marroni AS, Metzger IF, Souza-Costa DC, Nagassaki S, Sandrim VC, Correa RX, Rios-

Santos F, Tanus-Santos JE (2005) Consistent interethnic differences in the distribution of

clinically relevant endothelial nitric oxide synthase genetic polymorphisms. Nitric Oxide

12:177-182. doi: 10.1016/j.niox.2005.02.002

4. Nakayama M, Yasue H, Yoshimura M, Shimasaki Y, Kugiyama K, Ogawa H, Motoyama T,

Saito Y, Ogawa Y, Miyamoto Y, Nakao K (1999) T-786-->C mutation in the 5'-flanking

region of the endothelial nitric oxide synthase gene is associated with coronary spasm.

Circulation 99:2864-70. doi: 10.1016/S0002-9149(00)01041-9

5. Hingorani AD, Liang CF, Fatibene J, Lyon A, Monteith S, Parsons A, Haydock S, Hopper

RV, Stephens NG, O'Shaughnessy KM, Brown MJ (1999) A common variant of the

endothelial nitric oxide synthase (Glu298-->Asp) is a major risk factor for coronary artery

disease in the UK. Circulation 100: 1515-1520. doi: 10.1161/01.CIR.100.14.1515

6. Miyamoto Y, Saito Y, Kajiyama N, Yoshimura M, Shimasaki Y, et al (1998) Endothelial

nitric oxide synthase gene is positively associated with essential hypertension. Hypertension

32: 3-8. doi: 10.1161/01.HYP.32.1.3

7. Wang XL, Sim AS, Badenhop RF, McCredie RM, Wilcken DE (1996) A smoking-dependent

risk of coronary artery disease associated with a polymorphism of the endothelial nitric oxide

synthase gene. Nature Medicine 2: 41 – 45. doi: 10.1038/nm0196-41

8. Uwabo J, Soma M, Nakayama T, Kanmatsuse K (1998) Association of a variable number of

tandem repeats in the endothelial constitutive nitric oxide synthase gene with essential

hypertension in Japanese. Am J Hypertens 11:125-128. doi: 10.1016/S0895-7061(97)00419-6

9. Stroes ESG, van Faassen EE, Yo M, Martasek P, Boe P, Govers R, Rebelink TJ (2000) Folic

acid reverts dysfunction of endothelial nitric oxide synthase. Circ Res 86:1129-1134. doi:

10.1161/01.Res.86.11.1129

10. Mansoor MA, Kristensen O, Hervig T, Stakkestad JA, Berge T, Drabløs PA, Rolfsen S,

Wentzel-Larsen T (2005) Relationship between serum folate and plasma nitrate

concentrations: possible clinical implications. Clin Chem 51:1266-8. doi:

10.1373/clinchem.2004.046409

11. Matthews RG, Kaufman S (1980) Characterization of the dihydropterin reductase activity of

pig liver methylenetetrahydrofolate reductase. JBC 255:6014-6017.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

14

12. Rao GN, Cotlier E (1985) Enzymatic activity of quinonoid dihydropterin reductase and

tetrahydropeterin content in human ocular tissues and senile cataracts. Exp Eye Res 40:601-

607. doi: 10.1016/0014-4835(85)90082-X

13. Chalupsky K, Cai H (2005) Endothelial dihydrofolate reductase: critical for nitric oxide

bioavailability and role in angiotensin II uncoupling of endothelial nitric oxide synthase. Proc

Natl Acad Sci U S A. 102:9056–9061. doi: 10.1073/pnas.0409594102

14. Moens AL., Kass DA (2006) Tetrahydrobiopterin and Cardiovascular Disease. Arterioscler

Thromb Vasc Biol 26:2439-2444. doi: 10.1161/01.ATV.0000243924.00970.cb

15. Charasson V, Hillaire-Buys D, Solassol I, Laurand-Quancard A, Pinguet F, Le Morvan V,

Robert J (2009) Involvement of gene polymorphisms of the folate pathway enzymes in gene

expression and anticancer drug sensitivity using the NCI-60 panel as a model. Eur J Cancer

45:2391-401. doi: 10.1016/j.ejca.2009.05.013

16. Forges T, Monnier-Barbarino P, Alberto JM, Guéant-Rodriguez RM, Daval JL, Guéant JL

(2007) Impact of folate and homocysteine metabolism on human reproductive health.

Hum Reprod Update 13:225-238. doi: 10.1093/humupd/dml063

17. Skibola CF, Smith MT, Hubbard A, Shane B, Roberts AC, Law GR, Rollinson S, Roman E,

Cartwright RA, Morgan GJ (2002) Polymorphisms in the thymidylate synthase and serine

hydroxymethyltransferase genes and risk of adult acute lymphocytic leukemia. Blood

99:3786-3791. doi: 10.1182/blood.V99.10.3786

18. Dhillon B, Badiwala MV, Maitland A, Rao V, Li SH, Verma S (2003) Tetrahydrobiopterin

attenuates homocysteine induced endothelial dysfunction. Mol Cell Biochem 247:223-7. doi:

10.1023/A:1024146501743

19. Danishpajooh IO, Gudi T, Chen Y, Kharitonov VG, Sharma VS, Boss GR (2001) Nitric oxide

inhibits methionine synthase activity in vivo and disrupts carbon flow through the folate

pathway. J Biol Chem 276:27296-27303. doi: 10.1074/jbc.M104043200

20. Liu X, Miller MJS, Joshi MS, Sadowska-Krowicka H, Clark DA, Lancaster JR Jr (1998)

Diffusion-limited reaction of free nitric oxide with erythrocytes. J Biol Chem 273:18709-13.

doi: 10.1074/jbc.273.30.18709

21. Weitzberg E, Lundberg JO (2013) Novel aspects of dietary nitrate and human health. Annu

Rev Nutr 33:129-159. doi: 10.1146/annurev-nutr-071812-161159

22. Hobbs DA, George TW and Lovegrove JA (2013) The effects of dietary nitrate on blood

pressure and endothelial function: a review of human intervention studies. Nutr Research

Reviews 26:210-222. doi: 10.1017/S0954422413000188

23. Jiang H, Torregrossa AC, Parthasaathy DK, Bryan NS (2012) Natural product nitric oxide

chemistry: new activity of old medicines. Evidence-Based Complementary and Alternative

Medicine 2012;1-9. doi: 10.1155/2012/873210

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

15

24. Carlström M, Liu M, Yang T, Zollbrecht C, Huang L, Peleli M, et al (2013) Cross-talk

Between Nitrate-Nitrite-NO and NO Synthase Pathways in Control of Vascular NO

Homeostasis. Antioxidant & Redox Signaling 2013; doi:10.1089/ars.2013.5481

25. Omar SA, Webb AJ (2014) Nitrite reduction and cardiovascular protection. J Mol and Cell

Cardiol pii: S0022-2828(14)00032-7. doi: 10.1016/j.yjmcc.2014.01.012

26. Kapil V, Weitzberg E, Lundberg JO, Ahluwalia A (2014) Clinical evidence demonstrating the

utility of inorganic nitrate in cardiovascular health. Nitric oxide 38:45-57. doi:

10.1016/j.niox.2014.03.162

27. Gilchrist M, Winyard PG, Aizawa K, Anning C, Shore A, Benjamin N (2013) Effect of

dietary nitrate on blood pressure, endothelial function, and insulin sensitivity in type 2

diabetes. Free Radical Biol and Med 60:89-97. doi: 10.1016/j.freeradbiomed.2013.01.024

28. Larsen FJ, Schiffer TA, Ekblom B, Mattasson MP, Checa A, Wheelock CE, et al (2014)

Dietary nitrate reduces resting metabolic rate: a randomized, cross over study in humans. Am

J Clin Nutr 99:843-50. doi: 10.3945/ajcn.113.079491

29. Mansoor MA, Svardal AM, Ueland PM (1992) Determination of the in vivo redox status of

cysteine, cysteinylglycine, homocysteine, and glutathione in human plasma. Anal Biochem

200:218-229. doi: 10.1016/0003-2697(92)90456-H

30. Larsen TL, Nilsen V, Andersen DO, Francis G, Rustad P, Mansoor MA (2008) Comparison of

high-pressure liquid chromatography (HPLC) and Griess reagent-spectroscopic methods for

the measurement of nitrate in serum from healthy individuals in the Nordic countries. Clin

Biochem 41:1474-81. doi: 10.1016/j.clinbiochem.2008.08.083

31. Miller SA, Dykes DD, and Polesky HF (1988) A simple salting out procedure for extracting

DNA from human nucleated cells. Nucleic Acids Res 16: 1215. doi: 10.1093/nar/16.3.1215

32. Johnson WG, Stenroos ES, Spychala JR, Chatkupt S, Ming SX, Buyske S (2004) New 19 bp

deletion polymorphism in intron-1 of dihydrofolate reductase (DHFR): a risk factor for spina

bifida acting in mothers during pregnancy. Am J Med Genet A 124A:339-45. doi:

10.1002/ajmg.a.20505

33. Hernes S, Cabo RN, Mansoor MA, Haugen M (2012) Eating patterns are associated with

biomarkers in selected population of university students and employees. J Nutr Sci 1: 1-8.

doi:10.1017/jns.2012.8

34. Brown KS, Kluijtmans LA, Young IS, Woodside J, Yarnell JW, McMaster D, Murray L,

Evans AE, Boreham CA, McNulty H, Strain JJ, Mitchell LE, Whitehead AS (2003) Genetic

evidence that nitric oxide modulates homocysteine: the NOS3 894TT genotype is a risk factor

for hyperhomocystenemia. Arterioscler Thromb Vasc Biol 23:1014-1020. doi:

10.1161/01.ATV.0000071348.70527.F4

35. Brown KS, Kluijtmans LA, Young IS, Murray L, McMaster D, Woodside JV, Yarnell JW,

Boreham CA, McNulty H, Strain JJ, McPartlin J, Scott JM, Mitchell LE, Whitehead AS

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

16

(2004) The 5,10-methylenetetrahydrofolate reductase C677T polymorphism interacts with

smoking to increase homocysteine. Atherosclerosis 174:315-322. doi:

10.1016/j.atherosclerosis.2004.01.023

36. Moat SJ, Lang D, McDowell IF, Clarke ZL, Madhavan AK, Lewis MJ, Goodfellow J (2004)

Folate, homocysteine, endothelial function and cardiovascular disease. J Nutr Biochem 15:64-

79. doi: 10.1016/j.jnutbio.2003.08.010

37. Fatini C, Sofi F, Gori AM, Sticchi E, Marcucci R, Lenti M, Casini A, Surrenti C, Abbate R,

Gensini GF (2005) Endothelial nitric oxide synthase -786T>C, but not 894G>T and 4b4a,

polymorphism influences plasma homocysteine concentrations in persons with normal vitamin

status. Clin Chem 51:1159-64. doi: 10.1373/clinchem.2005.048850

38. Heil SG, Den Heijer M, Van Der Rijt-Pisa BJ, Kluijtmans LA, Blom HJ (2004) The 894 G >

T variant of endothelial nitric oxide synthase (eNOS) increases the risk of recurrent venous

thrombosis through interaction with elevated homocysteine levels. J Thromb Haemost 2:750-

3. doi: 10.1111/j.1538-7836.2004.00701.x

39. Shim SH, Yoon TK, Cha DH, Han WB, Choi DH, Kim NK (2010) Endothelial Nitric Oxide

Synthase (eNOS) gene polymorphisms in spontaneously aborted embryos. Genes & Genomics

32:283-288. doi: 10.1007/s13258-010-0018-5

40. Nagassaki S, Metzger IF, Souza-Costa DC, Marroni AS, Uzuelli JA, Tanus-Santos JE (2005)

eNOS genotype is without effect on circulating nitrite/nitrate level in healthy male population.

Thrombosis Research 115:375-9. doi: 10.1016/j.thromres.2004.09.003

41. Veldman BA, Spiering W, Doevendans PA, Vervoort G, Kroon AA, de Leeuw PW, Smits P

(2002) The Glu298Asp polymorphism of the NOS 3 gene as a determinant of the baseline

production of nitric oxide. J Hypertens 20:2023-7. ISSN: 0263-6352

42. Dhangadamajhi D, Mohapatra B N, Kar S K, Ranjit M (2009) Endothelial Nitric Oxide

Synthase Gene Polymorphisms and Plasmodium falciparum Infection in Indian Adults. Infect

Immun 77:2943-2947. doi: 10.1128/IAI.00083-09

43. Moon J, Yoon S, Kim E, Shin C, Jo SA, Jo I (2002) Lack of evidence for contribution of

Glu298Asp (894-G>T) polymorphism of endothelial nitric oxide synthase gene to plasma

nitric oxide levels. Thromb Res 107:129-34. doi: 10.1016/S0049-3848(02)00208-6

44. Wang XL, Mahaney MC, Sim AS, Wang J, Wang J, Blangero J, Almasy L, Badenhop RB,

Wilcken DE (1997) Genetic contribution of the endothelial constitutive nitric oxide synthase

gene to plasma nitric oxide levels. Arterioscler Thromb Vasc Biol 17:3147-53. doi:

10.1161/01.ATV.17.11.3147

45. Yoon S, Moon J, Shin C, Kim E, Jo SA, Jo I (2002) Smoking status-dependent association of

the 27-bp repeat polymorphism in intron 4 of endothelial nitric oxide synthase gene with

plasma nitric oxide concentrations. Clin Chim Acta 324:113-20. doi: 10.1016/S0009-

8981(02)00235-8

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

17

46. Parle-McDermott A, Pangilinan F, Mills JL, Kirke PN, Gibney ER, Troendle J, O'Leary VB,

Molloy AM, Conley M, et al (2007) The 19-bp deletion polymorphism in intron-1 of

dihydrofolate reductase (DHFR) may decrease rather than increase risk for spina bifida in the

Irish population. Am J Med Genet A 143A:1174–80. doi: 10.1002/ajmg.a.31725

47. Van der Linden IJ, Nguyen U, Heil SG, Franke B, Vloet S, Gellekink H, Heijer M, Blom HJ

(2007) Variation and expression of dihydrofolate reductase (DHFR) in relation to spina bifida.

Mol Genet Metab 91:98–103. doi: 10.1016/j.ymgme.2007.01.009

48. Kalmbach RD, Choumenkovitch SF, Troen AP, Jacques PF, D'Agostino R, Selhub J (2008) A

19-Base Pair Deletion Polymorphism in Dihydrofolate Reductase Is Associated with Increased

Unmetabolized Folic Acid in Plasma and Decreased Red Blood Cell Folate. J Nutr. 138:2323-

7. doi: 10.3945/jn.108.096404

49. Sauberlich H E, Kretsch M J, Skala J H, Johnson H L, and Taylor P C (1987) Folate

requirement and metabolism in nonpregnant women. Am J Clin Nutr 46:1016-1028.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPTTable 1. Serum nitrate concentrations after supplementation with folic acid or placebo.

Baseline 2 wk Baseline 2 wk Folic acid Folic acid p-value Placebo Placebo p-value Trial I All 22.5±15.2 (19.7) 19.5±9.6 (18.1) 0.68 21.0±17.6 (16.1) 16.7±6.1 (15.1) 0.40 Trial II All 16.8±6.1 (16.5) 18.3±9.2 (15.2) 0.52 15.4±6.8 (12.9) 20.4±14.6 (16.8) 0.01 Data are presented as Mean±SD (median) µmol/L. P-value < 0.05 shows significant difference. Concentration of nitrate for baseline and two wk after folic acid supplementation, trial I, baseline placebo and 2 wk after placebo, trial II (p=0.010, Friedman Test).

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

Table 2. Allele frequency, Hardy-Weinberg Equilibrium (HWE) and intake of protein, fat, carbohydrate, riboflavin, vitamin B6, folate, vitamin B12 and vitamin C according to genotype. Allele Protein intake Fat intake Carbo. intake Riboflavin intake Vitamin B6 intake Folate intake Vitamin B12 intake Vitamin C intake frequency (g/day) (g/day) (g/day) (mg/day) (mg/day) (µg/day) (µg/day) (mg/day) All subjects 96.1±26.8 (90.5) 84.3±32.5 (77.1) 297±110 (282) 2.0±0.9 (1.7) 1.7±0.5 (1.7) 286±97 (282) 6.8±3.5 (6.2) 153±74.5 (145) 786-T>C TT T: 0.69 101±28.6 (93.6) 87.9±34.4 (75.4) 323±115 (284) 2.1±1.0 (1.9) 1.8±0.6 (1.7) 298±100 (284) 7.1±4.3 (5.7) 160±69.3 (157) TC+CC C: 0.31 91.8±24.7 (86.7) 81.0±30.6 (78.8) 273±99 (274) 1.8±0.7 (1.7) 1.6±0.5 (1.6) 274±94 (280) 6.6±2.5 (6.5) 147±79.1 (141) 894-G>T GG G: 0.67 99.9±29.0 (93.7) 88.0±36.1 (74.7) 307±107 (283) 2.1±1.0 (1.7) 1.8±0.5 (1.7) 293±104 (281) 7.5±4.4 (6.8) 153±75.1 (139) GT+TT T: 0.33 93.2±25.0 (90.0) 81.6±29.6 (78.3) 290±111 (281) 1.9±0.7 (1.7) 1.7±0.5 (1.7) 281±92 (286) 6.3±2.5 (5.9) 153±75.0 (163) Intron4 4b4b 4b: 0.85 97.7±29.0 (91.8) 84.8±34.4 (78.0) 308±117 (284) 2.0±0.9 (1.7) 1.8±0.6 (1.7) 288±101 (281) 6.8±3.7 (5.9) 155±76.3 (153) 4b4a+4a4a 4a: 0.15 91.9±20.1 (87.8) 83.1±27.6 (74.0) 271±86 (271) 1.8±0.6 (1.7) 1.6±0.4 (1.6) 281±89 (284) 6.9±3.0 (6.6) 148±70.9 (139) Data are presented as mean±SD and median in parentheses. The genotype distribution for each polymorphism was tested for possible deviation from HWE. No significant deviation was detected.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPTTable 3A. Serum folate levels in accordance with eNOS genotype polymorphisms after supplementation with folic acid or placebo.

Baseline 2wk Baseline 2wk Trial I Folic acid Folic acid p-value N Placebo Placebo p-value 786-T>C TT (27) 19.1±7.5 (17.8) 34.0±11.7 (32.0) <0.0001 (20) 16.9±5.3 (15.8) 17.7±4.5 (16.9) 0.3 TC+CC (23) 16.9±4.9 (15.7) 52.2±44.6 (36.5) <0.0001 (26) 16.0±5.9 (15.9) 17.4±7.4 (15.7) 0.09 894-G>T GG (21) 19.9±6.7 (19.9)* 35.4±11.6 (34.5) <0.0001 (19) 16.8±5.1 (16.6) 17.3±3.8 (16.8) 0.5 GT+TT (29) 16.7±6.0 (15.5) 49.0±43.0 (35.0) <0.0001 (27) 16.2±6.0 (15.6) 17.7±7.6 (16.1) 0.05 Intron4 4b4b (39) 18.0±6.7 (16.7) 44.8±37.3 (34.3) <0.0001 (30) 15.8±5.2 (15.0) 16.7±4.7 (15.6) 0.1 4b4a+4a4a (11) 18.3±5.9 (18.6) 36.8±12.7 (36.6) 0.003 (16) 17.7±6.2 (16.6) 19.1±8.3 (17.0) 0.3

Baseline 2wk Baseline 2wk Trial II Folic acid Folic acid p-value N Placebo Placebo p-value 786-T>C TT (18) 16.4±5.1 (15.5) 40.5±32.3 (31.0) 0.0004 (27) 24.2±8.7 (25.8) 23.0±8.0 (22.2) 0.07 TC+CC (23) 16.1±6.7 (15.3) 33.4±22.1 (27.3) <0.0001 (21) 22.7±5.5 (22.9) 20.8±4.4 (21.8) 0.09 894-G>T GG (18) 16.4±5.1 (15.4) 35.5±28.9 (30.3) 0.0005 (21) 24.4±7.2 (24.3) 22.6±5.5 (23.4) 0.03 GT+TT (23) 16.1±6.7 (15.3) 37.2±26.0 (28.6) <0.0001 (27) 22.9±7.6 (22.9) 21.6±7.5 (20.1) 0.2 Intron4 4b4b (25) 15.4±5.0 (13.8) 40.2±32.6 (28.6) <0.0001 (39) 23.6±7.8 (23.6) 22.1±7.2 (21.2) 0.02 4b4a+4a4a (16) 17.5±7.3 (15.9) 30.0±8.5 (30.1) 0.001 (9) 23.2±5.4 (23.3) 21.8±4.7 (23.6) 0.3 Data are presented as Mean±SD (median) nmol/L. P-value < 0.05 shows significant difference. *P<0.03. Table 3B. p-tHcy concentrations in accordance with eNOS gene polymorphisms after supplementation with folic acid or placebo.

Baseline 2wk Baseline 2wk Trial I Folic acid Folic acid p-value N Placebo Placebo p-value 786-T>C TT (27) 7.7±2.0 (7.6) 7.1±1.4 (6.9) 0.08 (19) 8.1±2.3 (7.3) 8.2±1.8 (7.9) 0.8 TC+CC (23) 7.7±1.8 (7.5) 7.1±1.3 (7.3) 0.002 (26) 9.2±5.2 (8.6) 8.8±3.5 (8.0) 0.4 894-G>T GG (21) 7.6±1.6 (7.3) 7.1±1.3 (6.9) 0.01 (18) 8.2±2.1 (7.6) 8.0±1.9 (7.7) 0.4 GT+TT (29) 7.7±2.1 (7.7) 7.1±1.3 (7.2) 0.02 (27) 9.1±5.2 (8.4) 8.9±3.3 (8.2) 0.9 Intron4 4b4b (39) 7.7±2.0 (7.7) 7.2±1.4 (7.0) 0.007 (29) 8.1±2.2 (7.5) 8.0±1.8 (7.9) 0.6 4b4a+4a4a (11) 7.3±1.4 (7.3) 6.8±1.2 (6.8) 0.02 (16) 9.9±6.4 (8.3) 9.5±4.0 (8.3) 0.9

Baseline 2wk Baseline 2wk Trial II Folic acid Folic acid p-value N Placebo Placebo p-value 786-T>C TT (19) 8.5±2.5 (7.6) 8.3±2.5 (7.6) 0.7 (27) 7.2±2.3 (7.3) 8.7±4.4 (8.1) <0.0001 TC+CC (23) 10.0±5.8 (8.7) 9.0±5.1 (7.5) 0.01 (23) 7.1±1.4 (7.2) 8.4±2.1 (8.4) 0.0001 894-G>T GG (19) 8.5±2.7 (7.8) 8.4±2.5 (7.8) 0.7 (22) 7.2±1.2 (7.5) 8.2±1.6 (8.1) 0.0007 GT+TT (23) 10.0±5.8 (8.7) 8.9±5.0 (7.3) 0.009 (28) 7.1±2.4 (6.9) 8.9±4.6 (8.1) <0.0001 Intron4 4b4b (39) 8.0±1.8 (7.6)* 7.4±1.7 (6.7)** 0.2 (26) 7.2±2.1 (7.2) 8.6±3.8 (8.1) <0.0001 4b4a+4a4a (11) 11.4±6.8 (9.0) 11.1±6.0 (8.9) 0.04 (16) 7.1±1.1 (7.2) 8.6±2.5 (7.8) 0.0009 Data are presented as Mean±SD (median) µmol/L. P-value < 0.05 shows significant difference. *P=0.04 and **P=0.003.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPTTable 4A. Serum nitrate concentrations in accordance with eNOS and folate metabolizing gene polymorphism after supplementation with folic acid or placebo.

Baseline 2 wk Baseline 2 wk Trial I Folic acid Folic acid p-value N Placebo Placebo p-value 786-T>C TT (27) 22.3±17.7 (17.2) 17.8±7.9 (16.9) 0.6 (19) 18.9±10.8 (16.1) 18.2±6.5 (18.5) 0.8 TC+CC (23) 22.7±11.9 (20.9) 21.0±11.0 (19.4) 0.9 (26) 22.5±21.4 (15.9) 15.6±5.8 (14.5) 0.2 894-G>T GG (21) 20.4±14.1 (18.6) 17.8±7.3 (16.6) 1.0 (18) 26.1±24.7 (16.3) 17.6±5.4 (16.5) 0.2 GT+TT (29) 24.0±16.0 (21.9) 20.7±11.1 (19.1) 0.5 (27) 17.5±9.9 (16.1) 16.2±6.7 (14.5) 0.9 Intron4 4b4b (39) 23.4±16.9 (19.9) 18.4±8.2 (17.8) 0.3 (30) 20.0±17.0 (16.0) 16.4±6.5 (14.5) 0.5 4b4a+4a4a (11) 19.3±5.8 (19.3) 22.3±13.1 (20.4) 0.3 (15) 23.0±19.3 (16.4) 17.6±5.7 (16.0) 0.7 MTHFR-677C>T CC (24) 16.9±6.2 (17.6)* 17.6±7.0 (17.1) 0.3 (17) 24.9±23.1 (16.6) 17.5±6.5 (15.1) 0.5 CT +TT (26) 27.7±18.9 (23.6) 20.9±11.1 (18.6) 0.3 (28) 18.6±13.2 (16.0) 16.4±6.1 (15.1) 0.6 MTHFR-1298A>C AA (22) 21.2±12.4 (18.4) 20.1±10.8 (19.4) 0.9 (24) 21.4±15.7 (16.6) 17.7±6.2 (16.0) 0.6 AC+CC (28) 23.5±17.2 (20.7) 18.7±8.6 (17.0) 0.6 (21) 20.5±20.0 (13.6) 15.5±6.1 (14.4) 0.5 RFC1-80G>A GG (17) 21.8±13.4 (19.3) 20.9±7.8 (20.2) 0.5 (10) 20.8±18.9 (15.7) 17.3±6.5 (15.9) 0.8 GA (21) 22.7±15.8 (22.5) 19.8±12.0 (17.8) 0.5 (22) 21.5±19.3 (16.7) 16.9±7.1 (14.8) 0.6 AA (12) 23.1±17.6 (19.7) 16.1±5.1 (17.4) 0.5 (13) 20.3±14.7 (15.7) 15.9±4.0 (15.3) 0.2 MTHFD1-1985G>A GG (17) 21.4±15.9 (21.0) 17.3±8.2 (14.3) 0.8 (17) 24.0±23.1 (16.0) 16.8±5.9 (14.4) 0.6 GA (22) 21.6±10.4 (19.2) 20.3±11.5 (18.1) 0.4 (20) 20.6±14.5 (16.7) 16.2±6.2 (15.3) 0.1 AA (11) 25.9±21.9 (19.3) 21.1±7.5 (21.5) 0.4 (8) 15.4±10.1 (11.0) 17.6±7.1 (16.8) 0.2 MTR-2756A>G AA (29) 22.2±15.1 (19.5) 19.2±8.5 (17.8) 1.0 (28) 24.0±21.4 (16.9) 16.7±6.0 (15.1) 0.3 AG+GG (21) 22.9±15.7 (20.9) 19.6±11.2 (18.9) 0.5 (17) 16.0±6.2 (16.0) 16.9±6.7 (14.7) 0.9 DHFR-19del WW (16) 21.2±10.8 (20.9) 20.1±7.9 (18.9) 0.7 (22) 18.6±12.4 (16.2) 16.4±7.1 (15.0) 0.9 WD (22) 20.6±15.1 (17.3) 20.5±11.9 (18.3) 0.2 (14) 22.3±23.3 (16.2) 17.1±5.1 (15.1) 0.9 DD (12) 27.7±19.8 (22.6) 16.9±7.1 (15.8) 0.008 (9) 24.7±19.7 (16.1) 16.8±6.0 (14.3) 0.1 TS 2R2R (13) 28.6±23.9 (19.9) 21.7±13.6 (20.0) 0.6 (10) 19.4±19.7 (13.6)** 17.9±5.9 (16.1) 0.7 2R3R (21) 21.0±9.7 (20.9) 19.1±7.7 (18.7) 0.2 (27) 16.9±7.4 (16.1) 16.2±6.7 (14.2) 0.8 3R3R (16) 19.5±11.3 (16.3) 17.7±7.5 (17.4) 0.9 (8) 36.8±29.9 (24.4) 17.0±4.8 (15.2) 0.1 Data are presented as Mean±SD (median) µmol/L. P-value < 0.05 shows significant difference. *P=0.01 and **P=0.05.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPTTable 4B. Serum nitrate concentrations in accordance with eNOS and folate metabolizing gene polymorphism after supplementation with folic acid or placebo. Baseline 2 wk Baseline 2 wk Trial II Folic acid Folic acid p-value N Placebo Placebo p-value 786-T>C TT (18) 17.6±6.7 (17.4) 19.5±10.6 (17.2) 0.5 (27) 14.7±7.8 (12.2)* 19.0±14.5 (16.1) 0.06 TC+CC (23) 16.2±5.8 (14.6) 17.4±8.2 (15.2) 0.9 (22) 16.3±5.2 (15.1) 22.2±14.8 (19.8) 0.08 894-G>T GG (18) 16.4±5.2 (17.2) 19.4±10.0 (16.7) 0.8 (22) 14.6±4.8 (12.6) 17.8±7.0 (16.9) 0.1 GT+TT (23) 17.2±6.9 (15.6) 17.5±8.8 (14.2) 0.3 (27) 16.1±8.0 (14.9) 22.6±18.5 (15.8) 0.03 Intron4 4b4b (25) 16.4±5.8 (17.1) 17.7±9.9 (13.6) 0.5 (38) 15.1±7.3 (12.2) 20.9±16.0 (16.9) 0.01 4b4a+4a4a (16) 17.4±6.8 (15.5) 19.2±8.1 (16.4) 0.8 (11) 16.5±4.5 (14.9) 19.0±8.2 (14.9) 0.5 MTHFR-677C>T CC (16) 16.2±6.4 (15.8) 14.1±6.1 (13.1)* 0.3 (22) 15.8±8.3 (12.5) 15.6±5.3 (15.4)*** 0.7 CT+TT (25) 17.2±6.1 (17.1) 21.0±10.0 (16.2) 1.0 (27) 15.2±5.3 (14.0) 24.4±18.3 (23.0) 0.003 MTHFR-1298A>C AA (24) 17.8±7.0 (17.2) 18.8±9.6 (16.1) 0.6 (23) 17.7±8.1 (14.9) 18.4±6.6 (16.1) 0.5 AC+CC (17) 15.4±4.6 (15.0) 17.4±8.8 (14.6) 0.7 (26) 13.4±4.6 (12.3) 22.2±19.1 (17.3) 0.005 RFC1-80G>A GG (17) 17.4±8.3 (16.5) 14.6±7.1 (14.5) 0.2 (10) 13.8±4.5 (12.3) 21.6±17.1 (17.9) 0.02 GA (21) 17.5±6.3 (17.0) 19.3±9.7 (15.7) 0.7 (22) 17.3±8.8 (14.9) 21.6±16.1 (17.0) 0.2 AA (12) 15.3±3.9 (15.0) 18.7±9.6 (13.1) 0.6 (13) 14.3±4.2 (12.5) 17.0±6.4 (15.4) 0.3 MTHFD1-1958G>A GG (15) 16.2±4.9 (16.5) 16.4±9.4 (14.6) 0.2 (18) 15.5±7.4 (13.3) 17.6±7.1 (16.6) 0.3 GA (19) 16.9±7.8 (14.3) 19.9±9.5 (16.2) 0.7 (21) 15.3±6.0 (12.7) 20.1±16.0 (16.1) 0.03 AA (7) 17.9±3.1 (17.4) 17.0±7.9 (13.6) 0.5 (10) 15.6±7.9 (14.6) 24.8±20.8 (19.9) 0.1 MTR-2756A>G AA (25) 15.7±4.4 (15.6) 16.3±8.4 (14.3) 0.06 (28) 14.8±6.3 (13.6) 20.5±18.9 (14.2)** 0.2 AG+GG (16) 18.6±8.0 (17.3) 21.6±9.9 (21.1) 0.6 (21) 16.3±7.4 (12.9) 20.4±5.5 (18.9) 0.03 DHFR-19del WW (18) 15.5±5.3 (14.7) 17.0±9.3 (14.2) 0.5 (14) 16.3±7.7 (13.9) 23.5±17.5 (19.8) 0.08 WD (14) 18.0±5.7 (17.5) 20.8±9.7 (19.9) 0.7 (22) 14.4±6.2 (13.7) 19.5±16.3 (15.4) 0.1 DD (9) 17.7±8.3 (17.4) 16.8±8.4 (14.9) 0.3 (13) 16.2±6.9 (12.4) 18.7±6.3 (17.0) 0.2 TS 2R2R (9) 19.4±5.7 (18.3) 18.2±8.1 (14.6) 0.3 (13) 17.9±10.1 (14.9) 22.3±20.2 (16.8) 0.4 2R3R (25) 16.7±6.2 (16.1) 18.8±9.5 (15.7) 0.8 (20) 15.5±5.2 (13.2) 18.7±6.1 (17.6) 0.06 3R3R (7) 14.0±6.1 (14.3) 16.6±10.3 (13.1) 0.9 (16) 13.4±4.5 (12.6) 21.1±17.4 (15.4) 0.07 Data are presented as Mean±SD (median) µmol/L. P-value < 0.05 shows significant difference. *P=0.04, **P=0.03 and ***P=0.02.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

Methionine

Homocysteine

qBH2

BH2

BH4

L-arginine

NO

NO2- , NO3

-

DHF

THF

Folic acid

5,10-methyleneTHF

dTMP

dUMP

Purines

B2

B12

B6

4

1

2

3

10

8

1

1

DNA synthesis

97

O2-, H2O2

BH2

10-formylTHF

5

Cytoplasma

Cell membrane

5-methylTHF

5-methylTHF

RFC1

5-methylTHF

5,10-methenylTHF

Remethylation

6

Figure 1: Folate metabolism. The figure is modified from previously published study [10].

Enzymes: 1. Dihydrofolate reductase; 2. Serine hydroxymethyltransferase; 3. 5, 10-methylenetetrahydrofolate reductase; 4. Methionine

synthase; 5. Methylenetetrahydrofolate dehydrogenase; 6. Methenyltetrahydrofolate cyclohydrolase; 7. Formyltetrahydrofolate synthase; 8.

Thymidylate synthase; 9. Dihydropteridine reductase; 10. Endothelial nitric oxide synthase.

Vitamins: B2; B6 and B12.

Abbreviations: DHF, dihydrofolate; THF, tetrahydrofolate; 5-methylTHF, 5-methyltetrahydrofolate; qBH2, quinonoid-7,8-dihydrobiopterine;

BH2, 7,8-dihydrobiopterine; BH4, tetrahydrobiopterine; NO, nitric oxide; NO2-, nitrite; NO3

- nitrate.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

n=50

Blood collection

PlaceboFolic acid

Trial I Trial II

14 days

Washout period

14 days14 days

Placebo Folic acid

Study design

14 days 14 days 14 days

Washout periodn=50

Blood collection Blood collection Blood collection

Figure 2: Study design.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPTHighlights (for review)

• A double-blind cross over study with folic acid supplementation (800 µg/day) during two weeks.

• We examine whether genetic polymorphisms in endothelial nitric oxide synthase (eNOS) and genes involved in folate metabolism affect the concentration of serum nitrate, serum folate and plasma total homocysteine in healthy subjects after folic acid supplementation.

• Polymorphisms in eNOS and folate genes affect the concentration of serum folate and p-tHcy but do not have any impact on the concentration of NO3.