ECOLOGY OF CULEX (MELANOCONION) CEDECEI, VECTOR OF...

ECOLOGY OF CULEX (MELANOCONION) CEDECEI, VECTOR OF EVERGLADES VIRUS IN FLORIDA

By

ISAIAH J. HOYER

A THESIS PRESENTED TO THE GRADUATE SCHOOL

OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2017

To my father, Kevin R. Hoyer and mother Ava L. Hoyer. You have both supported me from Alaska to Florida, and everywhere in between.

4

ACKNOWLEDGMENTS

I would like to thank Dr. Nathan Burkett-Cadena for his guidance and council.

Much of the work presented is attributed to Dr. Burkett-Cadena’s ingenuity and shared

interest in sylvatic cycles of mosquito-host interactions. I thank Dr. Jonathan Day and

Dr. Phil Lounibos for their insightful feedback and support. I extend my gratitude to Dr.

Erik Blosser for his occasional visits to the field, shared knowledge, and support. I thank

Lary Reeves for acquiring the Everglades National Park permit, his company in the

Everglades, and his contagious broad exuberant enthusiasm for the natural world. I

further extend my thanks to the FMEL technicians who performed a large part of

bloodmeal extractions and PCR assays, Carolina Acevedo, Tanise Stenn, Anna

Thompson, and Jordan Vann; additionally, thanking Glauber Rocha Pereira for his

assistance identifying CO2-baited CDC light-trap mosquito samples. Lastly, I express

warm regards to my friends and family for their unwavering encouragement.

5

TABLE OF CONTENTS page

ACKNOWLEDGMENTS ............................................................................................ 4

LIST OF TABLES ...................................................................................................... 6

LIST OF FIGURES .................................................................................................... 7

ABSTRACT ............................................................................................................... 9

CHAPTER

1 INTRODUCTION .............................................................................................. 11

2 INVESTIGATING SEASONAL AND REGIONAL PATTERNS OF CULEX (MELANOCONION) CEDECEI HOST UTILIZATION ....................................... 16

Materials and Methods...................................................................................... 16 Data Analysis .................................................................................................... 25 Results .............................................................................................................. 28

3 UNDERSTANDING PATTERNS OF MOSQUITO HOST UTILIZATION THROUGH PASSIVE AND ACTIVE CAPTURE TECHNIQUES ...................... 46

Materials and Methods...................................................................................... 46 Data Analysis .................................................................................................... 52 Results .............................................................................................................. 54

4 DISCUSSION ................................................................................................... 64

IRC Resting Shelter Sampling .......................................................................... 64 ENP Mosquito Collections ................................................................................ 65 Bloodmeal Analysis of Blood-Engorged Culex (Melanoconion) cedecei ........... 69 Mosquito Drift Fence, Wildlife Cameras, and Modified no. 17 Trinidad Trap .... 73 Implications for Everglades Virus Transmission in Florida ................................ 78

LIST OF REFERENCES ......................................................................................... 82

BIOGRAPHICAL SKETCH ...................................................................................... 86

6

LIST OF TABLES

Table page

2-1 Adult mosquitoes sampled from resting shelters in Indian River County ...... 33

2-2 Adult mosquitoes sampled by resting shelters from Everglades National Park .............................................................................................................. 34

2-3 Adult mosquitoes sampled by CO2-baited CDC miniature light-traps from Everglades National Park ............................................................................. 35

2-4 Hosts of Culex (Melanoconion) cedecei from Everglades National Park and Indian River County ............................................................................... 36

2-5 Total Culex cedecei bloodmeals from brown rat/roof rat, hispid cotton rat, and cotton mouse in Everglades National Park ............................................ 37

3-1 Adult mosquitoes sampled from mosquito drift fence ................................... 57

7

LIST OF FIGURES

Figure page 2-1 Wireframe resting shelter, sensu Burkett-Cadena (2011a) ........................... 38

2-2 PVC resting shelter ....................................................................................... 39

2-3 Pop-up resting shelter .................................................................................. 40

2-4 Demonstration of sampling mosquitoes from pop-up resting shelter in Everglades National Park ............................................................................. 41

2-5 Hand-held aspirator fitted collection cup and removable funnel ................... 42

2-6 Monthly wireframe resting shelter collections of Culex cedecei from Indian River County ...................................................................................... 43

2-7 Comparison of PVC and wireframe resting shelter sampling methods in Indian River County ...................................................................................... 43

2-8 Seasonal patterns of Culex cedecei abundance from sampling sites in Everglades National Park ............................................................................. 44

2-9 Comparison of PVC resting shelter and natural aspiration sampling method in Everglades National Park ............................................................ 44

2-10 Seasonal patterns of host use by Culex cedecei from Indian River County ...................................................................................... 45

2-11 Seasonal patterns of host use by Culex cedecei from Everglades National Park ............................................................................. 45

3-1 Mosquito drift fence ...................................................................................... 58

3-2 Close-up of a “sticky-clock” suction device and mosquito drift fence ............ 58

3-3 Wildlife camera (Stealth Cam G42NG), used for capturing animal activity patterns ........................................................................................................ 59

3-4 Modified no. 17 Trinidad trap ........................................................................ 60

3-5 Circadian activity of Culex cedecei ............................................................... 61

3-6 Day and night activity patterns of mammal (10 species) and mourning dove in Indian River County .......................................................... 61

3-7 Attraction of Culex cedecei to modified no. 17 Trinidad trap baited with animal, compared to unbaited traps ............................................................. 62

8

3-8 Circadian activity of Culex cedecei and mammalian host animals................ 62

3-9 Relationship between nocturnal activity and host use by Culex cedecei for 10 mammal species ................................................................................ 63

9

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science

ECOLOGY OF CULEX (MELANOCONION) CEDECEI, VECTOR OF EVERGLADES

VIRUS IN FLORIDA

By

Isaiah J. Hoyer

May 2017

Chair: Nathan Burkett-Cadena Major: Entomology and Nematology

Culex (Melanoconion) cedecei is the principal vector of Everglades virus in

Florida, a subtype of Venezuelan equine encephalitis virus complex, circulating among

wild rodents and mosquitoes. Field studies were conducted in Florida to elucidate Culex

cedecei and vertebrate host interactions in Indian River County and Everglades

National Park, Florida, USA. Blood-engorged female Culex cedecei were sampled using

primarily resting shelters. Host associations were determined using PCR bloodmeal

analysis techniques targeting 16s and cytochrome b mitochondrial DNA of host animals.

Host and vector activity patterns were quantified using wildlife camera and mosquito

drift fence trapping, respectively. Results of these studies revealed that Culex cedecei

primarily feeds upon mammals, particularly rodents, the reservoir hosts of Everglades

virus. In Everglades National park, nearly 98% of bloodmeals were identified as rodents,

in contrast to previous work from the late 1970’s in which rodents accounted for

approximately half of Culex cedecei hosts. This shift in host use is likely related to

changes in the mammal community in the Everglades, with decreased availability of

medium and large mammals. Host circadian activity patterns were generally similar to

10

that of Culex cedecei, however some mammals whose activity patterns overlapped with

Culex cedecei were underrepresented in the bloodmeal identifications. These results

may indicate that animal circadian activity does not necessarily conform with vector-host

use. In conclusion, these findings suggest an expected increase in prevalence of

Everglades virus in Florida.

11

CHAPTER 1 INTRODUCTION

Everglades virus (EVEV) is an endemic pathogen to the state of Florida that

circulates among mosquito vectors and small mammalian hosts, predominantly rodents

(Edman 1979; Weaver et al. 1986; Coffey et al., 2004). Everglades virus is placed in the

family Togaviridae, genus Alphavirus, and is subtype II within the Venezuelan equine

encephalitis (VEE) complex (Weaver et al. 2004). Historically, EVEV was considered a

variant of VEE until phylogenetic analysis and descriptions of VEE antigenic variants

indicated a clear distinction (Young and Johnson 1969; Calisher et al.,1980). Like other

viruses in the Alphavirus genus, EVEV is enveloped, spherical in shape, with of a

messenger-sense, single-stranded RNA genome (Weaver et al. 2004). Everglades virus

is thought to have been introduced into North America ca. 100–150 years ago, where it

diverged from other VEE lineages (Weaver et al. 1992).

Everglades virus may infect humans and cause a nonspecific, flu-like, febrile

illness and, in some cases, encephalitis (swelling of the brain), which can lead to

serious neurological damage (Coffey et al., 2006). Extensive field surveys and

laboratory studies concluded Culex (Melanoconion) cedecei Stone and Hair, is the

primary vector of EVEV (Chamberlain et al. 1969; Weaver et al. 1986). Host-feeding

patterns and vector incrimination studies failed to identify other mosquito species

involved in EVEV transmission (Edman 1979; Coffey and Weaver 2005). Extensive field

surveys throughout Southern Florida detected high levels of EVEV antibodies in rodents

relative to other mammals, therefore suspecting rodent involvement in EVEV

maintenance and amplification (Chamberlain et al. 1969; Lord et al. 1973; Bigler and

Hoff 1975). Laboratory studies concluded Peromyscus gossypinus (Le Conte) (cotton

12

mouse) and Sigmodon hispidus Say and Ord (hispid cotton rat) were competent

reservoir hosts of EVEV (Bigler et al. 1974a; Coffey et al. 2004).

The distribution of EVEV is not well documented (Coffey et al. 2006). Everglades

virus was first reported from a serologic survey of Seminole Native Americans, who

reside north of Everglades National Park in Brighton and Big Cypress reservations

(Work 1964). The Seminole Native American’s hemagglutination-inhibition (HI) antibody

incidence of EVEV was as high as 58%, indicating frequent exposure (Work 1964).

Over the years, reported EVEV isolations, human cases or antibody detection, and

other non-human incidence, have been restricted to south and central Florida

(Chamberlain et al. 1964, 1969; Sudia et al. 1968; Lord et al. 1973; Ventura et al. 1974).

The true extent of EVEV in humans is likely underreported, due to the lack of severity

and non-descriptive symptoms in infected persons (Coffey et al. 2006).

The currently accepted northernmost extent of EVEV is Indian River County (Day

et al. 1996). However, serologic evidence of EVEV in dogs has been reported as far

north as Tallahassee (Coffey et al. 2006). It is important to note that many of the EVEV

seropositive dogs had no travel history to southern Florida, i.e. they were outside the

known transmission zone of EVEV (Coffey et al. 2006). Everglades virus transmission is

suspected to be driven largely by the range of the primary vector, Cx. cedecei (Coffey et

al. 2004, 2006). Although not well defined, the current documented range of Cx. cedecei

is southern and central Florida, as far north as Brevard County (Darsie and Ward 2005).

There is currently no definitive explanation of how EVEV antibodies occurred in dogs

outside the range of Cx. cedecei (Coffey et al. 2006). Literature regarding Cx. cedecei

13

ecology is sparse, largely due to lack of systematic sampling and the difficulty of

identifying Cx. cedecei based on morphology (Belkin 1969; Coffey et al. 2006).

To elucidate the vector-host interactions in context of EVEV transmission, field

studies and laboratory analyses were performed to investigate seasonal and regional

patterns of Cx. cedecei host utilization through bloodmeal analysis of field-collected

females from Indian River County and Everglades National Park. These studies

included active and passive sampling techniques to quantify mosquito and host

behavior, respectively employing a mosquito drift fence and wildlife cameras. Data

resulting from these studies were used explore relationships between host activity and

host utilization by Cx. cedecei.

Past work in the Everglades virus episystem, such as Edman (1979),

documented host-feeding patterns of Melanoconion in Everglades National Park and in

swamp-hammocks of Indian River County. Edman (1979) collected mosquitoes from

Mahogany Hammock in Everglades National Park and Schwey Hammock in Indian

River County. Following Edman (1979), mosquitoes sampled for this thesis were

collected in Everglades National Park, including Mahogany Hammock, and mosquitoes

were collected in Indian River County, specifically from South Oslo Riverfront

Conservation Area (SORCA) and surrounding property of the Florida Medical

Entomology Laboratory (FMEL).

Within Everglades National Park, there is strong evidence of a severe decline in

mammal populations (Dorcas et al. 2012). The decline in several species of mammals is

theorized to be caused by the invasion of generalist apex predators, the introduced

Python molurus bivittatus Kuhl (Burmese python) in particular (Dorcas et al. 2012;

14

McCleery et al. 2015). The Burmese python was sighted irregularly about 20 years prior

to recognition as an established species in the year 2000 (Dorcas et al. 2012).

Presently, nearly four decades have passed since Edman (1979). The following thesis

touches upon how severe declines in Everglades National Park mammal populations

have potentially affected the bloodmeal opportunities of Cx. cedecei, and therefore the

sylvatic cycle of EVEV transmission. The prospect of new bloodmeal analyses from

Everglades National Park Cx. cedecei, offers opportunities to examine potential shifts in

host use due to changes in host availability. There are no reports about the seasonality

of host-vector interactions with respect to EVEV transmission. Past authors have

reflected how host-density, age ratios, and breeding activity of cotton mice and hispid

cotton rats may affect the seasonality of EVEV transmission (Bigler et al. 1974b;

Ventura et al. 1974; Bigler and Jenkins 1975). Seasonal patterns of EVEV antibodies

were detected using HI tests on tagged cotton mice and hispid cotton rats from two

hammocks north of Everglades National Park in Pinecrest, FL (Bigler et al. 1974b).

Everglades virus antibodies in the tagged cotton mice and hispid cotton rats peaked

between July and October, coinciding with the ENP wet season when high water levels

increase densities of the two species, and when the populations were composed of

mostly mature breeding individuals (Bigler et al. 1974b; Bigler and Jenkins 1975).

Understandings of vertebrate-host seasonality and arthropod-vector blood feeding

patterns are important components of all arbovirus transmission cycles (Ostfeld and

Keesing 2000; Kilpatrick et al. 2006).

To elucidate the ecological mechanisms that contribute to EVEV transmission, a

better understanding of vector-host interactions and EVEV vector and host infection

15

rates is needed. Incidentally, Cx. cedecei is a competent vector of VEE epizootic

subtype IAB (Weaver et al. 1986). Mass morbidity and sometimes mortality in humans

is attributed to VEE epizootic subtype IAB spill over from equines (Weaver et al. 2004).

The epizootic VEE subtype IAB appears to result from a single amino-acid substitution

in the E2 envelope glycoprotein enzootic VEE serotypes (Weaver et al. 2004). The

mosquito vector and vertebrate host range of VEE is altered by the mutation, supporting

proliferation in different mosquito vectors and highly efficient amplification in equines

(Weaver et al. 2004). Although Aedes taeniorhynchus Wiedemann and Culex

nigripalpus Theobald are not competent vectors of EVEV, they are competent vectors of

VEE subtype IAB (Coffey and Weaver 2005; Weaver et al. 2004). Aedes

taeniorhynchus and Culex nigripalpus exhibit mammalophilic feeding behavior, are

aggressive biters, and come into close contact with people (Coffey and Weaver 2005).

Aedes taeniorhynchus and Culex nigripalpus are likely candidates to serve as bridge

vectors of VEE subtypes to humans from rodent populations (Coffey and Weaver 2005).

Under what circumstances will enzootic strains of VEE such as EVEV, mutate into

epizootic strains? Specific mechanisms that facilitate VEE enzootic to epizootic

emergence are yet to be elucidated (Weaver et al. 2004). Millions of Floridians and

especially those that live in areas known to support EVEV transmission such as the

Miami-Dade region, are susceptible to EVEV and VEE related pathogens (Chamberlain

et al. 1969; Weaver et al. 1986; Coffey and Weaver 2005).

16

CHAPTER 2 INVESTIGATING SEASONAL AND REGIONAL PATTERNS OF CULEX

(MELANOCONION) CEDECEI HOST UTILIZATION

Materials and Methods

Various sampling methods were explored to determine the most efficient means

of collecting Cx. cedecei. For Indian River County (IRC) sampling, the efficacy of

wireframe (Figure 2-1) and PVC (Figure 2-2) resting-shelters were evaluated. In

Everglades National Park (ENP) the use of PVC (Figure 2-2) and pop-up (Figure 2-3,

Figure 2-4) resting-shelters, natural aspirations and CO2-baited CDC miniature light-

traps were evaluated. The objective was to identify techniques that would produce the

greatest quantity of Cx. cedecei for bloodmeal analysis.

Resting Shelter Designs and Collection Technique

Three different resting-shelter designs were employed: wireframe (Burkett-

Cadena 2011a), PVC, and pop-up. All resting-shelters were similar in size and shape,

i.e. cylindrical, roughly 150 liters in volume, 0.9 meters in height, and 1.3 meter

circumference.

The wireframe resting-shelters were constructed from galvanized metal wire field

fencing, heavy-duty black garbage bags, and black duct tape (Figure 2-1) (Burkett-

Cadena 2011a).

The PVC resting-shelters were composed of half-inch polyvinyl chloride (PVC)

piping, heavy-duty black garbage bags, rubber bands, and binder clips (Figure 2-2).

Each PVC resting-shelter was composed of three 1.27 centimeter (half-inch) PVC

pipes, 0.9 meters in length, two 1.3 meter polyethylene circles, four 1.27 centimeter

(half-inch) polyethylene couplings to connect the two polyethylene circles, six PVC “t”

couplings to connect the PVC pipes and polyethylene circles, rubber bands to hold the

17

PVC “t” couplings in place, a heavy-duty black garbage bag, and large binder clips to

fasten the black garbage bags to the PVC and polyethylene structure. PVC resting-

shelters were fully collapsible, enabling the user to break them down for transport

The pop-up resting-shelters were made of a heavy duty black garbage bags,

black duct tape, and roughly three meters of flexible metal spring (Figure 2-3). The

metal spring for each pop-up resting-shelter was derived from a spiral pop-up hamper. I

used black duct tape to adhere the metal spring to the outside of a heavy-duty black

garbage bag, providing the rigid cylindrical shape and dimensions similar to that of the

wireframe and PVC resting-shelters. Uniquely, the spring allows the user to collapse the

pop-up resting-shelter into a circle (Figure 2-4).

A handheld battery-powered aspirator fitted with a collection cup and funnel, was

used to extract mosquitoes from each resting-shelter (Figure 2-5). The funnel on the

aspirator fitted snuggly in each resting-shelter, which increased mosquito collection

efficiency. The funnel increased collection efficiency by reducing the chances of

mosquitoes escaping, creating a vortex that directed specimens towards the collection

cup, and increased battery life via less time spent aspirating per resting-shelter.

IRC Resting Shelter Sampling

Mosquito collections in IRC took place on the campus of the Florida Medical

Entomology Laboratory (FMEL) and neighboring property of the South Oslo Riverfront

Conservation Area (SORCA). Collections from resting-shelters occurred two–three

times per week between 08:00 and 11:00, from January 13 to December 06, 2016.

Along a roughly 300 meter path through various sylvatic habitats of these

properties, 20 wire-frame resting-shelters were haphazardly placed in the shade when

18

possible. A handheld battery-powered aspirator fitted with a collection cup and a funnel,

was used to extract mosquitoes from each resting-shelter, as described above.

Mosquitoes were sampled a total of 85 days, specifically, 5 days in January, 6

days in February, 7 days in March, 8 days in April, 10 days in May, 8 days in June, 8

days in July, 10 days in August, 8 days in September, 7 days in October, 6 days in

November, and 2 days in December.

IRC Wireframe and PVC Resting Shelter Comparison

A comparison of wireframe and PVC resting shelters at IRC was performed to

investigate the efficacy for sampling Cx. cedecei. Ten wireframe resting shelters were

compared with ten PVC resting shelters. Of the 20 actively used wireframe resting

shelters haphazardly placed in IRC, 10 were selected using a random number

generator. A PVC resting shelter was then placed within three meters of each of the

selected wireframe resting shelters. The duration of the experiment was six days during

May 2016. Mosquitoes were collected from each resting shelter with a handheld battery-

powered aspirator. Collections from each resting shelter were kept separate.

ENP Sampling Sites

The Everglades National Park Service permitted sampling from up to 8 locations

along the approximately 64 kilometer Main Park road between Long Pine Key and

Flamingo, including target areas near Pay-hay-okee overlook, Mahogany Hammock,

Nine Mile Pond, and Snake Bight trailhead. Sampling was restricted within 300 feet from

the centerline of a Main Park Road or within 150 feet of respective trails.

ENP sites were established by preliminary sampling from diverse sites,

representing a broad range of habitats in ENP. The name and location of sites sampled

19

in ENP in the order of closest to the ENP visitors center (park entrance) were: Road to

Anhinga (25°24'08.3"N, 80°36'56.7"W), Long Pine Key (25°24'00.1"N, 80°39'35.4"W),

Twin Pine Hammock (25°25'3.00"N, 80°38'20.00"W), Pinelands (25°25'24.8"N,

80°40'47.0"W), Road to Pa-hay-okee Hammock (25°25'56.0"N, 80°46'38.9"W), Pa-hay-

okee Hammock (25°26'27.2"N, 80°47'01.6"W), Decoy Hammock (25°21'24.00"N,

80°49'20.00"W), Road to Mahogany Hammock (25°20'20.0"N, 80°49'04.8"W), Goiter

Palm Hammock (25°19'55.00"N, 80°48'10.00"W), Paurotis Palm Hammock

(25°18'7.00"N, 80°47'56.00"W), Nine Mile Pond (25°15'14.1"N, 80°47'53.5"W), Snake

Bight Trail (25°11'59.9"N, 80°52'27.3"W), Coot bay pullout (25°10'56.9"N,

80°53'51.8"W), and Bear Lake Trail (25° 8'55.98"N, 80°55'23.71"W). Not all sites were

consistently sampled during each ENP trip. Long Pine Key was closed during the May

2016 sampling trip due to a recent fire. Sites that were consistently sampled (February,

May, June, and August 2016) were Road to Anhinga, Pinelands, Road to Mahogany

Hammock, Nine Mile Pond, Snake Bight Trail, and Bear Lake Trail.

ENP Resting Shelter Sampling

Mosquito collections from resting shelters in ENP occurred between 07:00h and

13:00h for three consecutive days in December 2015, three consecutive days in

February 2016, five consecutive days in May 2016, five consecutive days in June 2016,

and five consecutive days in August 2016. Most natural aspirations occurred between

07:00h and 13:00h, although some occurred between 15:30h and 20:00h.

Within ENP, 20 PVC resting shelters were used in February 2016, 21 PVC

resting shelters in May 2016, 24 PVC resting shelters in June 2016, and 24 PVC with

the addition of 4 pop-up resting shelters in August 2016. The resting shelters were

20

placed at sites along Main Park road and adjacent trails. A handheld battery-powered

aspirator fitted with a collection cup and a funnel, was used to extract mosquitoes from

each resting shelter.

Natural Aspirations and CO2-Baited CDC Miniature Light-Traps

Mosquito collections from natural resting sites in ENP occurred three consecutive

days in December 2015, three consecutive days in February 2016, five consecutive

days in May 2016, and one day in June 2016. Mosquitoes were collected from natural

resting sites using a handheld battery-powered aspirator fitted with a collection cup.

Fifteen minutes of effort were allowed per site during natural aspirations. Targeted

natural resting sites were primarily dark moist areas that were sheltered from wind and

sun. Examples of natural resting sites sampled were fallen trees, decaying logs, dense

undergrowth, tree trunks, tree cavities, and solution holes.

Two CO2-baited CDC miniature light-traps were placed in different locations of

ENP for two consecutive evenings, August 17–18, 2016. One light-trap was placed

towards the entrance of ENP, just off Main Park road on the way to the Anhinga and the

Gumbo limbo trail, and within 20 meters of resting shelters. Another light-trap was

placed towards the end of main park road, along Bear Lake trail, also within 20 meters

of resting shelters. The light-traps were hung from shepherd hooks that were about 1.63

meters in height. A roughly two liter sized insulated water cooler packed full of dry ice

was placed next to each CDC miniature light-trap. The mosquitoes were collected each

morning and the water coolers were replenished with dry ice at dusk.

21

ENP Resting Shelter Comparison

Two different techniques were used to extract mosquitoes from the pop-up

resting shelters (Figure 2-3), i.e. a handheld battery-powered aspirator fitted with a

collection cup and funnel (Figure 2-5), and a pump-action method (Figure 2-4).

The pump-action method extracted mosquitoes by essentially plugging the

entrance of a pop-up resting shelter and forcing air, mosquitoes and other content into a

collection chamber by repeatedly collapsing the pop-up resting shelter (Figure 2-4). The

pump-like action (or accordion style fashion) of repeatedly collapsing a pop-up resting

shelter was dubbed the, “pump-action” method. The plug covering the pop-up resting

shelter was composed of flexible black plastic with a collection chamber positioned in

the center. The plug fit snuggly over the pop-up resting shelter, preventing mosquitoes

from escaping. The action of collapsing or compressing the entire pop-up resting shelter

pushes mosquitoes into the collection chamber. This collapsing or compressing

accordion style action was repeated until the resting shelter was depleted of

mosquitoes.

Five consecutive days of sampling were conducted in ENP August 2016 to

compare the efficacy of collecting Cx. cedecei from PVC resting shelters, pop-up resting

shelters with a handheld aspirator, and pop-up resting shelters with the pump-action

method. Two sites within ENP were selected to carry out the trap comparisons: Road to

Anhinga and Bear Lake. Each day after collection, the resting shelters were rotated to

reduce resting shelter placement sampling bias.

22

Bloodmeal Analysis of Blood-Engorged Culex (Melanoconion) cedecei

Single blood-engorged female Cx. cedecei from IRC and ENP were subjected to

molecular polymerase chain reaction (PCR) assays targeting the vertebrate

mitochondrial 16S ribosomal RNA (rRNA) and cytochrome b loci; regions of DNA that

are suitable for distinguishing mammalian taxa at the species level (Kitano et al. 2007).

Subsequently, the PCR products were sent to Eurofins (Louisville, Kentucky) for direct

Sanger sequencing; thereafter the results were aligned with published sequences in the

National Center of Biotechnology Information’s (NCBI) sequence database using the

Basic Local Alignment Search Tool (BLAST). These analyses resulted in species level

identification of host blood from blood-engorged Cx. cedecei.

Individual blood-engorged Cx. cedecei were placed in separate 1.5 milliliter

microcentrifuge tubes. DNA was extracted using a DNeasy blood and tissue kit (Qiagen,

Valencia, CA). Specifically, 180 microliter buffer ATL (Animal Tissue Lysis) was added

to the 1.5 millileter microcentrifuge tube with a blood-engorged mosquito. Then a sterile

plastic pestle was used to grind each mosquito. Next 20 microliters of proteinase K

(Keratin) was added, mixed by vortexing, and incubated in a 56°C water bath for about

5 minutes or until the mixture was completely lysed. After incubation, the samples were

vortexed for 15 seconds. Then 200 microliters of buffer AL (lysis buffer) was added,

mixed thoroughly by vortexing and then incubated in a 56°C water bath for 10 minutes.

The next step was to add 200 microliters of ethanol (96–100%) and mix thoroughly by

vortexing. Using a pipette, the mixture was moved into a DNeasy Mini spin column

placed in a 2 milliliter collection tube. It was then centrifuged at 6,000 x gravity (8,000

revolutions per minute) for 1 minute, later discarding the flow-through and collection

23

tubes. Next, the spin columns were placed in new 2 milliliter collection tubes, and 500

microliters of buffer AW1 (wash buffer one) was added. Once again, the samples were

placed in a centrifuge at 6,000 x gravity (8,000 revolutions per minute) for 1 minute,

later discarding the flow-through and collection tubes. Next, the spin column was placed

in new 2 milliliter collection tubes, with the addition of 500 microliters of buffer AW2

(wash buffer two), and centrifuged for 3 minutes at 20,000 x gravity (14,000 revolutions

per minute), later discarding the flow-through and collection tubes. Then the spin

columns were transferred to new 1.5 milliliter microcentrifuge tubes where the DNA was

eluted by adding 200 microliters of buffer AE (elution buffer) to the center of the spin

column membrane. Concluding the extraction process, the samples were incubated at

room temperature (15–25°C) for 1 minute and centrifuged for 1 minute at 6,000 x gravity

(8,000 revolutions per minute). The extractions were stored in a -20°C freezer until PCR

was performed.

Polymerase chain reaction methods were used to amplify the vertebrate

mitochondrial 16S ribosomal RNA (rRNA) and cytochrome b loci; a region of DNA that

is suitable for distinguishing vertebrate taxa at the species level identification (Kitano et

al. 2007). Three different primer sets were utilized. The first primer set, forward primer

H2714, “CTCCATAGGGTCTTCTCGTCTT,” and reverse primer L2513,

“GCCTGTTTACCAAAAACATCAC,” were used because of their documented ability to

amplify mammal DNA (Burkett-Cadena et al., 2008) in light of the Cx. cedecei tendency

to consume mammal blood (Edman 1979). The primer set H2714/L2513 also amplifies

amphibian DNA (Burkett-Cadena et al., 2008). Other primers used were L0/H1 and

16L1/H3056, which target the same region of the cytochrome b gene as H2714/L2513

24

and are informative for species level identifications of, respectively, birds and reptiles

(Blosser et al. 2016). A 96-well plate was used for PCR. Each well contained 14.25

microliters of de-ionized molecular grade water, 2.5 microliters of 10X reaction buffer, 2

mM dNTPs, 1.5 microliters of 50 millimolar MgCl2, 20 micromolar forward primer, 20

micromolar reverser primer, 0.5 microliters of Taq polymerase, and 2.5 microliters of my

previously extracted DNA. The thermocycler ran a total of 37 cycles. The specific

thermocycler conditions were 1 cycle for 4 minutes at 95°C, followed by 35 cycles at

95°C for 30 seconds, 57°C for 30 seconds, 72°C for 30 seconds, and 72°C for 7

minutes.

The PCR products were about 244 base pairs in length and were visualized prior

to sequencing by electrophoresis on a 1.5% agarose gel and purified by using QIAquick

PCR purification kit (Qiagen, Valencia, CA). SYBR Safe DNA gel stain was added to

the agarose gel to visualize DNA under blue-light. Samples that displayed banding at

the optimal 244 base pair length on the gels were sent to Eurofins (Louisville, Kentucky)

for direct Sanger sequencing. Sequencing results were aligned with sequence from the

National Center of Biotechnology Information’s (NCBI) sequence database using the

Basic Local Alignment Tool (BLAST) function. A nucleotide similarity of 95% or above

was considered a positive match.

Mosquito Sorting and Preservation

All collected mosquito specimens were placed in a -20°C freezer until they were

sorted and identified to species. Prior to placement in a -20°C freezer, mosquito

collections in ENP were stored in a YETI brand cooler filled with dry ice because a

-20°C freezer was unavailable.

25

During the identification process, the mosquitoes were kept on ice to reduce the

likelihood of DNA and RNA degradation. Each mosquito specimen was categorized as

blood-engorged, gravid, unfed, or male. Female mosquitoes in the genus Culex

subgenus Melanoconion were identified via cibarial armature (Williams and Savage

2009) if other characteristics did not lead to a reliable identification. The blood-engorged

Cx. cedecei were placed in separate vials. The specimens were considered blood-

engorged no matter how minute the volume of blood. All female Cx. cedecei that were

non-blood-engorged (gravid or unfed) were kept for later virus detection.

Data Analysis


Monthly means of unfed females, blood-engorged females, gravid females,

males, and total collected Cx. cedecei were calculated by dividing the quantity of Cx.

cedecei collected by frequency of sampling events per month. Totals of species were

combined in a table to display all mosquito species collected associated with their

respective totals.


The May 2016 mean of blood-engorged females, unfed females, gravid females

and male Cx. cedecei were calculated for PVC and wireframe resting shelters with

standard error of mean. A separate two-sample two-tailed t-test was calculated to

compare PVC and wireframe resting shelter collections of blood-engorged female,

unfed female, gravid female and male Cx. cedecei. Alpha was set at 0.05 for the two-

sample two-tailed t-tests.

26

ENP Resting Shelter Sampling

The mean number of mosquitoes collected from resting shelters were calculated

for each site within ENP for a given sampling month. The number of days sampled and

the number of resting shelters used per site were not consistent across the entirety of

the study. Thus, for a given site and day, the total number of mosquitoes collected were

divided by the number of PVC resting shelters used.

ENP Resting Shelter Comparison

The total Cx. cedecei collected from the ENP site Road to Anhinga August 16–

20, 2016 was analyzed, i.e. comparing the efficacy of collecting Cx. cedecei from PVC,

pop-up with hand-held aspirator, and pop-up with pump-action method resting shelters.

A one-way ANOVA followed by Tukey’s HSD was used to compare the three different

resting shelter collections. Alpha was set at 0.05 for the statistical tests.

Natural Aspirations and CO2-Baited CDC Miniature Light-Traps

Three ENP sites: Road to Anhinga, Nine Mile Pond and Snake Bight Trail were

selected to compare natural aspirations and PVC resting shelter collections of Cx.

cedecei across three consecutive days in May 2016. Other ENP sites and natural

aspirations were not concurrent. The mean number of collected Cx. cedecei from

natural aspirations and PVC resting shelters were calculated by dividing the number of

Cx. cedecei by three days. Separate two-tailed t-tests were conducted for each ENP

site, comparing natural aspirations and PVC resting shelter collections of Cx. cedecei.

Alpha was set at 0.05 for the two-sample two-tailed t-tests.

Mosquito collections from the CO2-CDC miniature light-traps were subsampled,

unless the total collection was less than approximately 500 mosquitoes. The mass of

27

each mosquito subsample was used to calculate the estimated quantity of mosquitoes

collected. Three subsamples of 100 mosquitoes without replacement were identified to

species for each CO2-baited CDC miniature light-trap collection. The net mass of total

mosquitoes collected was calculated by subtracting the mass of the container with

mosquitoes by the mass of the container itself. Mass of each sub-sample was also

calculated. The mass of each subsample along with the total mass of mosquitoes was

used to estimate the quantity of mosquitoes by species per trap night.


The host-blood sources were summarized by host species for IRC and ENP. The

percent monthly host blood source in ENP was calculated for each sampling period.

Chi-square tests of indepence were used to test for differences in the distribution of host

blood sources across sampling periods at ENP and IRC, where the IRC sampling

periods were considered to be two consecutive months, e.g. December and January

were considered as a single sampling period.

Lastly, a chi-square test of independence was used to examine differences in the

distribution of total Cx. cedecei bloodmeals across sites within ENP. Culex cedecei

bloodmeals from human and host-species with less than five bloodmeals were omitted

from the analysis. Therefore, the host species used for the ENP chi-square test of

independence were brown rat/roof rat, cotton mouse, and hispid cotton rat. The sites

sampled in ENP used for the analysis were Road to Anhinga, Road to Mahogany

Hammock, Nine Mile Pond, Snake Bight, and Bear Lake. Other sites sampled within

ENP were omitted because of inconsistent sampling across the sampling periods.

28

Results


Nearly 3,500 mosquitoes were collected from wireframe resting shelters across

85 days of sampling from January 13 to December 06, 2016 (Table 2-1). Culex cedecei

was the species most commonly collected from resting shelters, totaling approximately

38% of the collection (n=1,316). Culex nigripalpus was the next most commonly

sampled mosquito species, constituting approximately 21% of the total collection

(n=772). With regards to physiological states of Cx. cedecei, 222 blood-engorged

females, 102 gravid females, 326 unfed females, and 666 males were collected (Table

2-1).

The greatest numbers of Cx. cedecei blood-engorged females were collected in

February, March and April (Figure 2-6). The greatest total numbers (n=244) of Cx.

cedecei were collected in April (35 per resting shelter). The lowest numbers of Cx.

cedecei were collected in November, where n=22 and the mean number per resting

shelter was four (true mean=3.67). There is a downward trend of mean collected Cx.

cedecei from April through November (Figure 2-6).


No significant differences in mean numbers of blood-engorged females, gravid

females, and unfed females of Cx. cedecei were detected between wireframe and PVC

resting shelters sampled in May (Figure 2-7). The average numbers of Cx. cedecei were

roughly equal between PVC and wireframe shelters (Figure 2-7). No significant

differences were found between blood-engorged females (P=0.87), gravid females

(P=1), unfed females (P=0.42), males (P=0.35), or total of Cx. cedecei (P=0.45) (Figure

2-7).

29

ENP Mosquito Collections

There was a total of 20,429 mosquitoes collected from ENP resting shelters,

including 20 mosquito species (Table 2-2). Some of the most commonly collected

mosquito species in descending order were Culex cedecei (39.91% of collection), Culex

atratus Theobald (23.92%), and Culex iolambdis Dyar (11.79%) (Table 2-2). No uniform

pattern of Cx. cedecei seasonal abundance was observed across all sites. At sites near

the entrance of ENP (upland hammock sites including Road to Anhinga, Twin Pine

Hammock, and Road to Mahogany Hammock) numbers of Cx. cedecei increased as the

wet season progressed, i.e May–August (Figure 2-8). At sites closer to the coast (Nine

Mile Pond, Snake Bight, and Bear Lake, mosquito numbers decreased as the wet

season progressed (Figure 2-8).

ENP PVC resting shelter and natural aspiration comparison. The mean

quantity of collected Cx. cedecei was higher from PVC resting shelters than natural

resting site aspirations at all three sampling sites (Figure 2-9). The mean number of Cx.

cedecei collected from PVC resting shelters and natural resting site aspirations were

significantly different for Road to Anhinga and Nine Mile Pond; respectively P=0.048

and P<0.001 (Figure 2-9). However, the number of Cx. cedecei collected from PVC

resting shelters and natural resting site aspirations in Snake Bight Trail were not

significantly different, where P=0.295 (Figure 2-9).

ENP PVC, pop-up with handheld aspirator, and pop-up with pump-action

resting shelter comparison. Statistical outcomes from the one-way ANOVA detected

no significant difference in the quantity of Cx. cedecei collected from either resting

shelter collection method (F=0.517, df=2, P=0.609). Additionally, the statistical

30

outcomes from Tukey’s HSD found no significant difference in the quantity of

Cx. cedecei collected from PVC vs. Pop-up with handheld aspirator (F=0.517, df=2,

P=0.944), PVC vs. Pop-up with pump-action (F=0.517, df=2, P=0.738), or Pop-up with

handheld aspirator vs. Pop-up with pump-action (F=0.517, df=2, P=0.548). Statistical

analysis comparing the resting shelters from Bear Lake was not conducted due to low

numbers, i.e. a single unfed female Cx. cedecei was collected from each of the three

resting shelters August 17, 2016.

CO2-baited CDC miniature light-traps. The total number of mosquitoes

collected from CO2-baited CDC miniature light-traps at Road to Anhinga and Bear Lake

Trail on two-consecutive nights were 25,685 and 102,925, respectively (Table 2-3). The

Road to Anhinga CO2-baited CDC miniature light-trap top three mosquitoe species

collected were Ae. taeniorhynchus (78% of the collection), Cx. nigripalpus (9%) and Cx.

cedecei (7%) (Table 2-3). Aedes taeniorhynchus constituted 99% of mosquitoes from

the CO2-baited CDC miniature light-trap at the Bear Lake Trail site (Table 2-3).


There were 741 bloodmeals of Cx. cedecei acquired from IRC (n=290) and ENP

(n=451) (Table 2-4). The majority of vertebrate host nucleotide similarities using BLAST

for Cx. cedecei bloodmeal identification were 98-99%. Ninety-nine percent of the Cx.

cedecei bloodmeals from both IRC and ENP were of mammalian origin (Table 2-4).

Less than one percent were reptile, respectively IRC and ENP (n=1, n=3) (Table 2-4). A

single bird bloodmeal was identified from IRC (Table 2-4). There were 130 Cx. cedecei

bloodmeals that were unidentifiable, and therefore listed as unknown (Table 2-4).

Rattus rattus (Linnaeus) (roof rat) and Rattus norvegicus (Berkenhout) (brown rat) blood

31

sources were indistinguishable by PCR (99% similar), as were Sylvilagus floridanus

(J.A. Allen) (Eastern cottontail) and Sylvilagus palustris (Bachman) (marsh rabitt) (Table

2-4). Rodents accounted for the majority of bloodmeals in the ENP and IRC,

respectively 88% and 59% (Table 2-4). In ENP, the most common host-blood source

was hispid cotton rat (65%, n=201), followed by brown rat/roof rat (27%, n=85) (Table 2-

4). In IRC the most common bloodmeal was Neotoma floridana (Ord) (eastern woodrat)

(38%, n=96), eastern cottontail/marsh rabbit (22%, n=55), and hispid cotton rat (19%,

n=48) (Table 2-4). The distribution of host use across the sampling periods in IRC were

not significant (P=0.242) (Figure 2-10).

Although the most hispid cotton rat bloodmeals from ENP occurred August 2016

(n=105; 56.45% of collection), the highest hispid cotton rat bloodmeals in relation to

percent of total monthly bloodmeals was June 2016 (n=58; 75% of collection) (Figure 2-

11). The percentage of bloodmeals from hispid cotton rat and brown rat/roof rat

fluctuated across sampling periods. The percentage of bloodmeals from cotton mouse

peaked in February (Figure 2-11). A significant difference in distribution of bloodmeals

for these three rodent hosts was detected across sampling periods (P<0.001) (Figure 2-

11). Pair wise Chi-square tests revealed significant differences in seasonal distribution

of bloodmeals between cotton mouse vs. brown rat/roof rat (P<0.001) and in cotton

mouse vs. hispid cotton rat (P<0.001) (Figure 2-11). There was no significant difference

in host use of brown rat/roof rat vs. hispid cotton rat (P=0.076) (Figure 2-11).

The distribution of total Cx. cedecei host bloodmeals were significantly different

across the ENP sampling sites (X2=127.354, df=8, P<0.001). The majority of collected

brown rat/roof rat Cx. cedecei bloodmeals were from Road to Anhinga (n=68), and the

32

second largest quantity of brown rat/roof rat Cx. cedecei bloodmeals were from Snake

Bight (n=7) (Table 2-5). The majority of collected cotton mouse Cx. cedecei bloodmeals

were from Nine Mile Pond (n=8), and the second largest quantity of collected cotton

mouse Cx. cedecei bloodmeals were from Snake Bight (n=3) (Table 2-5). The majority

of collected hispid cotton rat Cx. cedecei bloodmeals were from Nine Mile Pond (n=44),

the second and respectively third largest quantities of hispid cotton rat Cx. cedecei

bloodmeals were from Road to Mahogany Hammock (n=38) and Road to Anhinga

(n=22) (Table 2-5).

33

Table 2-1. Adult mosquitoes sampled from resting shelters in Indian River County.

Mosquito species Blood-engorged

Gravid Unfed Male Total Percent of collection

Aedes (Stg.) albopictus Skuse 0 0 1 3 4 0.11

Aedes (Och.) atlanticus Dyar and Knab 0 0 1 0 1 0.03

Aedes (Och.) infirmatus Dyar and Knab 1 1 0 0 2 0.06

Aedes (Och.) pertinax Grabham 0 0 1 0 1 0.03

Aedes (Och.) taeiniorhynchus (Wiedemann) 0 0 3 1 4 0.11

Anopheles (Ano.) atropos Dyar and Knab 0 0 1 2 3 0.09

Anopheles (Ano.) crucians Wiedmann 35 11 108 93 247 7.08

Anopheles (Ano.) punctipennis (Say) 0 0 1 0 1 0.03

Anopheles (Ano.) quadrimaculatus Say 1 0 25 47 73 2.09

Culex (Mel.) atratus Theobald 15 5 19 32 71 2.03

Culex (Mel.) cedecei Stone and Hair 222 102 326 666 1,316 37.72

Culex (Cux.) coronator Dyar and Knab 0 0 1 0 1 0.03

Culex (Cux.) declarator Dyar and Knab 0 1 4 1 6 0.17

Culex (Mel.) erraticus (Dyar and Knab) 20 18 59 71 168 4.82

Culex (Mel.) iolambdis Dyar 40 39 185 205 469 13.44

Culex (Cux.) nigripalpus Theobald 46 126 222 328 722 20.69

Culex (Mel.) pilosus Dyar and Knab 3 2 15 6 26 0.75

Culex (Cux.) quinquefasciatus Say 2 4 15 52 73 2.09

Culex (Cux.) salinarius Coquillett 5 0 22 0 27 0.77

Culex (Ncx.) territans Walker 0 0 1 0 1 0.03

Deinocerites cancer Theobald 29 26 191 23 269 7.71

Psorophora (Gra.) columbiae Dyar and Knab 0 0 1 0 1 0.03

Uranotaenia (Ura.) lowii Theobald 0 0 2 0 2 0.06

Wyeomyia (Wy.) mitchellii Theobald 0 0 0 1 1 0.03

Total 419 335 1,204 1,531 3,489 100.00

Values represent total numbers of blood-engorged female, gravid female, unfed female, and male mosquito from wireframe resting shelters sampled January 13 to December 06, 2016.

34

Table 2-2. Adult mosquitoes sampled by resting shelters from Everglades National Park.

Mosquito species Blood-engorged

Gravid Unfed Male Total Percent of collection

Aedes (Och.) atlanticus Dyar and Knab 0 0 0 14 14 0.07

Aedes (Och.) infirmatus Dyar and Knab 0 0 0 10 10 0.05

Aedes (Och.) taeiniorhynchus (Wiedemann) 4 2 31 1,335 1,372 6.72

Anopheles (Ano.) atropos Dyar and Knab 0 0 1 2 3 0.01

Anopheles (Ano.) crucians s.I. Wiedmann 7 2 142 279 430 2.10

Anopheles (Ano.) quadrimaculatus s.I. Say 2 0 3 14 19 0.09

Coquillettidia (Cq.) perturbans (Walker) 0 0 0 1 1 0.0049

Culiseta (Cu.) melanura (Coquillett) 7 2 25 17 51 0.25

Culex (Mel.) atratus Theobald 514 259 2,517 1,597 4,887 23.92

Culex (Mel.) cedecei Stone and Hair 441 131 2,254 3,693 6,519 31.91

Culex (Mel.) erraticus (Dyar and Knab) 108 85 509 1,261 1,963 9.61

Culex (Mel.) iolambdis Dyar 147 185 918 1,159 2,409 11.79

Culex (Mel.) mulrennani Basham 1 0 1 6 8 0.04

Culex (Cux.) nigripalpus Theobald 43 101 218 513 875 4.28

Culex (Mel.) pilosus Dyar and Knab 219 102 698 754 1,773 8.68

Culex (Cux.) quinquefasciatus Say 0 0 0 1 1 0.0049

Deinocerites cancer Theobald 1 0 0 0 1 0.0049

Uranotaenia (Ura.) lowii Theobald 6 11 15 55 87 0.43

Uranotaenia (Ura.) sapphirina (Osten Sacken) 0 0 0 1 1 0.0049

Wyeomyia (Wy.) mitchellii Theobald 0 0 0 5 5 0.02

Total 1,500 880 7,332 10,717 20,429 100.00

Values represent total resting shelter collections of mosquito species with percent of total by species. Samples were collected December 2015, February, May, June, and August 2016.

35

Table 2-3. Adult mosquitoes sampled by CO2-baited CDC miniature light-traps from Everglades National Park.

Mosquito species

Road to Anhinga Bear Lake

No. of mosquitoes

Percent of collection

No. of mosquitoes

Percent of collection

Aedes (Stg.) albopictus Skuse 1 0.00 0 0.00

Aedes (Och.) atlanticus Dyar and Knab 7 0.03 0 0.00

Aedes (Och.) infirmatus Dyar and Knab 66 0.26 0 0.00

Aedes (Och.) pertinax Grabham 233 0.91 218 0.21

Aedes (Och.) taeiniorhynchus (Wiedemann) 19,964 77.73 102,021 99.12

Anopheles (Ano.) crucians s.I. Wiedmann 957 3.73 218 0.21

Anopheles (Ano.) punctipennis (Say) 3 0.01 0 0.00

Culex (Mel.) cedecei Stone and Hair 1,891 7.36 0 0.00

Culex (Mel.) erraticus (Dyar and Knab) 158 0.62 0 0.00

Culex (Mel.) iolambdis Dyar 0 0.00 125 0.12

Culex (Cux.) nigripalpus Theobald 2,348 9.14 218 0.21

Culex (Mel.) pilosus Dyar and Knab 2 0.01 0 0.00

Psorophora (Gra.) columbiae Dyar and Knab 24 0.09 0 0.00

Uranotaenia (Ura.) lowii Theobald 4 0.02 0 0.00

Wyeomyia (Wy.) mitchellii Theobald 4 0.02 125 0.12

Wyeomyia (Wy.) vanduzeei Dyar and Knab 23 0.09 0 0.00

Total 25,685 100 102,925 100

Values represent total females and percent of total from two sites, August 18 and 19, 2016. Each CO2-baited CDC miniature light-trap was placed in the field in the evening and retrieved the following morning. The quantities of mosquitoes are estimations based on sub-sample calculations (see Materials and Methods).

36

Table 2-4. Hosts of Culex (Melanoconion) cedecei from Everglades National Park and Indian River County.

Host-blood source ENP IRC Total

Reptilia

Brown anole (Anolis sagrei) 3 1 4

Aves

Black-crowned night heron (Nycticorax nycticorax) 0 1 1

Mammalia

Virginia opossum (Didelphis virginiana) 0 (0%) 14 (5.5%) 14

Nine-banded armadillo (Dasypus novemcinctus) 0 (0%) 3 (1.18%) 3

Eastern gray squirrel (Sciurus carolinensis) 0 (0%) 1 (0.39%) 1

Southern flying squirrel (Glaucomys volans) 0 (0%) 1 (0.39%) 1

Eastern woodrat (Neotoma floridana) 1 (0.32%) 96 (37.65%) 97

Cotton mouse (Peromyscus gossypinus) 14 (4.5%) 1 (0.39%) 15

Marsh rice rat (Oryzomys palustris) 2 (0.65%) 0 (0%) 2

Hispid cotton rat (Sigmodon hispidus) 201 (64.84%) 48 (18.82%) 249

Brown rat/Roof rat (Rattus norvegicus/Rattus rattus) 85 (27.42%) 9 (3.53%) 94

Eastern cottontail/Marsh rabbit (Sylvilagus floridanus/Sylvilagus palustris)

1 (0.32%) 55 (21.57%) 56

Bobcat (Lynx rufus) 0 (0%) 2 (0.78%) 2

North American river otter (Lontra canadensis) 1 (0.32%) 3 (1.18%) 4

Raccoon (Procyon lotor) 2 (0.65%) 21 (8.24%) 23

White-tailed deer (Odocoileus virginianus) 3 (0.97%) 1 (0.39%) 4

Human (Homo sapiens sapiens) 34 7 41

Unknown 104 26 130

Total 451 290 741

Values represent total bloodmeals and percent of total non-human mammal bloodmeals from Cx. cedecei sampled August 2015 to December 2016. Rattus rattus and Rattus norvegicus blood sources were indistinguishable by PCR, as were Sylvilagus floridanus and Sylvilagus palustris.

37

Table 2-5. Total Culex cedecei bloodmeals from brown rat/roof rat, hispid cotton rat, and cotton mouse in Everglades National Park.

Site Brown rat /roof rat

Cotton mouse

Hispid cotton rat

Rd. to Anhinga 68 0 22

Rd. to Mahogany Hammock 0 0 38

Nine Mile Pond 2 8 44

Snake Bight 7 3 5

Bear Lake 6 0 16

Sampling periods are December, February, May, June, and August 2016.

38

Figure 2-1. Wireframe resting shelter, sensu Burkett-Cadena (2011a). Photo courtesy of

Isaiah Hoyer.

39

Figure 2-2. PVC resting shelter. Photo courtesy of Isaiah Hoyer.

40

Figure 2-3. Pop-up resting shelter. Photo courtesy of Isaiah Hoyer.

41

Figure 2-4. Demonstration of sampling mosquitoes from pop-up resting shelter in

Everglades National Park. A) Fully expanded pop-up resting shelter capped with removable plastic plug. B) Collapsed pop-up resting shelter. Photo courtesy of Isaiah Hoyer.

42

Figure 2-5. Hand-held aspirator fitted collection cup and removable funnel. Photo

courtesy of Isaiah Hoyer.

43

Figure 2-6. Monthly wireframe resting shelter collections of Culex cedecei from Indian

River County.

Figure 2-7. Comparison of PVC and wireframe resting shelter sampling methods in

Indian River County. Degrees of freedom are 118 for all comparisons.

-5

0

5

10

15

20

25

30

35

40

45

Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec

Nu

mb

er

of

Cx. ced

ecei

(Mean±S

EM

)

Months of 2016

blood-engorged

gravid

male

unfed

total

0

0.2

0.4

0.6

0.8

1

1.2

1.4

Blood-engorged Unfed Gravid Male

Nu

mb

er

of

Cx. ced

ecei

(Mean

+S

EM

)

Cx. cedecei

PVC

Wireframe

T P

Bloodfed -0.163 0.871

Gravid 0 1

Unfed 0.812 0.418

Males 0.942 0.453

Total 0.753 0.453

44

Figure 2-8. Seasonal patterns of Culex cedecei abundance from sampling sites in

Everglades National Park.

Figure 2-9. Comparison of PVC resting shelter and natural aspiration sampling method

in Everglades National Park.

0

10

20

30

40

50

60

Dec Feb May Jun Aug

Pe

rce

nt

tota

l m

on

thly

blo

od

-en

go

rge

d C

x.

ce

de

ce

i

Month

Bear Lake Nine mile pond

Pinelands Road to Anhinga

Road to Mahogany Hammock Snake Bight

Twin Pine Hammock Other

0

20

40

60

80

100

120

140

Road to Anhinga Nine Mile Pond Snake Bight Trail

Nu

mb

er

of

Cx

. c

ed

ec

ei

(Me

an

+S

EM

)

ENP sampling sites

PVC

Natural

Site df T P

Rd. Anh 4 2.80 0.048

9MP 4 20.12 <0.001

SB 4 1.20 0.295

45

Figure 2-10. Seasonal patterns of host use by Culex cedecei from Indian River County.

Figure 2-11. Seasonal patterns of host use by Culex cedecei from Everglades National

Park.

0

10

20

30

40

50

60

70

80

90

Dec_Jan Feb_Mar Apr_May Jun_Jul Aug_Sep Oct_Nov

To

tal C

x.

ced

ecei b

loo

dm

eals

Month

Eastern woodrat

Eastern cottontail/Marsh rabbit

Hispid cotton rat

Raccoon

Virginia opossum

Brown rat/Roof rat

X2 29.54

df 25

P 0.242

0

20

40

60

80

100

120

140

160

180

Dec Feb May Jun Aug

To

tal C

x.

ced

ecei b

loo

dm

eals

Month

Cotton mouse

Brown rat/Roof rat

Hispid cotton rat

Full

model

Cotton mouse v.

Brown rat/

Roof rat

Cotton mouse v.

Hispid cotton rat

Brown rat/

Roof rat v.

Hispid cotton rat

X2 38.47 25.17 25.70 8.47

df 8 4 4 4

P <0.001 <0.001 <0.001 0.076

46

CHAPTER 3 UNDERSTANDING PATTERNS OF MOSQUITO HOST UTILIZATION THROUGH

PASSIVE AND ACTIVE CAPTURE TECHNIQUES

Materials and Methods

Field studies were conducted in IRC to investigate Cx. cedecei and mammal-host

interactions. Specific topics included exploration of relationships between circadian

activity periods of Cx. cedecei and mammalian host animals and Cx. cedecei attraction

to different rodent species. These studies utilized a variety of methods to quantify

circadian activity, including a mosquito drift fence (Figure 3-1, Figure 3-2), wildlife

camera trapping (Figure 3-3), and modified no. 17 Trinidad traps (Figure 3-4).

Mosquito Drift Fence

The mosquito drift fence is an active sampling technique that shares the

principles of both an insect Malaise trap and a linear herpetological drift fence in that it

acts as a path barrier to moving animals and, directs them towards sampling devices at

one or both ends. A single mosquito drift fence was erected in South Oslo Riverfront

Conservation Area (SORCA) in IRC to measure circadian activity patterns of Cx.

cedecei from June 29 to August 02, 2016 (Figure 3-1, Figure 3-2). Composed of white

and black netting, the drift fence directed movement of Cx. cedecei and other similar

sized insects into one of two “sticky clock” collection devices placed on either side, thus

measuring the time of collection (Figure 3-1, Figure 3-2). The drift fence was placed

along a partially shaded trail where relatively large numbers of Cx. cedecei were

previously collected from wireframe resting shelters. The objective of the mosquito drift

fence was to investigate the circadian activity of Cx. cedecei, therefore providing an

inference on when they might encounter host animals.

47

Similar to a Malaise trap and a linear herpetological drift fence, the mosquito drift

fence manipulates the direction of movement of animals upon contact of the fencing

material. Both the mosquito drift fence and a Malaise trap target flying insects, however

the drift fence funnels specimens into a device we named “sticky clock,” allowing us to

determine the precise time of capture. Contrary to the mosquito drift fence, a Malaise

trap does not passively distinguish time of capture. A similarity of the mosquito drift

fence and a linear herpetological drift fence is that they both rely on a rectangular fence

that is positioned flush and perpendicular to the ground in attempt to force an organism

left or right towards a collection device.

The dimensions of the drift fence were: 4 meters long, 4 meters wide, 68.5

centimeters high at the center, and 73.5 centimeters high at either end. The netting

used was bridal veil, with mesh size approximately 1 millimeter. The black netting

served as a vertical barrier, where the bottom was weighted with sticks allowing it to rest

on the ground to minimize gaps and withstand wind from disturbing the barrier. White

netting was placed on top of the black netting, completing the “T” shaped structure. The

white netting created a roof-like structure where it was divided evenly down the middle,

carefully closing any gaps where the white and black netting came together. The netting

was held taught by black paracord tied to six wooden posts (Figure 3-1, Figure 3-2).

Components of the sticky-clock trap were a CDC miniature light-trap with no

bulb, a funnel made from window-screen, a round plastic disc, Tanglefoot, a 24-hour

clock motor, hardware cloth, and a H-frame wire stake. We fastened a funnel on the

bottom of the CDC miniature light-trap to better direct the capture of insects. The funnel

tip had an opening that measured approximately 1.5 centimeters. The round plastic lid

48

had a diameter of 18.5 centimeters. We cut a hole from the center of the round plastic

lid to fasten it onto a 24-hour clock motor. Permanent marker was used to draw the face

of a 24-hour clock onto the round plastic lid, coinciding with the position of the tip of the

funnel and the time of day. A thin layer of Tanglefoot was smeared onto the round

plastic lid, ensuring insects captured in the CDC miniature light-trap with no bulb would

be blown onto the round plastic lid and be stuck to reflect time of capture. The sticky-

clock trap was fastened onto the H-frame wire stake with zip-ties. Hardware cloth

served as a base for the clock motor. A new round plastic lid was placed onto the sticky

clock every 24-hours, each trial ensuring the tip of the funnel was directly above the

respectable time. Mosquitoes attached to the round plastic lid were identified to species,

counted, and recorded with the time of captured as indicated on the 24-hour clock

drawn upon the round plastic lid (Figure 3-1, Figure 3-2).

Wildlife Camera Trapping

Wildlife cameras are a passive sampling technique that I used to capture

vertebrate host activity patterns. Wildlife cameras were placed haphazardly in IRC

targeting medium to small mammals. The cameras were placed in overlapping habit of

wireframe resting shelters. The objective was to collect information on regional activity

patterns of mammals that occur in the IRC sampling site with Cx. cedecei.

Five wildlife cameras (Stealth Cam G42NG) were set from June 21 to October

04, 2016 (Figure 3-3). A sixth camera was operated May 19, 2016 to October 04, 2016.

All cameras were placed in forested areas of FMEL campus (n=3) and SORCA (n=3).

The cameras were motion triggered, set to quick mode three (Q3): 720P HD 10 second

videos and 30 second timeout delay between activations. Cameras were mounted on H-

49

frame wire sign stakes with zip ties, standing about 45 centimeters from the ground

(Figure 3-3). The habitat characteristics of cameras 1–5 were a mixture of deciduous

and evergreen woodland. The canopy consisted of majorly various palm species, oak,

and some Brazilian pepper. Cameras 1, 2 and 4 were less than 20 meters away from

mesic pine flatwood habitat. The habitat of camera six was dominated by red mangrove,

however oak and various palm species were less than 20 meters away. All wildlife

cameras were placed within ten meters or less from water. Although some cameras

were later re-positioned slightly to monitor Sherman, Havahart and modified no. 17

Trinidad traps, no bait was used.

All videos recorded by the wildlife cameras were viewed, and the data recorded

were the wildlife camera number associated with each location, the quantity of animals

in frame separated by species, date, time, temperature, and the video number.

Wild Rodent Baited Modified no. 17 Trinidad Trap

The no. 17 Trinidad trap is an animal-baited passive trap developed by Davies

(1971) to capture mosquitoes attracted to rodents. A modified active trap version of

Davies (1971) no. 17 Trinidad trap was used (Figure 3-4). The modified version of

Davies (1971) no. 17 Trinidad trap varied in three major ways. One, the modified

Trinidad trap inhibited mosquito and animal contact. Two, the modified Trinidad trap

baited animal was predominantly out of view, i.e. covered from all directions except from

below. Lastly, the modified Trinidad trap required a CDC miniature light trap with no

bulb, hanging from the bottom of the animal baited chamber to collect mosquitoes.

Field studies were conducted in IRC to assess Cx. cedecei attraction to various

species of wild rodents. Wild rodents were captured and placed individually in modified

50

no. 17 Trinidad traps to investigate attraction of Cx. cedecei. Baited Sherman and

Havahart traps were used to capture wild rodents from August to the end of October

2016 in SORCA and FMEL. The modified no. 17 Trinidad trap was composed of two

compartments, a top chamber housing the rodent and a bottom chamber collecting

incoming mosquitoes. The top chamber housing the rodent was a blue 5-gallon bucket

with the bottom portion removed and screened to inhibit mosquito-rodent contact. The

bottom chamber collecting mosquitoes was a CDC miniature light trap, with the bulb

removed (Figure 3-4).

Modified no. 17 Trinidad trap design. The modified Trinidad trap rodent

chamber was composed of a blue 5-gallon bucket with a removable lid and handle,

hardware cloth, metal coat hanger wire, white netting, elastic cord, and two large bolts

with wing nuts (Figure 3-4). The bottom of the bucket was removed with a table saw. A

butane torch was used to soften the rim of the bottom bucket, allowing hardware cloth to

mesh with the plastic, i.e. hardware cloth replaced the bottom of the 5-gallon bucket by

being pushed through the heated plastic. The hardware cloth thus served as the bottom

of the bucket, allowing scent, feces, and urine to drop freely. The discarded plastic rim

from cutting the 5-gallon bucket was fastened at the bottom of the bucket with bolts,

covering the sharp hardware cloth edges, and creating an approximately 1.5 centimeter

gap extending beyond the hardware cloth base. White bridal veil netting with a mesh

size approximately 1 millimeter, covered the bottom of the bucket and was held tight by

a black elastic cord. The 1.5 centimeter overhang of the discarded plastic rim and the

white bridal veil netting protected the animal from mosquitoes and other biting insects of

similar size. Coat hanger metal wire was shaped to allow a CDC miniature light trap to

51

hang at the bottom of the bucket. The coat hanger metal wire was fastened to the

bucket by wing nuts that screwed over the bolts used to hold the discarded plastic rim

(Figure 3-4).

The mosquito chamber was a CDC miniature light trap with no bulb, a cut CDC

collection bag measuring 16 centimeters in length, and a metal hook that connected to

the coat hanger fastened to the bucket (Figure 3-4). The modified Trinidad trap was

hung from a 1.22 meter Shepherd hook. The bottom of the bucket was 0.5 meters from

the ground and the entrance to the CDC miniature light trap was 0.43 meters from the

ground. A dab of Tanglefoot was applied around the circumference of each shepherd

hook and the batteries powered the CDC miniature light traps to deter ants from

disturbing the modified no. 17 Trinidad trap (Figure 3-4).

Experiment trials. The modified no. 17 Trinidad trap experiment trials were set

around dusk between 16:00 and 18:30. The traps were retrieved the following morning.

Captured wild rodents were individually placed in a modified no. 17 Trinidad trap with a

glass petri-dish of bird seed and a glass petri-dish of wet cotton. A control modified no.

17 Trinidad trap containing a glass petri-dish of bird seed and a glass petri-dish of wet

cotton, was placed approximately 10 meters away from the trap containing a rodent.

Capturing Wild Rodents In IRC

Efforts to capture wild rodents in SORCA and the grounds of FMEL took place

August 1 to October 31, 2016 and twice in December 2016, totaling 46 trap nights

(IACUC study #201509113). Small Sherman (8 X 9 X 23 centimeters) and small 2-

door Havahart (45.72 X 12.7 X 12.17 centimeters) traps were used. Sherman and

Havahart traps were baited with a mixture of peanut butter, rolled oats, and vanilla

52

extract. Both traps were set at dusk, and checked early the following morning. Quantity

and location of each trap varied on a given night. No more than 16 Sherman and 5

Havahart traps were activated per night. Although trapping occurred in and around

buildings of FMEL, the majority effort took place in oak-palm habitat, targeting small-

medium mammal runways. Sometimes Ortho Home Defense insect killer spray (active

ingredients, 0.05% Bifenthrin and 0.0125% Zeta-Cypermethrin) was used to deter ants

from disturbing the peanut butter bait mixture. Additionally, traps were occasionally

secured with tent stakes to deter trap molestation by non-target mammals.

Upon capture, individual rodents were transferred directly to a 5-gallon bucket of

a modified no. 17 Trinidad trap with bird seed and water. They were then placed in a

cool, dry and quiet place. Species was determined but sex and weight were not.

Additionally, blood or other bodily fluids from the rodents were not taken. Rodents were

released at point of capture after the field experiments or within 48 hours.

Data Analysis


Daily totals of Cx. cedecei were allocated for every hour, where one day is a 24-

hour period. Across the 22 days of successful sampling, the mean number of collected

Cx. cedecei for every hour was calculated. Culex cedecei collected on the half-hour

marks were rounded up to the nearest hour, where mosquito specimens captured on a

quarter hour mark were rounded down to the nearest hour.


Total observations of animal species that resulted in less than five were not

included in the data analysis. Each animal observation was categorized as “day” or

53

“night,” with regards to sunset and sunrise times specific to the date of animal

encounter. The day activity category was from sunrise to one minute prior to sunset,

and night activity category was from sunset to one minute before sunrise.

The mean frequency of animal observations per hour was calculated by species

across the days of wildlife camera activity. Similar to the mosquito drift fence hourly

means, the animals encountered per hour were rounded up to the nearest hour on the

half-hour marks and rounded down to the nearest hour on the quarter hour marks.

Modified no. 17 Trinidad Trap Experimental Trials

Two-sample one-tailed t-tests were performed to compare the quantity Cx.

cedecei on a given trap night from the unbaited (control) and the rodent-baited

(treatment). Alpha was set at 0.05.

Circadian Activity of Culex cedecei and Mammalian Host Animals

A series of linear regressions were used comparing temporal activity of Cx.

cedecei and individual mammalian host animal species. Culex cedecei circadian activity

was assumed to be a function of host animal temporal activity. Animals used in the

analysis were eastern woodrat, Procyon lotor (Linnaeus) (raccoon), Didelphis virginiana

Kerr (Virginia opossum), and Dasypus novemcinctus Linnaeus (armadillo). An additional

linear regression was conducted comparing number of Cx. cedecei bloodmeals of 10

host animal species and the percent of the associated host animal species observations

occurring at night. The host animals used for the regression were Lontra Canadensis

(Schreber) (otter), Sciurus carolinensis Gmelin (eastern gray squirrel), Lynx rufus

(Schreber) (bobcat), raccoon, eastern cotton tail/marsh rabbit, cotton rat, eastern

woodrat, Virginia opossum, armadillo, and brown rat/roof rat.

54

Results


The mosquito drift fence sampling occurred for 26 days between June 29 to

August 02, 2016. However, not all collection data were used from the mosquito drift

fence. There were a several days of sampling, occurring in 24-hour increments, where

the collection data from one of the two sticky-clock devices was omitted due to improper

function or destruction of the collected mosquitoes by ants. Improper functioning of the

sticky-clock device was defined as a clock keeping improper time as observed upon

trap retrieval every 24-hours. It was not until 22 of the 26-day mosquito drift fence

sampling where the improper time keeping of one of the sticky-clock devices was

resolved. A plastic gear was discovered to be missing from the faulty 24-hour clock

motor. Shortly thereafter, the sticky-clock device was fixed and placed back into position

at one of the ends of the mosquito drift fence. Therefore, most of the drift-fence data

used are from a single sticky-clock device.

A total of 1,087 mosquitoes were collected (Table 3-1), where 1,047 of the

mosquitoes were unfed females, 11 blood-engorged females, 6 gravid females, and 25

males. The most commonly collected mosquito species was Cx. nigripalpus (44%,

n=474) followed by Cx. cedecei (36%, n=392) (Table 3-1). The peak circadian activity

periods of Cx. cedecei were 04:00h and 22:00h, where the mean number of collected

Cx. cedecei were both 0.762 (Figure 3-5). The span of Cx. cedecei circadian activity

occurred between 1:00h–4:00h, followed by a sharp decline from 4:00h–5:00h, then

another peak at 6:00h and 8:00h (Figure 3-5). Mean Cx. cedecei collections rose

sharply beginning at 19:00h, peaking at 22:00h, followed by a sharp decline to zero

captures at 0:00h (Figure 3-5).

55


The wildlife cameras captured 1,264 videos across 130 days from May 19 to

October 4, 2016. Of these videos, 1,259 had identifiable animals. Raccoons made up

the majority of animals observed on the wildlife cameras (n=787) followed by the

eastern gray squirrel (142), Virginia opossum (n=122), and eastern woodrat (n=94)

(Figure 3-6). The animal species and quantity of observation were not evenly distributed

among the wildlife cameras, i.e. some cameras were triggered more often than others.

Capturing Wild Rodents In IRC

There were 44 days of rodent trapping from August 01 to October 31, 2016 and

two days in December 2016. Seven cotton mice and four hispid cotton rats were

collected.

Modified no. 17 Trinidad Trap Experimental Trials

Six trials nights were performed with cotton mice and five with hispid cotton rats

(Figure 3-7). A seventh cotton mouse escaped prior to a planned experimental trial. For

each trial a different cotton mouse individual was used. Three of the five trial nights, a

different cotton rat individual was used (Figure 3-7). There was no significant difference

of the quantity Cx. cedecei collected between the control and cotton mouse trials

(T=0.734, df=10, P=0.240) (Figure 3-7). There was a significant difference of the

quantity Cx. cedecei collected between the control and hispid cotton rat trials (T=3.11,

df=8, P<0.01) (Figure 3-7).

Circadian Activity of Culex cedecei and Mammalian Host Animals

There is apparent overlap of activity periods in eastern woodrat, Virginia

opossum, and raccoon, from 2:00h–4:00h (Figure 3-8). There is additional overlap in

56

activity of raccoon and Cx. cedecei activity periods from 4:00h–8:00h (Figure 3-8).

There is also overlap of Cx. cedecei activity periods from 20:00h–23:00h with eastern

woodrat, Virginia opossum, raccoon, and armadillo (Figure 3-8). There were no time-

intervals lacking raccoon observations, i.e. raccoons were observed throughout every

time interval (Figure 3-8). Raccoon was the only animal with mean frequencies of

observations higher than 0.2 occurring from 10:00h–19:00h (Figure 3-8). Regression

analysis Cx. cedecei hourly activity as a function of eastern woodrat hourly sightings

were significant (R2=0.49, df=22, P<0.001) (Figure 3-8). Culex cedecei hourly activity as

a function of the other host animals were not significant, i.e. raccoon (R2=0.01, df=22,

P=0.727), Virginia opossum (R2=0.16, df=22, P=0.050), and armadillo (R2=0.14, df=22,

P=0.710) (Figure 3-8).

There was no significant association between the number of Cx. cedecei host

animal bloodmeals and the associated host animal percent nightly observations

(P=0.159) (Figure 3-9). Host animals active in the day such as the otter and eastern

gray squirrel, were least fed upon by Cx. cedecei (Figure 3-9). The eastern woodrat was

mostly active at night and accounted for the most bloodmeals (Figure 3-9). Contrary, the

Virginia opossum, armadillo, and brown rat/roof rat were mostly active at night and fed

upon little by Cx. cedecei (Figure 3-9).

57

Table 3-1. Adult mosquitoes sampled from mosquito drift fence.

Mosquito species Total Percent of collection

Aedes (Stg.) albopictus Skuse 1 0.09

Aedes (Och.) atlanticus Dyar and Knab 25 2.30

Aedes (Och.) infirmatus Dyar and Knab 2 0.18

Aedes (Och.) taeiniorhynchus (Wiedemann) 1 0.09

Anopheles (Ano.) atropos Dyar and Knab 16 1.47

Anopheles (Ano.) crucians s.l. Wiedmann 10 0.92

Anopheles (Ano.) quadrimaculatus s.l. Say 1 0.09

Coquillettidia (Cq.) perturbans (Walker) 1 0.09

Culex (Cux.) nigripalpus Theobald 474 43.61

Culex (Mel.) atratus Theobald 2 0.18

Culex (Mel.) cedecei Stone and Hair 392 36.06

Culex (Mel.) erraticus (Dyar and Knab) 5 0.46

Culex (Mel.) iolambdis Dyar 82 7.54

Deinocerites cancer Theobald 71 6.53

Psorophora (Jan.) ferox (von Humboldt) 3 0.28

Uranotaenia (Ura.) lowii Theobald 1 0.09

Total 1,087 100

Values represent total and percent of from 27 days of sampling June 29 to August 1, 2016.

58

Figure 3-1. Mosquito drift fence. Photo courtesy of Isaiah Hoyer.

Figure 3-2. Close-up of a “sticky-clock” suction device and mosquito drift fence. Photo

courtesy of Isaiah Hoyer.

59

Figure 3-3. Wildlife camera (Stealth Cam G42NG), used for capturing animal activity

patterns. Photo courtesy of Isaiah Hoyer.

60

Figure 3-4. Modified no. 17 Trinidad trap. Photo courtesy of Isaiah Hoyer.

61

Figure 3-5. Circadian activity of Culex cedecei.

Figure 3-6. Day and night activity patterns of mammal (10 species) and mourning dove

in Indian River County.

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8M

ean

cap

ture

d C

x. ced

ecei

Time

0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%

Raccoon (787)

North American river otter (8)

Bobcat (10)

Eastern cottontail/marsh rabbit (10)

Roof rat (11)

Hispid cotton rat (5)

Eastern woodrat (94)

Eastern gray squirrel (142)

Nine-banded armadillo (55)

Virginia opossum (122)

Mourning dove (8)

Percent sightings split between day or night

Wild

life

cam

era

to

tal

an

imal

sig

hti

ng

s

DAY NIGHT

62

Figure 3-7. Attraction of Culex cedecei to modified no. 17 Trinidad trap baited with

animal, compared to unbaited traps.

Figure 3-8. Circadian activity of Culex cedecei and mammalian host animals.

0

2

4

6

8

10

12

14

Cotton mouse Hispid cotton rat

To

tal C

x.

ced

ecei

(Mean

+S

EM

)

Host species

host species

control

df T P

Cotton

mouse10 0.734 0.240

Hispid

cotton rat8 3.11 0.007

0

0.1

0.2

0.3

0.4

0.5

0.6

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

Mean

fre

qu

en

cy o

f m

am

mal sig

hti

ng

s

Mean

cap

ture

d C

x.c

ed

ecei

Time

Cx. cedecei Eastern woodrat Raccoon

Virginia opossum Armadillo

63

Figure 3-9. Relationship between nocturnal activity and host use by Culex cedecei for

10 mammal species. Host animal species: A) otter, B) Eastern gray squirrel, C) bobcat, D) raccoon, E) Eastern cottontail/marsh rabbit, F) cotton rat, G) Virginia opossum, H) armadillo, I) Eastern woodrat, and J) brown rat/roof rat.

y = 39.263x + 1.5223R² = 0.23191

0

25

50

75

100

0 0.2 0.4 0.6 0.8 1

No

. C

x.

ced

ecei

blo

od

meals

% Night animal observations

P = 0.159

AB

C

D

E

F

G

HJ

I

df = 8

64

CHAPTER 4

DISCUSSION


Culex cedecei was the most commonly collected mosquito from resting shelters

in IRC, accounting for nearly 38% of the collection (Table 2-1), followed by Culex

nigripalpus and Culex iolambdis, respectively 21% and 13% (Table 2-1). Culex cedecei

was not collected evenly among wireframe resting shelters at different locations, as

more blood-engorged Cx. cedecei were collected at resting shelters in some locations.

Although adult Cx. cedecei habitat was not quantified, location specific collection data

suggests an association of slope and proximity to water. Consistently high numbers of

blood-engorged Cx. cedecei were collected from resting shelter locations that were

characterized as mostly shaded, with a subtle slope angled toward a slow-moving body

water less than 5 meters away. The greatest number of mosquitoes were collected

during the early morning hours, before sunlight penetration through the canopy.

The greatest numbers of total Cx. cedecei were collected in April and the

greatest numbers of blood-engorged Cx. cedecei were collected February, March and

April (Figure 2-6). No analysis was conducted to test what environmental factors

attributed to the monthly mean number of Cx. cedecei. However, recent studies

conducted in the same area involving the utilization of resting shelters to collect Culex

Melanoconion mosquitoes identified months of high abundance occurring during periods

of higher temperature and precipitation (Blosser et al. 2016). It is interesting that the

high quantity of collected Cx. cedecei coincides with the dry season; suggesting

populations may be emerging from permanent bodies of water.

65

There was no significant difference in the quantity of Cx. cedecei collections from

PVC and wireframe resting shelters (P=0.453) (Figure 2-7), therefore these methods

are comparable with regards to capturing Cx. cedecei.

ENP Mosquito Collections

The Everglades National Park scientific research and collection permit stated that

“traps may only be present in the field during collection trips.” The ENP permit

prohibited leaving resting shelters or any field equipment within ENP outside the

sampling periods. It was not convenient to transport 20 or more wireframe resting

shelters to and from ENP during each sampling period. Therefore, we compared

published and novel methods to collect resting Culex (Melanoconion) spp., targeting

blood-engorged Cx. cedecei. Timed natural aspirations, three different resting shelter

methods and CO2-baited CDC miniature light-traps supported feasible transport to and

from ENP. The resting shelters were the most efficient method for collecting blood-

engorged Cx. cedecei.

Aspirations of mosquitoes from natural resting-sites were physically strenuous

and yielded low overall numbers of Cx. cedecei. The PVC resting shelters were more

effective in capturing Cx. cedecei than natural aspirations (Figure 2-9) with the

exception of samples from Snake Bight Trail. The lack of significant difference at Snake

Bight Trail was likely due to large day-to-day variation in numbers collected, despite

large differences in total mosquitoes collected from PVC resting shelters (n=209) and

natural aspirations (n=29) (Figure 2-9). The raw numbers suggest the use of PVC

resting shelters efficiently collect Cx. cedecei better than natural aspirations (Figure 2-

9).

66

Additionally, hazards inherent to targeting natural resting mosquito habitat in

ENP for every site were not quantified, but could be an important consideration when

selecting a sampling method. The natural aspiration technique was to stealthily place

the aspirator in areas that potentially harbored resting mosquitoes, e.g. crevices, tree

cavities, and solution holes. Many occasions involved the investigator kneeling and

extending their arm quickly to aspirate resting mosquitoes before they were disturbed.

The natural aspirations put a field-tired person at unnecessary risk, e.g. stumbling upon

a timber rattle snake, cotton mouth, or alligator. Manmade resting shelters are

reproducible and likely safer means of sampling resting mosquitoes while avoiding

natural hazards.

As mentioned above, the CO2-baited CDC miniature light-traps were a less

efficient method for capturing blood-engorged Cx. cedecei compared to PVC resting

shelters (Table 2-3). Two consecutive nights of CO2-baited CDC miniature light-trap

data suggests Cx. cedecei is uncommon in the Road to Anhinga site, accounting for the

third most commonly collected mosquito (n=1,891; 7.36% of collection) where Ae.

taeniorhynchus was the most common mosquito collected (n=19,964; 77.7% of

collection). At the Bear Lake site Cx. cedecei was not collected and Ae. taeniorhynchus

was overwhelmingly the most commonly collected (n=102,021; 99.12%). The adult

mosquito species collected are dependent upon the methods used to capture them

(Silver 2008). The resting shelter data from Bear Lake clearly indicates Cx. cedecei are

more abundant than what might be conceived utilizing CO2-baited CDC miniature light-

traps. There is not a single “catch-all” method to collect all the species of mosquitoes

occupying a given area (Silver 2008).

67

PVC, pop-up with handheld aspirator and pop-up with pump-action resting

shelters in ENP were compared to identify differences in the quantity of Cx. cedecei

collected. The statistical outcomes suggest they are equally efficient for collecting Cx.

cedecei, i.e. the quantity of Cx. cedecei collected from PVC, pop-up with handheld

aspirator and pop-up with pump-action resting shelters are comparable. There was no

significant difference in the quantity of collected Cx. cedecei from PVC and the two

different pop-up resting shelters designs. There was no significant difference in the

quantity of collected Cx. cedecei from PVC and pop-up with handheld aspirator, PVC

and pop-up with pump-action, or pop-up with handheld aspirator and pop-up with pump-

action. The difference in pop-up and PVC resting shelter materials were minimal. The

primary difference was the frame used to support the heavy-duty black garbage bag,

where the PVC resting shelter used PVC piping (Figure 2-2), the pop-up resting shelter

was supported by a flexible metal wire (Figure 2-3). It is unknown how the effect of rust

would have on mosquito collections. Overtime, especially in wireframe resting shelters,

the metal tended to rust after several days of exposure.

Over the course of the sampling periods using PVC resting shelters, Culex

subgenus Melanoconion were the most commonly collected mosquitoes (Table 2-2),

suggesting PVC resting shelters provide attractive resting habitat for Culex

Melanoconion mosquitoes. There are two proposed explanations: one, Culex subgenus

Melanoconion preferentially rest in dark-basal habitats, where other mosquito

subgenera rest in different habitats or are less selective with resting sites, and two,

Culex subgenus Melanoconion are more abundant than other mosquito subgenera. The

second is unlikely as demonstrated by CO2-baited CDC miniature light-trap collections,

68

where a single species, Ae. taeniorhynchus was far more abundant than others (Table

2-3). Thus, it is suspected Culex subgenus Melanoconion exhibit selective resting site

behavior, different from other mosquito subgenera.

The southern and northern most sampling sites in ENP exhibit different seasonal

patterns of Cx. cedecei abundance (Figure 2-8). The ENP sites Nine Mile Pond, Snake

Bight, and Bear Lake, are located at the southern end of the park and are predominantly

salt-marsh and mangrove habitats. The ENP sites Road to Anhinga, Twin Pine

Hammock, and Road to Mahogany Hammock, are located towards the northern end of

the park and are predominantly hardwood hammock habitats. There were higher

percent collected blood-engorged Cx. cedecei collected from the southern sites relative

to the northern sites from December to May; which co-occurs with the dry season.

Conversely, a higher percent collected blood-engorged Cx. cedecei occurred from the

northern sites from June to August, coinciding with the wet season which begins mid-

May and ends late-November. Perhaps habitat and the volume of precipitation explains

the seasonal inverse relationship of the percent collected blood-engorged Cx. cedecei

from ENP southern and northern sites. There is more available larval habitat during the

wet-season, increasing the abundance of Cx. cedecei. The southern end of ENP can

sustain a higher abundance of Cx. cedecei during the dry season than the northern end

of the park because the southern end has a lower water table which sustains more

mosquito larval habitats. Additionally, the quantity of blood-engorged Cx. cedecei is

likely attributed to the availability of mammalian hosts. Everglades National Park rodent

densities increase during the wet season in the hardwood hammocks (Lord et al. 1973;

Smith and Vrieze 1979). The hammocks become islands as water levels rise, isolating

69

vertebrate hosts and mosquitoes together from other landscapes. An increase in density

and therefore isolation in hammocks of rodents such cotton mice and hispid cotton rats

are documented, inferring that it is difficult for them to disperse during the wet season

(Lord et al. 1973; Bigler and Jenkins 1975). More “hammock islands” were sampled in

the northern most end of ENP, whereas the southern ENP site were predominantly

larger and more continuous landscapes less likely to transform into islands as water

levels rise.


The majority of Cx. cedecei bloodmeal nucleotide similarities were 98-99%,

leaving little doubt in the validity of bloodmeal identifications. The unknown host-blood

sources were likely due to poor quality host DNA, prolonged exposure of blood-

engorged specimens, or other errors that occurred during host DNA extractions, PCR,

or sequencing. During the PCR assays, the mammal primers H2714/L2513 were used

first, and as expected were the most successful in amplifying host DNA due to prior

knowledge that Cx. cedecei primarily consumes mammal blood (Edman 1979). The

other primer sets, L0/H1 and 16L1/H3056, respectively targeting bird and reptile DNA,

were sequentially used when the mammal primer set H2714/L2513 failed. If all three

primer sets failed to amplify host DNA, then the samples were not sequenced. It is

assumed that the true identity of the unknown host-blood sources are represented in the

bloodmeal data set.

There was no significant difference detected in the distribution of IRC Cx.

cedecei host-use across sampling periods (Figure 2-11). Suggesting that in IRC, no

seasonal shifts of host-use by Cx. cedecei occurred during the year-long sampling

period, i.e. the proportion of host species fed upon by Cx. cedecei remained constant.

70

The findings suggest host species were equally available throughout the year-long

sampling period.

The significant difference detected across sampling periods in ENP Cx. cedecei

bloodmeals was likely attributed to a shift in Cx. cedecei host use to cotton mice in

February (Figure 2-11). Cotton mice populations in nearby Everglades habitats are

documented to rise in winter and spring (Lord et al. 1973; Bigler and Jenkins 1975).

Perhaps the shift in Cx. cedecei host-use towards cotton mice was a result of increased

availability of cotton mice, e.g. due to an increase in cotton mice density or abundance.

The bloodmeal results suggest that Cx. cedecei are primarily mammal feeders,

which is concurrent with Edman (1979). Interestingly, the percent of identified Cx.

cedecei rodent bloodmeals from IRC and ENP were strikingly different than Edman’s

(1979). The IRC Cx. cedecei percent rodent bloodmeals from Edman (1979) and I

respectively were 15% and 60%. The ENP Cx. cedecei percent rodent bloodmeals from

Edman (1979) and I respectively were 54% and 98%. Location might explain the

differences in IRC Cx. cedecei bloodmeal results from Edman (1979). In IRC blood-

engorged Cx. cedecei were collected on the grounds of the Florida Medical Entomology

Lab and the neighboring South Oslo Riverfront Conservation Area; whereas Edman

(1979) in IRC sampled from Schwey Hammock, which has since been developed into a

citrus grove. It is possible that the vertebrate host community from my sampling area

and Edman’s (1979) were different, such that there was a disproportionate availability of

vertebrate host species for Cx. cedecei to acquire a bloodmeal.

Location likely does not explain the differences in my ENP Cx. cedecei

bloodmeal results from Edman (1979). Within ENP, Edman (1979) sampled from

71

Mahogany Hammock. I sampled from eight sites spread along the 64 kilometer stretch

of Main Park Road, including hammocks bordering Mahogany Hammock, i.e. Road to

Mahogany Hammock. Rodent bloodmeals accounted for 54% of total hosts in ENP in

Edman (1979), where other mammals such as white-tailed deer, raccoon, and Virginia

opossum account for the other 46%. In contrast, rodents were 98% of total bloodmeals

in ENP in my work, where the eastern cottontail/marsh rabbit, raccoon and white-tailed

deer account for the other 2% (Table 2-4). The difference may be attributed to a change

in Cx. cedecei innate host-preference or a change in the host-community. The latter is

more feasible, because in many mosquito species host preference is highly plastic

within their natural host range where differences are caused mostly by the relative

abundance of available hosts (Burkett-Cadena et al. 2011b; Takken and Verhulst 2013).

Culex cedecei bloodmeals from IRC demonstrate that they will readily feed on

mammals other than rodents such as the eastern cottontail/marsh rabbit, raccoon, and

Virginia opossum (Table 2-4). Therefore, the predominantly rodent host bloodmeals

from ENP suggest a reduction in availability of non-rodent mammal hosts compared to

Edman’s (1979) ENP bloodmeal data. The present ENP mammal community is likely

different than it was when Edman (1979) collected mosquitoes in the late 1970s. Dorcas

et al. (2012) documents a severe mammal decline in the ENP mammal community.

Evidence from systematic road surveys measuring live and road-killed wildlife in ENP

from 1995-1996 and 2003-2011, incriminate the invasive Burmese python (Python

molurus bivittatus) as the causative factor of the mammal declines (Dorcas et al. 2012).

Raccoon, Virginia opossums, and rabbits were the most commonly sighted mammals in

ENP in 1996-1997 (Dorcas et al. 2012). Reproduction of the Burmese python was first

72

reported at the southernmost end of ENP near the Flamingo marina in the 1990s,

however this python was not documented as an established invasive species until 2000

(Dorcas et al. 2012). Between 2003-2011, decreased observations were documented

for raccoon (99.3%), Virginia opossum (98.9%), white-tailed deer (94.1%), bobcat

(87.5%) and rabbits were failed to be detected altogether (Dorcas et al. 2012). A slight

increase in rodent observations were noted (Dorcas et al. 2012). Although the Burmese

python readily prey upon rodents, it is theorized that rodent populations have remained

stable or have increased because the python has reduced selection pressure from

natural predators such as bobcats and foxes (Dorcas et al. 2012). Additionally, rodents

exhibit a fecund life history making them more resilient to python predation (Dorcas et

al. 2012). Dorcas et al. (2012) discusses several indirect and direct evidence

incriminating the Burmese python as the causative factor affecting ENP mammal

populations.

Further incrimination of the Burmese python facilitating the decline of ENP

mammal populations is presented in McCleery et al. (2015). Marsh rabbits fitted with a

radio transmitter were translocated to sites inside the Burmese python range and

control sites outside the range of the Burmese python (McCleery et al 2015). The

Burmese python accounted for 77% of marsh rabbit mortalities at sites residing within

the Burmese python range and 71% of marsh rabbit mortalities were caused by

mammals in the control sites (McCleery et al. 2015). Thus, suggesting the invasive

Burmese python competes with native mammal predators for prey species (McCleery et

al. 2015). The invasion of the Burmese python has negatively affected faunal

communities and the ecosystem function in ENP (Dorcas et al. 2012; McCleery et al.

73

2015). Additionally, other invasive apex predators that readily prey on mammals and

have been sighted in ENP are Eunectes murinus (Linnaeus) (green anaconda),

Eunectes notaeus Cope (yellow anaconda), and Crocodylus niloticus Laurenti (Nile

crocodile) (Early Detection and Distribution Mapping System 2017). The southern third

of Florida is suggested to be particularly vulnerable to invasions of non-indigenous

species due to its geographical location, climate and apparent impoverished native biota

(Myers and Ewel 1990). South Florida is surrounded by water on three sides, rarely

freezes, and the landscape has been severely modified via human practices such as

drainage, diking, burning outside the natural fire season and urbanization (Myers and

Ewel 1990).

It is alarming that we have detected a change in the ENP mammal community

from pairing our Cx. cedecei bloodmeal data with Edman’s (1979). It is beyond the

scope of our work to determine whether the 44% increase in rodent Cx. cedecei

bloodmeals is a direct effect from the Burmese python establishment over the course of

a near four decade gap. Most importantly, to deduce further information regarding the

status of ENP mammal richness and abundance, attention should be shifted towards

monitoring ENP mammal populations and a broader investigation of mosquito species

blood feeding patterns.

Mosquito Drift Fence, Wildlife Cameras, and Modified no. 17 Trinidad Trap

The mosquito drift fence data suggests Cx. cedecei is a crepuscular active

mosquito (Figure 3-5). Additionally, the mosquito drift fence data demonstrates Cx.

cedecei flight activity will occur at heights less than one meter from the ground. The

directionality or nature of the Cx. cedecei movement to become captured in the drift

fence is unknown. The drift fence was not designed to measure where the mosquitoes

74

were coming from or what would influence them to take flight. The wildlife camera data

provided information on activity patterns of mammalian hosts that occur in the IRC

sample area. The modified no. 17 Trinidad trap experimental trials were designed to

investigate Cx. cedecei host selection between two different rodent species. We failed

to capture two different rodent species on a single trap night, and therefore performed

several experimental trials comparing a single rodent species to a control. Nonetheless,

combining the mosquito drift fence, wild camera, and modified no. 17 Trinidad trap data

with the Cx. cedecei bloodmeal data provides valuable insight on Cx. cedecei

mammalian host interactions.

The wildlife cameras likely did not capture all animal activity in their field of vision.

The wildlife cameras had a 1-3 second delay from when they triggered and started

recording. Many of the animals captured were likely moving slow enough to be

recorded, changed direction to where upon they stayed in the camera field of vision or,

in the case of raccoon video recordings, there were usually several individuals moving

within view. Typical raccoon recording involved multiple individuals, where the lead

raccoon would trigger the camera. Few mice were captured and zero reptiles or

amphibians were captured with the exception of one alligator (Figure 3-6). Small

animals that were out of the vicinity to trigger the cameras, were likely under

represented. Additionally, the wildlife cameras were oriented towards terrestrial habitats

and therefore were not targeting arboreal animals. Eastern cottontail/marsh rabbits are

commonly seen on the grounds of FMEL, therefore it was surprising more were not

captured by the wildlife cameras (n=10) (Figure 3-6). The few rabbits recorded were

75

motionless and already in the field of vision, sometimes in the background of other

wildlife activity. Perhaps the rabbits move to quickly to be detected.

The conclusions to be drawn from the wildlife cameras become apparent when

paired with the mosquito drift fence and Cx. cedecei bloodmeal data. There is apparent

overlap of crepuscular activity between Cx. cedecei, the eastern woodrat, Virginia

opossum, raccoon, and armadillo (Figure 3-8). However, the eastern woodrat is the only

host animal with a significant association between Cx. cedecei circadian activity (Figure

3-8). The bloodmeal data further supports eastern woodrat and Cx. cedecei interaction

(Figure 3-9). The Eastern woodrat was mostly active at night and accounted for the

most bloodmeals (Figure 3-9). Interestingly, there was no significant association

between the number of Cx. cedecei host animal bloodmeals and the associated host

animal percent nightly observations (Figure 3-9). Host animals active in the day such as

the otter and eastern gray squirrel, were least fed upon by Cx. cedecei (Figure 3-9).

Contrary, the Virginia opossum, armadillo, and brown rat/roof rat were mostly active at

night and fed upon little by Cx. cedecei (Figure 3-9). Vertebrate host circadian activity is

not necessarily indicative of vector-host use. There are likely multiple factors affecting

Cx. cedecei host-use. A host animal may be more or less tolerant of blood feeding

mosquitoes (Burkett-Cadena et al. 2011b; Takken and Verhulst 2013).

Host animal activity does not determine availability, such that overlapping vector-

host activity equates to the likelihood of blood feeding occurrences. The susceptibility of

blood feeding is likely vector-host species dependent. For example, raccoon constituted

7% of the IRC bloodmeals, however raccoon accounted for 60% of the wildlife video

recordings and is active well within the mean activity of Cx. cedecei. It is not

76

immediately apparent what explains the lack of raccoon host-blood source in the Cx.

cedecei bloodmeals. Additionally, armadillos fall within the activity periods of Cx.

cedecei and are nearly absent from the bloodmeals. Circadian activity likely influences

host use, however circadian activity alone does not drive patterns of host use.

Culex cedecei host use was further investigated by the modified no. 17 Trinidad

trap. However, capturing wild rodents to be used in the modified no. 17 Trinidad trap

proved to be difficult. Seven cotton mice and four hispid cotton rats were captured over

the course of 46 days from August 01 to October, 2016. Frequent trap molestations

diminished the likelihood of captures. In most cases the traps would be closed and

moved slightly with the bait missing. Occasionally traps were found ten or more meters

from their original placement, and usually bent or crushed. Raccoons and the

occasional Virginia opossum were documented as the likely perpetrators of the trap

disturbances via wildlife camera recordings. Additionally, ants would swarm the traps.

The ants were assumed to be attracted by the bait that was largely composed of peanut

butter. Ortho Home Defense insect killer spray helped alleviate the ant problem.

The captures allotted six trials nights with cotton mice and five with hispid cotton

rats for the modified no. 17 Trinidad experimental trials (Figure 3-7). There was no

significant difference in mean collected Cx. cedecei from cotton mouse trials (P=0.240)

(Figure 3-7). There was a significant difference in mean collected Cx. cedecei from the

hispid cotton rat trials (P<0.01) (Figure 3-7) demonstrating the Cx. cedecei is attracted

to this host. However, because of low sample sizes more meaningful conclusions can

not be drawn. There were only five replicates and the total number of Cx. cedecei

collected from the hispid cotton rat trials were low, where neither treatment nor control

77

reached over 7 Cx. cedecei per trial (Figure 3-7). There are several reasons that might

explain the insignificant results found between cotton mouse treatment and control, and

that the overall difference in treatment and control for both rodent species was not

greater. One, Cx. cedecei was visiting, however failed to be captured by the modified

no. 17 Trinidad trap. Culex cedecei may have been visiting the modified no. 17 Trinidad

trap at a direction where they would not be captured by the mosquito collection

chamber, i.e. CDC miniature suction trap. Two, the scent of the host-animals was not

sufficient or that the scent was not properly wafting throughout the environment to

attract Cx. cedecei. Incidentally, a modification of the modified no. 17 Trinidad trap that

accounted for vision could be more favorable in attracting host-seeking Cx. cedecei, i.e.

a transparent trap design. Perhaps, vision of the vertebrate host is equally as important

as scent.

The bloodmeal findings suggest Cx. cedecei feeds upon rodents, including the

hispid cotton rat in both IRC and ENP (Table 2-4). Our modified no. 17 Trinidad trap

experimental trials with cotton mice were unable to distinguish statistical differences in

the quantity of Cx. cedecei collected from their respective control modified no. 17

Trinidad traps (Figure 3-7). Also, the trials were not comparable to identify a statistical

difference in Cx. cedecei host selection between cotton mice and hispid cotton rats

because the trials between rodent species were conducted on different nights. The

question remains if Cx. cedecei is actively seeking particular rodent host species, or

simply that some rodent hosts are more accessible than other vertebrates.

The circumstances of where, when and how Cx. cedecei acquire vertebrate

blood are unknown. Our data suggests Cx. cedecei is likely blood feeding in basal

78

habitats, areas coinciding with host ecology. The Eastern woodrat was the most

common bloodmeal of Cx. cedecei in IRC (38%) (Table 2-4). The eastern woodrat

forages predominantly from basal shrubbery and construct terrestrial nests (Pearson

1952). The hispid cotton rat was by far the most common host of Cx. cedecei in ENP

(65%) (Table 2-4). The hispid cotton rat nests on the ground in dense vegetation or may

construct burrows, and is poorly adapted for arboreal habitats, having a chunky, heavy

body, and relatively short legs and tail (Packer and Layne 1991). The cotton mouse was

one of least utilized hosts from IRC (<1%) and the third most common bloodmeal from

ENP (5%) (Table 2-4). The cotton mouse has a broad habitat tolerance, utilizing

burrows, tree cavities, fallen logs, stumps, buildings, and exhibits good climbing ability

in laboratory tests (Packer and Layne 1991). The ecology the host animals is one facet

of a myriad of factors that contribute to the blood feeding patterns of Cx. cedecei.

Implications for Everglades Virus Transmission in Florida

The near four-decade gap between Edman (1979) and our current

documentation of Cx. cedecei host use, provides a unique opportunity to explore

implications for EVEV transmission in Florida. With the support of Dorcas et al. (2012)

and McCleery et al. (2015), we suggest the change in ENP mammal community has

altered Cx. cedecei host-feeding patterns, such that the proportion of rodent bloodmeals

has increased from 54% to 98%. Since Edman (1979), there has been a severe decline

in medium-large sized mammals such as raccoon, eastern cottontail/marsh rabbit, and

white-tailed deer (Dorcas et al. 2012). Raccoon, Virginia opossum, and white-tailed deer

constitute 46% of Edman’s (1979) ENP Cx. cedecei bloodmeals and from our current

investigations account for 2% (Table 2-4). The proposed ecological driver that has

caused this shift in Cx. cedecei host use is the alteration of the ENP mammal

79

community, where medium-large sized mammals such as raccoon, eastern

cottontail/marsh rabbit, Virginia opossum, and white-tailed deer have been displaced by

the Burmese python (Dorcas et al. 2012; McCleery et al. 2015).

The detected shift in Cx. cedecei host use may represent an exemplary dilution

effect episystem. The dilution effect is a process where high host species diversity

reduces vector infection prevalence by diluting the effects of the most competent

pathogen reservoir-host (Ostfeld and Keesing 2000). Everglades virus transmission in

ENP meets the four conditions described by Ostfeld and Keesing (2000) that apply to

the dilution effect: 1) a generalist vector: Cx. cedecei acquires bloodmeals form a

variety of mammal species (Edman 1979), 2) oral acquisition of the pathogen: Cx.

cedecei transmits EVEV horizontally to vertebrate hosts, whereby no vertical

transmission from mother to offspring has been detected (Coffey and Weaver 2005), 3)

variation in host reservoir competence: the two documented reservoir hosts of EVEV

are the cotton mouse and hispid cotton rat (Bigler et al. 1974a; Coffey et al. 2004), other

vertebrate species fed upon by Cx. cedecei have been discounted as supporters of

EVEV proliferation (Chamberlain et al. 1969; Bigler 1969; Bigler and Hoff 1975), and 4)

the most competent reservoir hosts should be one of the most numerically dominant

species in the community: throughout ENP, the cotton mouse and hispid cotton rat are

abundant rodent species (Chamberlain et al. 1969; Bigler and Jenkins 1975).

Increased EVEV transmission and prevalence is suggested by comparing the

proportion of Cx. cedecei reservoir host use (cotton mouse and hispid cotton rat) from

Edman’s (1979) and our current bloodmeal data. The current ENP Cx. cedecei reservoir

host use was 70% (Table 2-4), and Edman’s (1979) was 49%. Therefore, the 21%

80

increase of reservoir host use by Cx. cedecei documents a less diluted episystem, likely

inferring increased transmission of EVEV. The current IRC Cx. cedecei reservoir host

use was 19% (Table 2-4). Relative to the current ENP Cx. cedecei reservoir host use,

the IRC data displays a diluted episystem. Edman’s (1979) in tandem with our IRC Cx.

cedecei host use data demonstrate that Cx. cedecei will readily feed on non-reservoir

hosts such as raccoon, eastern cottontail/marsh rabbit, and Virginia opossum (Table 2-

4). Therefore, the lack of non-reservoir host of Cx. cedecei in ENP suggests reduction in

non-reservoir host availability to Cx. cedecei, likely due to reduced abundance from

direct predation or competition of the Burmese python (Dorcas et al. 2012; McCleery et

al. 2015).

In conclusion, EVEV is likely more prevalent in ENP than previously documented

(20th century) due to increased feeding on reservoir hosts. The extant of EVEV

transmission is restricted South Florida, largely due to the range of Cx. cedecei (Coffey

et al. 2006). The risk EVEV spill over to humans is difficult to quantify. Previous studies

have documented the true extant of EVEV in humans is likely under documented, due

to the lack of severity and non-specific symptoms in infected persons (Coffey et al.

2006). It is concerning that EVEV antibodies were found in sentinel dogs as far North as

Tallahassee, where the dogs had no travel history to South Florida (Coffey et al. 2006).

More concerning is the potential and unknown circumstances that facilitate EVEV

mutation into an epizootic VEE serotype such as IAB or IC (Weaver et al. 2004). A

further understanding of EVEV ecology will elucidate the circumstances that support

spillover to people and the potential for epizootics to emerge. Serosurveys involving

dogs and wild rodents, enhanced Cx. cedecei surveillance, and attempts to isolate

81

EVEV from vertebrates in regions where historical EVEV seroconversion has occurred

is recommended (Coffey et al. 2006). Field studies quantifying the abundance of EVEV,

Cx. cedecei, and mammals in locations inside and outside the Burmese python range

will further support that EVEV transmission in ENP as an exemplary dilution effect

episystem.

82

LIST OF REFERENCES

Belkin, J. N. 1969. The problem of the identity of the species of Culex (Melanoconion) related to Opisthopus. Mosq. Syst. Newsl. 1(2): 26–28.

Bigler, W. J. 1969. Venezuelan encephalitis antibody studies in certain Florida wildlife.

J. Wildlife Dis. 5: 267–270. Bigler, W. J. and G. L. Hoff. 1975. Arbovirus Surveillance in Florida: wild vertebrate

studies 1965–1974. J. Wildlife. Dis. 11: 348–356. Bigler, W. J. and J. H. Jenkins. 1975. Population characteristics of Peromyscus

gossypinus and Sigmodon hispidus in Tropical Hammocks of South Florida. ASM. 56(2): 633–644.

Bigler, W. J., A. L. Lewis, and F. M. Wellings. 1974a. Experimental infection of the

cotton mouse (Peromyscus gossypinus) with Venezuelan equine encephalomyelitis virus. Am. J. Trop. Med. Hyg. 23: 1185–1188.

Bigler, W. J., A. K. Ventura, A. L. Lewis, F. M. Wellings, and N. J. Ehrenkranz. 1974b.

Venezuelan equine encephalomyelitis in Florida: endemic virus circulation in native rodent populations of Everglades hammocks. Am. J. Trop. Med. Hyg. 23: 513–521.

Bigler, W. J. and G. L. Hoff. 1975. Arbovirus surveillance in Florida: wild vertebrate

studies 1965–1974. J. Wildlife Dis. 11: 348–356. Blosser, E. M., T. Stenn, C. Acevedo, and N. D. Burkett-Cadena. 2016. Host use and

seasonality of Culex (Melanoconion) iolambdis (Diptera: Culicidae) from eastern Florida, USA. Acta Tropica. 164: 352–359.

Burkett-Cadena, N. D. 2011a. A Wire-Frame Shelter for Collecting Resting Mosquitoes.

J. Am. Mosquito Contr. 27(2):000–000. Burkett-Cadena, N. D., C. J. W. McClure, R. A. Ligon, S. P. Graham, C. Guyer, G. E.

Hill, S. S. Ditchkoff, M. D. Eubanks, H. K. Hassan, and T. R. Unnasch. 2011b. Host Reproductive Phenology Drives Seasonal Patterns of Host Use in Mosquitoes. Plos One. 6: 1–7.

Calisher, C. H., R. E. Shope, W. Brandt, J. Casals, N. Karabatsos, F. A. Murphy, R. B.

Tesh, and M. E. Wiebe. 1980. Proposed antigenic classification of registered arboviruses. I. Togaviridiae, Alphavirus. Intervirology. 14: 229–232.

Chamberlain, R. W., W. D. Sudia, P. H. Coleman, and T. H. Work. 1964. Venezuelan

equine encephalitis virus from South Florida. Science. 145: 272–274.

83

Chamberlain, R. W., W. D. Sudia, T. H. Work, P. H. Coleman, V. F. Newhouse, and J. G. Johnston, Jr. 1969. Arbovirus Studies in South Florida, with Emphasis on Venezuelan Equine Encephalomyelitis Virus. Am. J. Epidemiol. 89(2): 197–210.

Coffey, L. L., A. S. Carrara, S. Paessler, M. L. Haynie, R. D. Bradley, R. B. Tesh, and S.

C. Weaver. 2004. Experimental Everglades Virus Infection of Cotton Rats (Sigmodon hispidus). Emerg. Infect. Dis. 10: 2182–2188.

Coffey, L. L. and S. C. Weaver. 2005. Susceptibility of Ochlerotatus taeniorhynchus and

Culex nigripalpus for Everglades virus. Am. J. Trop. Hyg. 73(1): 11–16. Coffey, L. L., C. Crawford, J. Dee, R. Miller, J. Freier, and S. C. Weaver. 2006.

Serologic Evidence of Widespread Everglades Virus Activity in Dogs, Florida. Emerg. Infect Dis. 12: 1873–1879.

Darsie, R. F. and R. A. Ward. 2005. Identification and Geographical Distribution of the

Mosquitoes of North America, North of Mexico, 2nd ed. University Press of Florida, Gainesville, FL.

Davies, J. B. 1971. A small trap for use with animal or carbon dioxide baits. Mosq.

News. 31: 41–43. Day, J. F., L. M. Stark, J. Zhang, A. M. Ramsey, and T. W. Scott. 1996. Antibodies to

Arthropod-borne Encephalitis Viruses in Small Mammals from Southern Florida. J. Wildlife Dis. 32(3): 431–436.

Dorcas, M. E., J. D. Willson, R. N. Reed, R. W. Snow, M. R. Rochford, M. A. Miller, W.

E. Meshaka Jr., P. T. Andreadis, F. J. Mazzotti, C. M. Romagosa, and K. M. Hart. 2012. Severe mammal declines coinside with proliferation of invasive Burmese pythons in Everglades National Park. P. Natl. Acad. Sci. USA. 109(7): 2418–2422.

Edman, J. D. 1979. Host-Feeding Patterns of Florida Mosquitoes (Diptera: Culicidae)

VI. Culex (Melanoconion). J. Med. Entomol. 15: 521–525. Early Detection and Distribution Mapping System. 2017. The Universtiy of Georgia:

center for invasive species and ecosystem health. [Internet] [March 23, 2017] https://www.eddmaps.org/Species/.

Kilpatrick, A. M, P. Daszak, M. J. Jones, P. P. Marra, and L. D. Kramer. 2006. Host

heterogeneity dominates West Nile virus transmission. P. Roy. Soc. B-Biol. Sci. 273: 2327–2333.

Kitano, T., K. Umetsu, W. Tian, and M. Osawa. 2007. Two universal primer sets for

species identification among vertebrates. International Journal of Legal Medicine. 121: 423–427.

https://www.eddmaps.org/Species/

84

Lord, R. D., C. H. Calisher, W. D. Sudia, and T. H. Work. 1973. Ecological

investigations of vertebrate hosts of Venezuelan equine encephalomyelitis virus in south Florida. Am. J. Trop. Med. Hyg. 22: 116–123.

McCleery, R. A., A. Sovie, R. N. Reed, M. W. Cunningham, M. E. Hunter, and K. M.

Hart. 2015. Marsh rabbit mortalities tie python to the precipitous decline of mammals in the Everglades. Pr. Soc. B-Biol. Sci. 281: 1–7.

Myers, R. L. and J. J. Ewel. 1990. Ecosystems of Florida. University of Central Florida

Press, Orlando, FL. Ostfeld, R. S. and F. Keesing. 2000. The function of biodiversity in the ecology of

vector-borne zoonotic diseases. Canadian Journal of Zoology. 78: 2061–2078. Packer, W. C. and J. N. Layne. 1991. Foraging Site Preferences and Relative

Arboreality of Small Rodents in Florida. Am. Midl. Nat. 125: 187–194. Silver, J. B. 2008. Mosquito Ecology: Field Sampling Methods, third edition. Springer,

Dordrecht, The Netherlands. Smith, A. T. and J. M. Vrieze. 1979. Population Structure of Everglades Rodents:

response to a patchy environment. J. Mammal. 60: 778–794. Sudia, W. D., V. F. Newhouse, and W. A. Chappell. 1968. Venezuelan Equine

Encephalitis Virus-Vector Studies Following a Human Case in Dad County, Florida. Mosq News. 29(4): 596–600.

Takken, W. and N. O. Verhulst. 2013. Host Preferences of Blood-Feeding Mosquitoes.

Annu. Rev. Entomol. 58:433–453. Ventura, A. K., E. E. Buff, and N. J. Ehrenkranz. 1974. Human Venezuelan Equin

Encephalitis Virus Infection in Florida. Am. J. Trop. Hyg. 23(3): 507–512. Weaver, S. C., C. Ferro, R. Barrera, J. Boshell, and J. C. Navarro. 2004. Venezuelan

Equine Encephalitis. Annu. Rev. Entomol. 49: 141–174. Weaver, S. C., L. A. Bellew, and R. Rico-Hesse. 1992. Phylogenetic Analysis of

Alphaviruses in the Venezuelan Equine Encephalitis Complex and Identification of the Source of Epizootic Viruses. Virology. 191: 282–290.

Weaver, S. C., W. F. Scherer, C. A. Taylor, D. A. Castello, and E. W. Cupp. 1986.

Laboratory Vector Competence of Culex (Melanoconion) cedecei for Sympatric and Allopatric Venezuelan Equine Encephalomyelitis Viruses. Am. J. Trop. Med. Hyg. 35(3): 619–623.

85

Williams, M. R., and H. M. Savage. 2009. Identification of Culex (Melanoconion) Species of the United States Using Female Cibarial Armature (Diptera: Culicidae). J. Med. Entomol. 46(4): 745–752.

Work, T. H. 1964. Serological Evidence of Arbovirus Infection in the Seminole Indians of

Southern Florida. Science. 145(3629): 270–272. Young, N. A. and K. M. Johnson. 1969. Antigenic variants of Venezuelan equine

encephalitis virus: their geographic distribution and epidemiological significance. Am. J. Epidemiol. 89: 286–307.

86

BIOGRAPHICAL SKETCH

Isaiah Joe Hoyer was born in Anchorage, AK, graduated from West Anchorage

High School, and at age 18 moved to Moscow, ID where he acquired a Bachelor of

Science in ecology and conservation biology at the University of Idaho spring 2013.

During the two-year period following his bachelor’s he gathered a diverse array of

teaching and research experience ranging from snail necropsies in Bay Area, CA to

tracking King Cobras in Northeastern Thailand. His zeal for pathogen-vector-host

interactions stemmed from a summer field tech position stationed at Blue Oak Ranch

Reserve in Bay Area, CA, where he investigated the transmission cycle of various

trematode species. In tandem with fascination for trematode ecology and voracious

mosquitoes he encountered in the Thai jungles, he continued his studies at the

University of Florida where he achieved a Master of Science in entomology and

nematology May 2017. He continues his quest for knowledge in medical entomology,

with emphasis on the ecology of vector borne disease.

ECOLOGY OF CULEX (MELANOCONION) CEDECEI, VECTOR OF...

Documents

Transcript of ECOLOGY OF CULEX (MELANOCONION) CEDECEI, VECTOR OF...