Draft - University of Toronto T-Space · E. amylovora, the causative agent of fire blight, produces...

Draft

Rapid identification of Erwinia amylovora and Pseudomonas syringae species and characterization of E. amylovora streptomycin resistance using quantitative PCR assays

Journal: Canadian Journal of Microbiology

Manuscript ID cjm-2018-0587.R2

Manuscript Type: Article

Date Submitted by the Author: 06-Mar-2019

Complete List of Authors: Laforest, Martin; AAC-AAFC, SJSR Research and development CentreBisaillon, Katherine; AAC-AAFCCiotola, Marie; AAC-AAFCCadieux, Melanie; AAC-AAFCHebert, Pierre-Olivier; AAC-AAFCToussaint, Vicky; AAC-AAFCSvircev, Antonet; AAC-AAFC

Keyword: Erwinia amylovora, Pseudomonas syringae, streptomycin resistance, molecular markers, population structure

Is the invited manuscript for consideration in a Special

Issue? :Not applicable (regular submission)

https://mc06.manuscriptcentral.com/cjm-pubs

Canadian Journal of Microbiology

Draft

Apple bacterial diseases

Page | 1

Rapid identification of Erwinia amylovora and Pseudomonas syringae

species and characterization of E. amylovora streptomycin resistance

using quantitative PCR assays

Martin Laforest†, Katherine Bisaillon†, Marie Ciotola†, Mélanie Cadieux†, Pierre-Olivier Hébert†*,

Vicky Toussaint† & Antonet M. Svircev‡

† Agriculture and Agri-Food Canada, 430 Gouin Blvd, Saint-Jean-sur-Richelieu, Québec, Canada, J3B

3E6.

‡ Agriculture and Agri-Food Canada, 4902 Victoria Avenue North, PO Box 6000, Vineland, Ontario,

Canada, L0R 2E0.

* Department of Biology, Sherbrooke University, 2500 University Blvd., Sherbrooke, Québec, Canada,

J1K 2R1

Corresponding author: Martin Laforest, Agriculture and Agri-Food Canada, 430 Gouin Blvd, Saint-Jean-

sur-Richelieu, Québec, Canada, J3B 3E6. Tel : 579-224-3071. E-mail : [email protected]

Page 1 of 34



Draft


Page | 2

Abstract

Erwinia amylovora and Pseudomonas syringae are bacterial phytopathogens responsible for

considerable yield losses in commercial pome fruit production. The pathogens, if left untreated, can

compromise tree health and economically impact entire commercial fruit productions. Historically, the

choice of effective control methods has been limited. The use of antibiotics was proposed as an effective

control method. The identification of these pathogens and screening for the presence of antibiotic

resistance is paramount in the adoption and implementation of the disease control methods. Molecular

tests have been developed and accepted for identification and characterization of these disease-causing

organisms. We improved existing molecular tests by developing methods that are equal or superior in the

robustness for the identification of either E. amylovora or P. syringae while being faster to execute. In

addition, the real-time PCR based detection method for E. amylovora provided complementary

information on streptomycin susceptibility or resistance of individual isolates. Finally, we describe a

methodology and results that compare the aggressiveness of the different bacterial isolates on four apple

cultivars. We show that bacterial isolates have different behaviors when put in contact with various apple

varieties and, hierarchical clustering on the severity of the symptoms indicates a population structure,

suggesting a genetic basis for host cultivar specificity.

Keywords

Erwinia amylovora, Pseudomonas syringae, streptomycin resistance, molecular markers, symptoms,

population structure

Page 2 of 34



Draft


Page | 3

IntroductionDiseases affecting pome fruit production are numerous and range in nature from bacterial, fungal,

viral, phytoplasmas and abiotic disorders (Lee et al. 2000; Ogawa and English 1991). The majority of

infections diagnosed in orchards from Québec, Canada, are caused by bacterial pathogens Erwinia

amylovora (Burrill) Winslow and Pseudomonas syringae van Hall (1902). E. amylovora, the causative

agent of fire blight, produces symptoms such as shoot wilt resulting in a “Shepherd's Crook”, blackening

of twigs, flowers and leaves as if they were burnt by fire (Van der Zwet et al. 2012). Interestingly, fire

blight played an important role in the history of phytobacteriology, as E. amylovora was the first

bacterium demonstrated to cause disease in plants, a discovery made in the late 1800s by Burrill (Kado

2011; Piqué et al. 2015; Van der Zwet et al. 2012). P. syringae pv. syringae causes apple bacterial blast

and cankers while P. syringae pv. papulans will produce blisterspots on apple fruits (Ogawa and English

1991).

Control options for bacterial diseases in apple are limited (see Van der Zwet et al. (2012) and

Vanneste (2000) for more complete reviews). An integrated orchard and nursery management program

that includes pruning of symptomatic twigs, proper sanitation, the use of less susceptible rootstocks and

cultivars, and a series of protective antibiotic sprays during open bloom should be favored. Streptomycin,

kasugamycin, oxytetracycline, and copper are chemicals with bacteriostatic properties that are commonly

used for control of fire blight. Today and in the past decades, streptomycin has been the antibiotic of

choice in pome production due to its high efficacy. This antibiotic compound has been shown to be

systemic and to exert its bactericidal, prophylactic actions at distant sites (Napier et al. 1956). The

efficacy of kasugamycin was more recently shown to be equivalent to the industry-standard streptomycin

(McGhee and Sundin 2011) while oxytetracycline was less efficacious than the other two antibiotics

(Adaskaveg et al. 2011; Jurgens and Babadoost 2013). The ability of copper hydroxide supplemented

with mancozeb to control fire blight was proven to be lesser than all other antibiotic treatments (Jurgens

and Babadoost 2013). Phytotoxicity is most commonly observed in apples when kasugamycin and copper

are used; however this is highly dependent on cultivar, dosage and frequency of treatments (Adaskaveg

Page 3 of 34



Draft


Page | 4

et al. 2011). In Canada the plant bioregulator prohexadione-calcium (Apogee®, BASF, Ludwigshafen,

Germany) is registered for control of fire blight pathogen. The mode of action involves the inhibition of

gibberellin biosynthesis, which in turn reduces shoot elongation and indirectly limits pathogen

progression during spring and summer (Yoder et al. 1999). The use of a yeast antagonist (Aureobasidium

pullulans, Blossom Protect by Bio-ferm, Tulln, Austria) has been permitted in Canada and the United

States (Seibold et al. 2006) for the control of fire blight in the spring during open bloom.

Chemical treatment will select for resistance to the antibiotics used to control the bacterial

diseases, as reviewed by Sundin and Wang (2018). Streptomycin resistance has been documented as early

as 1977 in P. syringae and demonstrated to be associated with the presence of a conjugative plasmid

(Burr et al. 1988; Sundin and Bender 1993; Young 1977). In a similar fashion, copper resistance was

identified in P. syringae in 1986 and shown to be carried on a plasmid (Bender and Cooksey 1986;

Sundin and Bender 1993). A mutation in the rpsL gene as well as the presence of the plasmid pEA29 give

rise to resistance of E. amylovora to streptomycin (Chiou and Jones 1995; Russo et al. 2008). Tolerance

of E. amylovora to copper was reported in Syria in 2009 (Al-Daoude et al. 2009). E. amylovora mutants

resistant to oxytetracycline were selected in the lab and the PR1 plasmid was transferred efficiently in

planta, establishing the possibility of plasmid-borne antibiotic transmission (Lacy et al. 1984). While

there are no currently reported cases of kasugamycin resistance in P. syringae (McGhee and Sundin 2011)

and E. amylovora, kasugamycin resistance has been reported in the rice phytopathogens Acidovorax

avenae subsp. avenae and Burkholderia glumae (Sundin and Wang, 2018). Moreover, the use of

antibiotics to control bacterial diseases in fruit production has the potential to cause human health risks as

resistance conferring genes are often associated with transfer-proficient elements which could potentially

transfer to human pathogens (McManus et al. 2002).

In the context of limited control options and the plant pathogen’s ability to develop resistance, the

rapid identification of bacterial pathogens and their potential to thrive in the presence of antibiotic

compounds is essential to adopt control practices that will increase chances of a successful harvest.

Page 4 of 34



Draft


Page | 5

Multilocus sequencing analysis (MLSA) can identify bacterial species and 16S rDNA sequencing can

provide genus-level classification (Sarkar and Guttman 2004). A PCR using pEa71 specific primers and

quantitative polymerase chain reaction (qPCR) (hpEa and Ea-lsc) assays have been developed to identify

E. amylovora (Gottsberger 2010; Lehman et al. 2008; Taylor et al. 2001). Similarly, a touchdown PCR

assay was developed to identify P. syringae (Guilbaud et al. 2016). We describe a new tool that rapidly

identifies the presence of streptomycin resistance in E. amylovora and a more rapid method for the

identification of P. syringae. E. amylovora and P. syringae disease symptoms were characterized on

apple trees using a disease severity index. The subsequent clustering of the damage level data allowed us

to highlight possible population structure in bacterial isolates obtained either from diagnostic services,

received directly from producers or from a laboratory collection.

Materials & Methods

Bacterial isolates

The vast majority of the isolates, i.e. 239, used in this study were isolated from samples submitted

by Québec’s orchard producers. The bacterial collection located at the Agriculture and Agri-Food Canada

(AAFC) Research Development Centre at Saint-Jean-sur-Richelieu, Québec, provided 7 more isolates

while the Ministère de l’Agriculture, des Pêcheries et de l’Alimentation du Québec (MAPAQ) contributed

26 isolates. The remaining isolate was purchased from ThermoFisher Scientific (Waltham, MA, USA).

Table S1 provides a complete list of all the bacterial isolates used in this study. A subset of 43 of

these bacterial isolates was used to create a diverse panel to test molecular identification protocols. Table

2 describes this panel as well as the host on which they were isolated and the origin of the samples. The

isolates listed in table 2 served as controls to perform and develop genetic tests and identifications were

made for several isolates by sequencing a portion of the 16S rDNA gene.

Isolation of bacteria from infected shoots of apple tree

Page 5 of 34



Draft


Page | 6

Apple tree samples with disease symptoms were collected in the summer of 2015 to 2017 from

Québec, Canada orchards (Montérégie and Laurentides). For each infected shoot sample, five subsamples

of three cm in length (1.5 cm on either side of the transition zone) were harvested. These apple twigs were

surface-disinfected for 15 minutes using sodium hypochlorite (Javel Ultra Bleach, Savon Olympic Inc.,

Laval, QC, Canada) 1.05 % v/v, rinsed three times with sterile distilled water, cut into 0.5 cm sections,

and sonicated five minutes in 2 ml of 0.85 % saline solution (sodium chloride from Sigma-Aldrich,

Oakville, ON, Canada, S7653) in a FS20H ultrasonic bath (ThermoFisher Scientific). A volume of 100 µl

of this solution was used to create a 10-1 to 10-5 serial dilutions in sterile saline. Ten µl of each dilution

(one for each isolate) was plated onto King’s B (KB) growth medium (Pseudomonas Agar F, Fisher

Scientific, Népéan, ON, Canada, BD Difco), supplemented with 0, 100 and 1000 µg/ml streptomycin

(streptomycin sulfate salt, Sigma-Aldrich, Oakville, ON, Canada, S9137) and 50 mg/l cycloheximide

(cycloheximide, Sigma-Aldrich, Oakville, ON, Canada, C7698). Preliminary identification of the isolates

was based on colony morphological characteristics, such as form, shape, fluorescence and color.

Purified colonies were stored in tryptic soy broth (Trypticase Soy Broth, Fisher Scientific,

Népéan, ON, Canada, BD: BBL) with 10 % glycerol (glycerol, Sigma-Aldrich, Oakville, ON, Canada,

G9012) at -80C. In total, 273 bacterial isolates were collected between 2015 and 2018, including

controls.

Bacterial DNA extractions

DNA extractions of 230 samples (collected up to 2016) were performed using 2 ml from a 10 ml

overnight bacterial culture with the Bacterial Genomic DNA Isolation Kit (Norgen Biotek Corp., Thorold,

ON, Canada) following the manufacturer’s instructions. For the remaining 43 samples (collected in 2017

and 2018), bacteria were obtained from purified colonies grown on KB agar plates and extractions were

performed with the DNeasy PowerLyzer PowerSoil Kit (Qiagen, Toronto, ON, Canada) following the

Page 6 of 34



Draft


Page | 7

manufacturer’s instructions. DNA concentrations were measured with a NanoDrop 2000 (Thermo

Scientific, Mississauga, ON, Canada) and diluted to 10 ng/µl.

Microbiological determination of streptomycin resistance

Each purified isolate was streaked onto KB medium amended with 50 mg/l cycloheximide with

100 or 1000 µg/ml streptomycin. KB plates were incubated at room temperature for 7 days and checked

for the presence of bacterial colonies.

Hypersensitive response tests on tobacco plants

Hypersensitive response (HR) tests were performed on non-host tobacco plants (Nicotiana

benthamiana) (Schaad et al. 2001). Plants were kept in a growth chamber at 20 °C/18 °C (day/night) with

a 16/8 h (light/dark) photoperiod for the duration of the test. Bacterial suspensions were prepared by

vortexing a loop full of 48h cultures grown on KB medium in sterile water. Leaf infiltrations with the

bacterial suspension were made by pressing needleless syringes on abaxial side of leaves until the

solution covered a diameter of approximately two cm. Sterile water was used as a negative control. Leaf

tissues were evaluated at 48 h and 96 h post-injection. Hypersensitive or positive response was

characterised by collapsed tissue in the leaf area covering the infiltration zone.

Molecular identification by PCR and touchdown qPCR of P. syringae

Identification of P. syringae isolates was initially performed using protocols developed by Sarkar

and Guttman (2004), Jiang et al. (2006) and primers for genes rpoD and gyrB (V. Toussaint, pers. comm.)

(results not shown). The touchdown PCR method developed by Guilbaud et al. (2016) was additionally

used to identify P. syringae isolates.

The SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad, Mississauga, ON, Canada)

was used to perform a touchdown qPCR with Psy-F and Psy-R primers (table 1) on a CFX96 Touch™

Real-Time PCR Detection System (Bio-Rad, Mississauga, ON, Canada) following the manufacturer’s

Page 7 of 34



Draft


Page | 8

instructions. The qPCR conditions were: 95 °C for 5 min; 10 cycles of 94 °C for 30 s, annealing

temperature starting at 62 °C for 30 s with a decrement temperature by 0.7 °C per cycle; 72 °C for 30 s

with fluorescence readings at each cycle. These steps were followed by 30 cycles at 94 °C for 30 s, 55 °C

for 30 s and 72 °C for 30 s with fluorescence readings at each cycle. Isolates B11-264 (P. syringae) and

B07-007 (Xanthomonas hortorum) were used as positive and negative controls, respectively.

Molecular identification of E. amylovora by PCR and qPCR

To identify E. amylovora, three different molecular tests were performed using pEa71, hpEa and

Ea-lsc primers (table 1). The kit OneTaq® Hot Start 2X Master Mix with Standard Buffer (New England

BioLabs, Pickering, ON, Canada) was used to perform PCR reactions on a SureCycle 8800 (Agilent

Technologies, Santa Clara, CA, USA) according to the polymerase manufacturer’s recommendations with

the adequate annealing temperature (table 1). PCR products were visualized on 1.5 % agarose gels in 1X

Tris-Acetate-EDTA (50X TAE buffer, Invitrogen, Burlington, ON, Canada,) buffer with EZ-Vision Two

(VWR, Mont-Royal, QC, Canada). The 100 bp DNA Ladder (New England BioLabs) was used as DNA

size standard. The QuantiFast Multiplex PCR+R Kit (Qiagen) was used to perform qPCR reactions on a

Mx3000P qPCR System (Agilent Technologies, Santa Clara, CA, USA) following the manufacturer’s

instructions. For the hpEa primers, the qPCR conditions were: 95 °C for 10 min; 40 cycles of 95 °C for 15

s and 60 °C 1 min with fluorescence readings at each cycle. For the Ea-lsc primers, the qPCR conditions

were: 95 °C for 5 min; 45 cycles of 95 °C for 30 s and 60 °C for 30 s with fluorescence readings at each

cycle. Results were visualized with MxPro qPCR Software (Agilent Technologies, Santa Clara, CA,

USA), the FAM dye was used for both primers sets and ROX dye was used as reference. Table 4 lists all

samples analyzed using the primer sets pEa71, hpEa and Ea-lsc. Isolates 433 and 435 were used as

positive controls for the identification of E. amylovora.

Molecular identification of bacterial isolates by sequencing

Page 8 of 34



Draft


Page | 9

To identify P. syringae, three molecular tests were performed based on rpoD, gyrB and cts

housekeeping genes and bacterial rDNA 16S specific universal primers Bac27F and Univ1492R (see

table 1 for all primers) (Jiang et al. 2006, Sarkar and Guttman 2004 and V. Toussaint, pers. comm.). The

kit OneTaq® Hot Start 2X Master Mix with Standard Buffer was used to perform PCR reactions as

previously described. All PCR products were sent to the Génome Québec Innovation Centre (Montreal,

QC, Canada) for Sanger sequencing. Sequences were assembled using the Staden Package and compared

to the Genbank (Benson et al. 2005) nucleotide database on the NCBI web site using BLAST (Altschul et

al. 1990; Bonfield et al. 1995). All sequences were submitted to Genbank, accession numbers are listed in

the supplemental material (file “Suppl. HitTable and genbank accessions.xlsx”).

Molecular testing for streptomycin resistance in E. amylovora

The rpsL gene sequence (Genbank accession number L36465.1) was used to develop a rhAmp®

SNP Genotyping assay (Integrated DNA Technologies, Iowa, USA). Amplifications were performed with

allele specific primers; ASP1- /rhAmp-F/TGTACACGACTACCCCTAArAAAAC/GT3 (E. amylovora

sensitive allele); ASP2- /rhAmp-Y/TGTACACGACTACCCCTAGrAAAAC/GT3 (E. amylovora allele

conferring high level of resistance to streptomycin) and LSP1-

GCTTGGTTAAACGAACACGACArCACTT/GT1 (common gene specific primer) and rhAmp® reagent

mixes according to manufacturer’s recommendation except for cycling conditions. Two µl of DNA

diluted at 2 ng/µl in nuclease-free water were used and amplifications were performed in a Mx3000P

qPCR System with the following conditions; 10 min at 95°C; 40 cycles of 10 s at 95°C, 20 s at 62°C and

30 s at 68°C with fluorescence readings at each cycle. Every isolate was tested in triplicate. Results were

visualized using the MxPro qPCR software ; amplifications with FAM dye represent wild-type sensitive

E. amylovora, amplifications with Yakima Yellow dye (detected with HEX filter) represent streptomycin

resistant mutant E. amylovora, ROX dye was used as reference. Isolates 435 and B16-001 were used as

susceptible and resistant controls, respectively.

Page 9 of 34



Draft


Page | 10

Pathogenicity tests on apple trees

Pathogenicity of E. amylovora and P. syringae bacterial isolates was tested on four apple tree

cultivars (rootstock); Royal Gala (M-26), Spartan (M-26), Honeycrisp (M-106) and Cortland (M-106).

Apple trees were bought as bare roots and planted in ProMix (PRO-MIX BX MYCORRHIZAE, Premier

Tech Biotechnologies, Rivière-du-Loup, QC, Canada) immediately after reception and fertilized with 10-

52-10 at 2 g/l (PLANTPROD Québec, QC, Canada). Trees were placed in a greenhouse at 10°C for the

first week and the temperature was gradually increased to promote bud break. Following bud break, trees

were continuously fertilized with 20-8-20 at 0.75 g/l (PLANTPROD Québec, QC, Canada) and the

temperature was 16 °C at night and 20 °C during the day. Once trees developed young leaves, fertilization

was adjusted to 1.5 g/l of 20-8-20 weekly throughout the inoculation testing process. Bacterial

suspensions were made using 48 h old cultures grown on King’s B medium and sterile water. E.

amylovora suspensions were adjusted to 1x109 CFU/ml (OD600= 0.62) and P. syringae suspensions were

adjusted to 1x108 CFU/ml (OD600= 0.09) to ensure a rapid development of symptoms (Norelli et al. 2003).

Scissors were dipped in bacterial suspensions and used to cut one young leaf per bacterial isolate in each

of the four apple varieties (Ruz et al. 2008). Symptoms were evaluated at 7 days post-inoculation for E.

amylovora. Leaves with symptoms were removed from the tree, photographed and evaluated using a

disease rating index. The disease severity index ranged from 0 to 3: 0 = no damage; 0.5 = browning at the

cut only; 1 = browning at 1-2 mm, 2 = browning at 3-4 mm and 3 = browning equal or larger than 5 mm.

For P. syringae, symptoms started to appear two weeks after inoculation. Observations were made three

weeks post-inoculation and apple trees were kept several weeks to ensure no further symptom

development. Hierarchical clustering was performed in JMP (SAS, Cary, North Carolina, USA) using

Ward method.

Results

Identification of P. syringae isolates

Page 10 of 34



Draft


Page | 11

Figure 1 shows the amplification products obtained with the procedure developed by Guilbaud et

al. (2016). Using this method, a single 144 bp fragment was amplified for all P. syringae isolates and

some Pseudomonas spp. isolates. Faint and multiple bands were observed for Pseudomonas sp. (B16-110,

B16-156, B16-175, B16-252), Pseudomonas mosselii (B16-145), Pantoea sp. (B16-157), Pseudomonas

fluorescens (B16-140, B16-191, B16-231), and Pseudomonas koreensis (B16-237), indicative of low

amplification efficiency. One Pseudomonas sp. (B16-257) and one P. fluorescens (B17-144) isolate

showed a single fragment but of different size than expected for P. syringae isolates (144 bp).

Pseudomonas rhodesiae (B16-197) produced the 144 bp sized band but also a much larger one. We

reasoned that the banding pattern observed with the Psy-PCR assay could be resolved using touchdown

quantitative PCR (TqPCR) (Zhang et al. 2015). Using this newly developed approach, all P. syringae

isolates have been identified on the basis of a Ct (Cycle threshold) value equal or below 20.12 while the

Ct value for other species was higher than 32.81.

Identification of E. amylovora isolates

E. amylovora isolates were identified using the method developed by Lehman et al. (2008) (table

4, Ea-lsc Ct). Ct values obtained for E. amylovora isolates were between 17.71 and 19.72. The bacterial

isolate with the closest Ct was of the same genus, and corresponded to E. billingiae, with a value of

24.18. All other species tested demonstrated a Ct value of 25.28 or above, indicating that amplification

products were detected at least 5 cycles after the last E. amylovora isolate amplicon. A subset of the

isolates listed in table 4 (hpEa Ct) were characterized with the protocol described by Gottsberger (2010).

Again, lower Ct values were obtained for the E. amylovora isolates (maximum Ct value of 20.88)

whereas the lowest Ct value observed for the other species was of 26.94 and corresponded to P. syringae.

At least 6 cycles separates the detection of a PCR product between E. amylovora and other species with

this method. In our hands, the PCR primers pEa71F and R (Taylor et al. 2001) were not specific to E.

amylovora, which is contrary to what Powney et al. (2011) reported. An amplification product was

obtained when these primers were used with a Pseudomonas sp. and a Lelliottia sp. isolates (table 3).

Page 11 of 34



Draft


Page | 12

Characterization of streptomycin resistance in E. amylovora

Chiou and Jones (1995) described a mutation in codon 43 of the E. amylovora rpsL gene which

results in an amino acid substitution (lysine to arginine) in ribosomal protein S12. This mutation confers

resistance to streptomycin. We have developed a rhAmp® genotyping assay to characterize this mutation.

In this genetic test, the allele conferring resistance is associated with the HEX fluorescent dye whereas the

wild type allele is associated with the FAM fluorescent dye. Using this test, all E. amylovora isolates that

are susceptible to streptomycin have a FAM Ct value smaller than the HEX Ct value. The Ct values of

these two variant alleles allowed discrimination between isolates. Susceptible lines had a lower Ct value

for the FAM dye, associated with the wild type allele whereas resistant lines had a lower Ct value for the

HEX dye, associated with the mutant, resistance-conferring allele (tables 3 and S2). Interestingly, only E.

amylovora isolates showed a Ct value lower than 30 with either FAM or HEX. Other species tested had

Ct values, for either HEX or FAM above 33.42 (value obtained with Paenibacillus sp.). To confirm the

results of the molecular assay, low and high levels of streptomycin resistance were determined by

observing colony growth on culture media supplemented with 100 and 1,000 µg/ml streptomycin,

respectively (table 4). All E. amylovora that tested positive for the resistance conferring mutation were

able to grow on both streptomycin concentrations and other isolates, negative for the mutation, were not

able to grow on antibiotic containing media. The genetic test was inconclusive for species other than E.

amylovora.

Hypersensitive response test on tobacco

Six isolates identified as E. amylovora, 32 as P. syringae, five as P. fluorescens, two as P.

rhodesiae, two as P. koreensis, one as Pantoea sp., one as P. mosselii, one as P. orientalis and ten as

Pseudomonas sp. were tested for HR on tobacco (table 3 and 4). A hypersensitive response was observed

when tobacco leaves were injected with all of each bacterial suspensions of E. amylovora. All P. syringae

isolates were pathogenic on tobacco leaves as did two of the Pseudomonas sp. isolates, causing an

Page 12 of 34



Draft


Page | 13

hypersensitive response. The other pseudomonads tested (P. fluorescens, P. koreensis, P. mosselii, P.

orientalis, P. rhodesiae, Pantoea sp. and eight of the Pseudomonas sp.) did not cause a hypersensitive

response on tobacco leaves.

Pathogenicity test on apple trees

Pathogenicity of Pseudomonas isolates was tested on apple tree leaves (figure 2). While 19 of

these isolates failed to show any damage when applied with the leaf cut procedure, 24 were able to infect

at least one of the apple varieties (table S2). All P. syringae isolates were able to cause damage. Inversely,

only two non P. syringae isolates caused limited lesions; one was identified as a P. fluorescens (B16-140)

while the other was classified as a Pseudomonas sp. (B16-175). On average, and considering the

associated rootstock, the apple cultivar Cortland showed the lesser symptoms with a low disease rating

(DR) (average of 0.39) when treated with P. syringae isolates. Royal Gala was most affected in this

experiment with an average DR of 0.74. Honeycrisp and Spartan trees showed intermediate symptom

levels of 0.59 and 0.47, respectively. The different P. syringae isolates was variable and clustering

analysis identified groups of isolates with similar aggressiveness patterns, especially on apple cultivars

Cortland and Royal Gala (figure 3).

E. amylovora isolates were tested for pathogenicity on apple tree leaves (figure 2). Damage

ratings varied widely depending on the bacterial isolates and apple variety (table S3). Overall, the variety

Royal Gala showed less severe symptoms with our test (average of 1.6), whereas Cortland seemed most

affected (average of 2.3). Some bacterial isolates like B16-018 were able to inflict heavy damages on

Honeycrisp while no injury occurred on Royal Gala. Isolate B16-223 was not able to cause any damage

on Honeycrisp while leaves of Royal Gala and Cortland appeared highly infected. On average, E.

amylovora infections were more severe than when apple tree cut leaves were treated with P. syringae.

The severity of symptoms caused by the different E. amylovora isolates clustered into different groups,

displayed with different colors in figure 4. For example, the top eight isolates produced little to no

Page 13 of 34



Draft


Page | 14

symptoms while the bottom 14 isolates produce symptoms on all varieties but honeycrisp. Interestingly,

the apple cultivar most susceptible to E. amylovora (table S3) isolates on average, Cortland, was the most

resistant to P. syringae (table S2) in our test. Inversely, the apple cultivar most resistant to E. amylovora

isolates on average, Royal Gala, was the most susceptible to P. syringae.

Discussion

Proper identification of bacterial isolates present in orchards is an important part of production

management and is needed to adopt the most suitable phytosanitary measures. For example, it has been

demonstrated that P. syringae is more prone to develop resistance to streptomycin as it is most often

acquired by plasmid transfer through conjugation (Bender and Cooksey 1986). We have characterized a

number of isolates coming from producers but also from our own collection. The test developed by

Guilbaud et al. (2016) performed flawlessly and was able to identify all P. syringae isolates, otherwise

identified through MLSA or 16S rDNA sequencing. We have improved on the published touchdown PCR

and developed a faster touchdown quantitative PCR (TqPCR) that was also able to identify all P. syringae

isolates. This method was faster to execute as it did not require an agarose gel to visualize the results.

Moreover, the TqPCR assay was able to identify P. syringae isolates originating from other plant species

such as green bean, tomato, squash and pepper. The assay (Psy-TqPCR) performed equally well to the

Psy-PCR assay with the added benefit to be much quicker to complete since it is not necessary to resolve

the amplification products on agarose gel. The method developed is therefore an improvement compared

to existing methods, being as robust, requiring less hands on time and providing a faster response to

growers for disease management decisions. It remains to be seen, however, if the rhAmp® method is

specific enough to provide results from raw, unpurified samples.

Identification of the E. amylovora isolates was performed using several methods. Both methods

developed by Lehman et al. (2008) and Gottsberger (2010) produced reliable results, consistent with

Page 14 of 34



Draft


Page | 15

identification made by 16S rDNA sequencing. The method published by Taylor et al. (2001) and tested

later by Powney et al. (2011) failed in our hands; a band was observed when using isolates identified as P.

putida, Lelliottia sp. and Pseudomonas sp. These three species were not identified as E. amylovora using

the Gottsberger method as well.

We have developed a genetic test based on the rhAmp® technology to characterize suspected

streptomycin resistance of E. amylovora isolates. This type of assay improves the precision and the

specificity of a qPCR-based SNP assay by using allele specific blocked primers that contain an RNA

base. The 3’ end of rhAmp® primers has a blocking group that prevent unspecific extensions. A cleavage

and a de-blocking by RNase H2 enzyme that only recognizes RNA-DNA complementary complex is

needed to activate the reaction. The new genetic test was able to quickly characterize the presence of

streptomycin resistance (K43R mutation in rpsL) in E. amylovora using a real-time PCR instrument and

did not require additional procedures for detection such as an agarose gel. This genetic test was also faster

to perform than the classical microbiological resistance test, which can take up to a week and necessitates

several growing media. Moreover, this simple, fast and efficient method was also able to confirm the

identity of the bacterial isolates with similar or better accuracy than methods developed by Lehman or

Gottsberger (Gottsberger 2010; Lehman et al. 2008). This quantitative PCR can identify E. amylovora

isolates and potential streptomycin resistance due to a mutation in rpsL in a single, quick procedure,

which represent two important results that can inform producers. Indeed, knowledge of streptomycin

resistance indicates that additional applications of this antibiotic will be ineffective and other control

measures should be considered. To the best of our knowledge, this is the first report on the correlation

between identification of the fire blight pathogen by real-time PCR and simultaneous detection of the

rpsL mutation. Large-scale orchard surveys for streptomycin resistance are often bottle necked by the

need to place the real-time PCR identified isolates on streptomycin-amended medium to screen for

presence of resistance. This later step is materials and time consuming since it requires multiple

laboratory step, 2-3 days incubation and visual assessment for the absence/presence of bacterial colonies.

Page 15 of 34



Draft


Page | 16

When apple leaves were challenged with the different isolates, we were able to describe

markedly different behavior depending on either the bacteria or the host apple cultivar. Leaves vary in

size depending on the apple variety and comparisons are easier within one cultivar than across cultivars.

We have applied a categorical scale to assess the severity of the infections. Hierarchical clustering of

these observations were performed (figure 3 and 4). It is interesting to see that certain isolates shared

similar behaviors. B17-142, which we identified earlier as being a P. syringae, was the only member of

this species not able to produce symptoms on leaves. As we have not tested other inoculation methods, we

cannot assert if this isolate is non-pathogenic; it may just be unable to cause symptoms with the dirty

scissor approach, One Pseudomonas sp. isolate (B16-175) and one P. fluorescens isolate (B16-140) were

able to produce symptoms. We concluded that the observed symptoms for these two isolates were due to

the scissor cut and not from a pathogenic interaction for three reasons: 1) because these bacteria only

caused symptoms on one of the four cultivars tested, 2) these species are not known to be pathogenic on

apple trees and 3) that they did not cause HR on tobacco leaves. All other P. syringae isolates were

pathogenic on two or more apple varieties. B16-199, the most aggressive isolate, showed moderate to

high infection levels on all four varieties.

Pathogenicity tests have shown that different isolates produced different lesions depending on the

apple cultivar challenged and these symptoms allowed for grouping of the different isolates in classes.

These are important observations that could impact how disease management is made in orchards. Not all

E. amylovora or P. syringae isolates will produce similar disease symptoms; some will be more dramatic

than others and growers could choose different control measures based on the severity of the symptoms

and the expected outcome on pome fruit production depending on the predicted aggressiveness of the

pathogen identified. For this, markers need to be developed to be able to predict the severity of the

infection based on the genetics of the pathogen. In the end, this could lessen the need for antibiotics and

reduce the selective pressure to evolve resistance. It is also of very high interest to see what are the

underlying genetic and molecular mechanisms associated with this host-pathogen interaction. Because of

Page 16 of 34



Draft


Page | 17

the apparent structure within the populations tested, one could postulate that the differences in symptom

severity are genetically controlled and, based on the differences found in these populations, that the

process governing infection can be studied with genetic analyses. It may be possible, using the phenotypic

information presented here, with a thorough characterization of the isolates’ genomes, to identify

chromosome or plasmid regions that are associated with the different infection severity observed. The

functional analysis of the genes located in these regions could provide a better understanding of the

infection process and provide targets for the development of new phytosanitary products.

Finally, these tests were performed in conditions that are not representative of what happens in

the field. They were performed in a greenhouse with the bacteria inoculated in a scissor made cut. It

would be of interest to see how these bacterial isolates behave in more natural conditions. It would be

even more interesting to see how the different isolates of both species perform in the context of their

natural infection processes.

The genetic test improvements presented are equal or superior in robustness compared to

previously presented methods. These protocols permit the unambiguous identification of P. syringae and

E. amylovora, the causative agents of bacterial canker and fire blight, respectively. The technologies used,

rhAmp® and quantitative PCR, require less hands-on and are therefore faster to execute while being more

informative, and in the case of the E. amylovora, they provide information regarding the resistance-

conferring mutation of the rpsL gene. Growers should benefit from the development of these tests as they

streamline the production of results, requiring less hands-on time, and can more quickly provide

information for disease management decision making. The observation made during the course of this

work sheds new light on the characteristics of different pathogen isolates, as shown by the very different

symptoms observed on leaves. Indeed, common behaviors can be observed between different isolates

when tested on four apple varieties, while other isolates act very differently, creating a structure in these

populations that is most certainly genetically driven. With additional genotypic information, it may be

possible to dissect the molecular underpinning of the host-pathogen interaction. This would yield a better

Page 17 of 34



Draft


Page | 18

understanding of the infection process and possibly new targets to act upon for the control of these

diseases.

Acknowledgements

This work was funded by Agriculture and Agri-Food Canada (Project #J-001011). Authors declare that

there are no conflicts of interest.

References

Adaskaveg, J.E., Förster, H., and Wade, M.L. 2011. Effectiveness of kasugamycin against Erwinia

amylovora and its potential use for managing fire blight of pear. Plant Dis. 95(4): 448-454. doi:

10.1094/PDIS-09-10-0679.

Al-Daoude, A., Arabi, M.I.E., and Ammouneh, H. 2009. Studying Erwinia amylovora isolates from Syria

for copper resistance and streptomycin sensitivity. J. of Plant Pathol. 91(1): 203-205. doi:

10.4454/jpp.v91i1.644.

Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and Lipman, D.J. 1990. Basic local alignment search tool.

J. Mol. Biol. 215(3): 403-410. doi: https://doi.org/10.1016/S0022-2836(05)80360-2.

Bender, C.L., and Cooksey, D.A. 1986. Indogeneous plasmids in Pseudomonas syringae pv. tomato:

conjugative transfer and role in copper resistance. J. Bacteriol. 165(2): 534-541.

Benson, D.A., Karsch-Mizrachi, I., Lipman, D.J., Ostell, J., and Wheeler, D.L. 2005. GenBank. Nucleic Acids

Res 33(Database issue): D34-38. doi: 10.1093/nar/gki063.

Bonfield, J.K., Smith, K.F., and Staden, R. 1995. A new DNA sequence assembly program. Nucleic Acids

Res 23(24): 4992-4999.

Burr, T.J., Norelli, J.L., Katz, B., Wilcox, W.F., and Hoying, S.A. 1988. Streptomycin resistance of

Pseudomonas syringae pv. papulans in apple orchards and its association with a conjugative plasmid.

Phytopathology 78: 410-413.

Page 18 of 34



https://doi.org/10.1016/S0022-2836(05)80360-2

Draft


Page | 19

Chiou, C.S., and Jones, A.L. 1995. Molecular analysis of high-level streptomycin resistance in Erwinia

amylovora. Phytopathology 85(3): 324-328.

Darwin, C. 1859. On the origin of species by means of natural selection, or preservation of favoured

races in the struggle for life. London : John Murray, 1859.

Gottsberger, R.A. 2010. Development and evaluation of a real-time PCR assay targeting chromosomal

DNA of Erwinia amylovora. Lett. Appl. Microbiol. 51(3): 285-292. doi: 10.1111/j.1472-

765X.2010.02892.x.

Guilbaud, C., Morris, C.E., Barakat, M., Ortet, P., and Berge, O. 2016. Isolation and identification of

Pseudomonas syringae facilitated by a PCR targeting the whole P. syringae group. FEMS Microbiol Ecol

92(1). doi: 10.1093/femsec/fiv146.

Jiang, H., Dong, H., Zhang, G., Yu, B., Chapman, L.R., and Fields, M.W. 2006. Microbial diversity in water

and sediment of Lake Chaka, an athalassohaline lake in northwestern China. Appl Environ Microbiol

72(6): 3832-3845. doi: 10.1128/AEM.02869-05.

Jurgens, A.G., and Babadoost, M. 2013. Sensitivity of Erwinia amylovora in Illinois apple orchards to

streptomycin, oxytetracyline, kasugamycin, and copper. Plant Dis. 97(11): 1484-1490. doi: 10.1094/PDIS-

02-13-0209-RE.

Kado, C.I. 2011. CHAPTER 1: historical development of plant bacteriology. In Plant Bacteriology. Edited

by I.K. Clarence. The American Phytopathological Society. pp. 1-11.

Lacy, G.H., Stromberg, V.K., and Cannon, N.P. 1984. Erwinia amylovora mutants and in planta-derived

transconjugants resistant to oxytetracycline. Can. J. Plant Pathol. 6(1): 33-39. doi:

10.1080/07060668409501588.

Lee, I.-M., Davis, R.E., and Gundersen-Rindal, D.E. 2000. PHYTOPLASMA: phytopathogenic mollicutes.

Annu. Rev. Micribiol. 54: 221-255.

Page 19 of 34



Draft


Page | 20

Lehman, S.M., Kim, W.-S., Castle, A.J., and Svircev, A.M. 2008. Duplex real-time polymerase chain

reaction reveals competition between Erwinia amylovora and E. pyrifoliae on pear blossoms.

Phytopathology 98(6): 673-679.

McGhee, G.C., and Sundin, G.W. 2011. Evaluation of Kasugamycin for Fire Blight Management, Effect on

Nontarget Bacteria, and Assessment of Kasugamycin Resistance Potential in Erwinia amylovora.

Phytopathology 101(2): 192-204.

McManus, P.S., Stockwell, V.O., Sundin, G.W., and Jones, A.L. 2002. Antibiotic use in plant agriculture.

Annu. Rev. Phytopathol. 40: 443-465. doi: 10.1146/annurev.phyto.40.120301.093927.

Napier, E.J., Turner, D.I., Rhodes, A., and Tootill, J.P.R. 1956. The systematic action against Pseudomonas

medicaginis var. phaeolicola of a streptomycin spray applied to dwarf beans. Ann. Appl. Biol. 44(1): 145-

151.

Norelli, J.L., Holleran, H.T., Johnson, W.C., Robinson, T.L., and Aldwinckle, H.S. 2003. Resistance of

Geneva and other apple rootstocks to Erwinia amylovora. Plant Dis. 87(1): 26-32. doi:

10.1094/PDIS.2003.87.1.26.

Ogawa, J.M., and English, H. 1991. Diseases of temperate zone tree fruit and nut crops. University of

California, Division of Agriculture and Natural Resources.

Piqué, N., Miñana-Galbis, D., Merino, S., and Tomás, J.M. 2015. Virulence factors of Erwinia amylovora:

A review. Int. J. Mol. Sci. 16(6): 12836-12854. doi: 10.3390/ijms160612836.

Powney, R., Beer, S.V., Plummer, K., Luck, J., and Rodoni, B. 2011. The specificity of PCR-based protocols

for detection of Erwinia amylovora. Australas. Plant Pathol. 40(1): 87-97. doi: 10.1007/s13313-010-

0017-7.

Russo, N.L., Burr, T.J., Breth, D.I., and Aldwinckle, H.S. 2008. Isolation of streptomycin-resistant isolates

of Erwinia amylovora in New York. Plant Dis. 92(5): 714-718. doi: 10.1094/PDIS-92-5-0714.

Page 20 of 34



Draft


Page | 21

Ruz, L., Cabrefiga, J., Bonaterra, A., Moragrega, C., and Montesinos, E. 2008. Evaluation of fire blight

control methods based on plant defence inducers and biological control agents.

Sarkar, S.F., and Guttman, D.S. 2004. Evolution of the Core Genome of Pseudomonas syringae, a Highly

Clonal, Endemic Plant Pathogen. Applied and Environmental Microbiology 70(4): 1999-2012. doi:

10.1128/aem.70.4.1999-2012.2004.

Schaad, N.W., Jones, J.B., and Chun, W. 2001. Laboratory guide for the identification of plant pathogenic

bacteria. 3rd Edition ed. American Phytopathological Society, St-Paul, MN. pp. 44.

Seibold, A., Viehrig, M., and Jelkmann, W. 2006. Yeasts as antagonists against Erwinia amylovora.

Sundin, G.W., and Bender, C.L. 1993. Ecological and genetic analysis of copper and streptomycin

resistance in Pseudomonas syringae pv. Syringae. Appl. Environ. Microbiol. 59(4): 1018-1024.

Sundin, G.W., and Wang, N. 2018. Antibiotic Resistance in Plant-Pathogenic Bacteria. Annu Rev

Phytopathol. doi: 10.1146/annurev-phyto-080417-045946.

Taylor, R.K., Guilford, P.J., Clark, R.G., Hale, C.N., and Forster, R.L.S. 2001. Detection of Erwinia

amylovora in plant material using novel polymerase chain reaction (PCR) primers. N. Z. J. Crop Hortic.

Sci. 29(1): 35-43. doi: 10.1080/01140671.2001.9514158.

Van der Zwet, T., Orolaza-Halbrendt, N., and Zeller, W. 2012. Fire blight: history, biology, and

management. APS Press, St. Paul, Minn, USA.

van Hall, C.J.J. 1902. Bijdragen tot de kennis der bakterieeleplantenzeikten, Cooperative Drukkerij-

vereeniging “Plantijn”. Inaugural Dissertation, Amsterdam. 198 pp.

Vanneste, J.L. 2000. Fire blight: the disease and its causative agent, Erwinia amylovora. CABI Pub,

Wallingford, Oxon, UK;New York, NY, USA.

Yoder, K.S., Miller, S.S., and Byers, R.E. 1999. Suppression of fireblight in apple shoots by prohexadione-

calcium following experimental and natural inoculation. HortScience 34(7): 1202-1204.

Page 21 of 34



Draft


Page | 22

Young, J.M. 1977. Resistance to streptomycin in Pseudomonas syringae from apricot. New Zealand

Journal of Agricultural Research 20(2): 249-251. doi: 10.1080/00288233.1977.10427329.

Zhang, Q., Wang, J., Deng, F., Yan, Z., Xia, Y., Wang, Z., Ye, J., Deng, Y., Zhang, Z., Qiao, M., Li, R.,

Denduluri, S.K., Wei, Q., Zhao, L., Lu, S., Wang, X., Tang, S., Liu, H., Luu, H.H., Haydon, R.C., He, T.C., and

Jiang, L. 2015. TqPCR: A touchdown qPCR assay with significantly improved detection sensitivity and

amplification efficiency of SYBR green qPCR. PLoS One 10(7): e0132666. doi:

10.1371/journal.pone.0132666.

Page 22 of 34



Draft


Page | 23

Figure 1 Agarose gel PCR identification of Pseudomonas syringae wild type isolates. Positive

identification of P. syringae was indicated by the presence of a strong band at 144 bp. NTC: no template

control.

Figure 2 Symptom development on apple leaves one week post-inoculation with Erwinia

amylovora B16-130. Apple cultivars used in the experiment included: A) untreated Royal Gala, B) Royal

Gala, C) Spartan, D) Honeycrisp and E) Cortland. Symptom development on apple leaves 3 weeks post-

inoculation with Pseudomonas syringae B16-222. Apple cultivars used in the experiment included: F)

untreated Royal Gala, G) Royal Gala, H) Spartan, I) Honeycrisp and J) Cortland.

Figure 3 Hierarchical clustering of the observed symptoms produced by the Pseudomonas isolates

on four different apple cultivars. Apple tree leaves were inoculated with the bacterial isolates using the

dirty scissor method and rated following 7 days post-inoculation using a five point Disease Severity

Index (DSI, 0 = no damage; 0.5 = browning at the cut only; 1 = browning at 1-2 mm, 2 = browning at 3-4

mm and 3 = browning equal or larger than 5 mm). The numbers beside the colour scheme represent

average scores of the DSI.

Figure 4 Hierarchical clustering of the observed symptoms produced by the E. amylovora isolates

on four different apple cultivars. Apple tree leaves were inoculated with the bacterial isolates using the

dirty scissor method and rated after 14 days post-inoculation using a five point Disease Severity Index

(DSI, 0 = no damage; 0.5 = browning at the cut only; 1 = browning at 1-2 mm, 2 = browning at 3-4 mm

and 3 = browning equal or larger than 5 mm). The numbers beside the colour scheme represent average

scores on a five point scale of the DSI. See Supplementary file “Figure 4-hires.pdf” for list of isolate

names.

Page 23 of 34



Draft

Apple bacterial diseases - tables

Page | 1

Primers Sequence (5’ – 3’) Amplicon size (bp)

Annealing temp. (°C) Reference

pEa71FpEa71R

CCTGCATAAATCACCGCTGACAGCTCAATGGCTACCACTGATCGCTCGAATCAAATCGGC 187 60 Taylor et al.

(2001)hpEaFhpEaRhpEaP

CCGTGGAGACCGATCTTTTAAAGTTTCTCCGCCCTACGAT

FAM-TCGTCGAAT/ZEN/GCTGCCTCTCT/IABkFQ(MGB)138 60 Gottsberger

(2010)

Ea-lscFEa-lscREa-lscP

CGCTAACAGCAGATCGCAAAATACGCGCACGACCAT

FAM-CTGATAATC/ZEN/CGCAATTCCAGGATG/IABkFQ105 60 Lehman et

al. (2008)

Bac27FUniv1492R

AGAGTTTGGATCMTGGCTCAGCGGTTACCTTGTTACGACTT 1,300 55 Jiang et al.

(2006)

PsyrpoD-F2PsyrpoD-R2

GAAGGCGARATYGRAATCGCCAAATCGCCTGRCGRATCCACCAGGT 950 59

V. Toussaint,

pers. comm.

PsygyrB-F3PsygyrB-R3

TTCAGYTGGGACATCCTGGCCAACCYTCCACSAKGTASAGYTCGGA 850 54

V. Toussaint,

pers. comm.

Cts-FpCts-Rp

AGTTGATCATCGAGGGCGCWGCCTGATCGGTTTGATCTCGCACGG 650 68

Sarkar and Guttman (2004)

Psy-FPsy-R

ATGATCGGAGCGGACAAGGCTCTTGAGGCAAGCACT 144 62-55* Guilbaud et

al. (2016)Table 1 Primer sequences used to characterize bacterial isolates in this study. * Touchdown PCR, see Materials and Methods. FAM: fluorescent dye. ZEN: internal quencher. IABkFQ: Iowa Black Quencher. MGB: minor groove binder.

Page 24 of 34



Draft


Page | 2

Isolates Bacterial isolates Host SourceB11-046 C. michiganensis subsp.

michiganensisTomato MAPAQ

433 E. amylovora Apple MAPAQ 435 E. amylovora Apple MAPAQ B16-187 E. amylovora Apple cv. Paula red QC orchardB18-020 E. amylovora Raspberry MAPAQ B18-021 E. amylovora Raspberry MAPAQ B18-022 E. amylovora Pear tree MAPAQ B16-001 E. amylovora streptomycin

resistantApple AAFC

B16-009 E. amylovora streptomycin resistant

Apple Oregon State University Corvallis Oregon


Apple MAPAQ


Apple MAPAQ


Apple MAPAQ

B08-193 Pectobacterium carotovorum MAPAQ B18-019 Pectobacterium carotovorum Potato MAPAQ B17-110 E. coli DH5α ThermoFisher Scientific

(ON, Canada)B16-236 E. persicina Apple cv. Paula red QC orchardB11-003 E. tracheiphila Squash AAFC B16-229 E.amylovora Apple cv. Cortland QC orchardB16-243 E.billingiae Apple cv. Cortland QC orchardB16-037 Lelliottia sp. Apple cv. McIntosh QC orchardB18-024 P. caricapapayea Squash MAPAQ B18-025 P. caricapapayea Pepper MAPAQ B18-026 P. caricapapayea Fennel MAPAQ B18-027 P. caricapapayea Raspberry MAPAQ B07-140 P. carotovorum Spaghetti squash Frelighsburg AAFC farmB18-015 P. carotovorum subsp.

carotovorumPotato MAPAQ

B18-023 P. carotovorum subsp. carotovorum

Potato MAPAQ

B16-140 P. fluorescens Apple cv. Vista bella QC orchardB16-231 P. fluorescens Apple cv. Cortland QC orchardB16-197 P. rhodesiae Apple cv. McIntosh QC orchardB13-005 P. stewartii Corn AAFC B11-264 P. syringae Squash AAFCB16-046 Paenibacillus sp. Apple QC orchardB16-157 Pantoea sp. Apple cv. Spartan QC orchardB16-015 Pseudomonas sp. Apple cv. Paula red QC orchardB16-058 Pseudomonas sp. Apple cv. Gala QC orchardB16-156 Pseudomonas sp. Apple cv. Paula red QC orchardB16-232 R. aquatilis Apple cv. Cortland QC orchardB16-211 R. pickettii Apple cv. Cortland QC orchardB16-233 Rahnella sp Apple cv. Cortland QC orchardB16-247 Ralstonia sp. Apple cv. McIntosh QC orchardB16-142 Subtercola sp. Apple cv. Imperial Gala QC orchardVT106 X. hortorum Lettuce AAFC Table 2 List of bacterial isolates used to develop the assays. A complete list of isolates used in this study is provided in table S1

Page 25 of 34



Draft


Page | 3

Isolates Species Psy-PCR(Band size in

bp)

TqPCR Ct Growth on KB + 100 μg/ml

streptomycin

Growth on KB + 1000 μg/ml

streptomycin

Tobacco HR

B17-097 P. syringae 144 15.54 S S +

B17-011 P. syringae 15.62 S S +

B17-010 P. syringae 15.87 S S +

B17-012 P. syringae 16.1 S S +

B17-112 P. syringae 16.12 S S +

B17-142 P. syringae 144 16.28 S S +

B17-111 P. syringae 16.4 S S +

B16-080 P. syringae 144 17.22 R R +

B16-129 P. syringae 144 17.31 R S +

B16-238 P. syringae 144 17.33 R R +

B16-199 P. syringae 144 18.03 R R +

B16-253 P. syringae 144 18.33 R R +

B16-186 P. syringae 144 18.34 R R +

B16-256 P. syringae 144 18.37 R R +

B16-228 P. syringae 18.41 R R +

B16-146 P. syringae 144 18.42 R R +

B16-189 P. syringae 144 18.45 R R +

B16-206 P. syringae 144 18.46 R R +

B16-222 P. syringae 144 18.55 R R +

B16-124 P. syringae 144 18.65 R R +

B16-151 P. syringae 144 18.68 R R +

B16-098 P. syringae 144 18.75 S S +

B16-135 P. syringae 144 18.84 R R +

B16-093 P. syringae 144 18.87 R R +

B16-203 P. syringae 144 18.93 R R +

B16-131 P. syringae 144 19.16 R R +

B16-118 P. syringae 144 19.41 R R +

B16-195 P. syringae 144 20.12 R R +

B16-140 P. fluorescens Faint band at 144

32.81 R R -

B16-145 P. mosselii More than 1 band

34.24 R R -

B16-197 P. rhodesiae More than 1 band

34.68 R R -

B16-110 Pseudomonas sp. More than 1 band

35.04 R S -


35.54 R S -

B16-191 P. fluorescens More than 1 band

35.64 R R -

B16-257 Pseudomonas sp. >1000 36.21 R R -

B17-092 P. koreensis 36.32 R R -

B16-231 P. fluorescens ~1000 36.38 R S -

B16-175 Pseudomonas sp. More than 1 36.67 R R -

Page 26 of 34



Draft


Page | 4

Isolates Species Psy-PCR(Band size in

bp)

TqPCR Ct Growth on KB + 100 μg/ml

streptomycin

Growth on KB + 1000 μg/ml

streptomycin

Tobacco HR

band

B16-157 Pantoea sp. More than 1 band

37.07 R R -


37.1 R R -

B17-144 P. fluorescens ~1000 37.59 R R -

B17-099 P. orientalis 39.55 R R -

B16-237 P. koreensis More than 1 band

Ct > 40 R R -

B17-180 P. syringae1 15.27 +

B11-264 P. syringae2 17.12 +

B13-200 P. syringae3 17.6 +

B14-270 P. syringae pv. papulans

18.28

B16-058 Pseudomonas sp. 32.1 R R +

B18-024 P. caricapapayae 36.53

B16-015 Pseudomonas sp. Ct > 40 -

Table 3 Molecular identification of Pseudomonas isolates using touchdown qPCR, a modified version of the Psy-PCR proposed by Guilbaud et al. (2016). R: streptomycin resistant; S: susceptible to streptomycin 1 Isolate from green bean, 2 isolated from squash and 3 isolated from tomato. + means pathogenic interaction. HR: hypersensitive response, + : HR on tobacco, -: no HR. Blank field indicates the condition was not tested.

Page 27 of 34



Draft


Page | 5

Isolates Species Ea-lsc Ct

hpEa Ct

pEa71 PCRband size (bp)

rhAmpFAM

Ct

rhAmpHEX Ct

Growth on KB + 100

μg/ml streptomycin

Growth on KB + 1000

μg/ml streptomycin

Tobacco HR


19.19 17.64 187 37.04 21.59 R R +


19.72 20.88 187 35.92 20.65 R R +

435 E. amylovora (PC)

17.71 18.97 187 21.54 27.76 S S +

B16-229 E. amylovora 17.97 16.34 187 25.22 34.54 S S +

B16-187 E. amylovora 18.81 16.94 187 26.98 36.69 S S +

433 E. amylovora (PC)

17.76 19.2 187 24.4 34.21 S S +

B16-243 E. billingiae 24.18 36.26 Ct > 40

B16-046 Paenibacillus sp.

25.28 No band

33.42 33.97

B16-058 Pseudomonas sp.

25.85 187 35.49 34.43 R R +


26.09 187 Ct > 40 36.14 -

B16-037 Lelliottia sp. 26.53 187 38.87 Ct > 40

B16-186 P. syringae 26.59 26.94 R R +

B16-231 P. fluorescens 27.22 36.8 Ct > 40 R R -

B16-080 P. syringae 27.35 28.36 38.07 Ct > 40 R R +

B16-142 Subtercola sp. 27.43 Ct > 40 Ct > 40

B16-211 Ralstonia pickettii*

28.79 39.2 Ct > 40

B16-035 Lelliottia sp. 28.88 187

B16-157 Pantoea sp. 29.09 38.93 Ct > 40 R R


30.42 32.65 R R -

B16-236 E. persicina 30.46 Ct > 40 Ct > 40

B16-233 Rahnella sp. 30.8 Ct > 40 Ct > 40

B16-232 R. aquatilis 30.94 Ct > 40 Ct > 40


31.63 30.95 Ct > 40 Ct > 40 R R -

B16-247 Ralstonia sp. 33.55 Ct > 40 34.89

B16-197 P. rhodesiae 36.17 35.99 Ct > 40 Ct > 40 R R -

B16-124 P. syringae 36.19 39.34 R R +

B16-118 P. syringae 36.53 37.47 Ct > 40 Ct > 40 R R +

B11-264 P. syringae 39.51 No Ct

R R +

VT106 X. hortorum 40.04 37.87 Ct > 40 Ct > 40

B13-005 P. stewartii 42.17 No Ct

Ct > 40 Ct > 40

B07-140 Pectobacterium carotovorum

No Ct No Ct

Ct > 40 Ct > 40

Page 28 of 34



Draft


Page | 6

Isolates Species Ea-lsc Ct

hpEa Ct

pEa71 PCRband size (bp)

rhAmpFAM

Ct

rhAmpHEX Ct

Growth on KB + 100

μg/ml streptomycin

Growth on KB + 1000

μg/ml streptomycin

Tobacco HR


No Ct No Ct

Ct > 40 Ct > 40

B11-003 E. tracheiphila No Ct No Ct

Ct > 40 Ct > 40

B17-110 E. coli DH5α No Ct 31.04 Ct > 40 Ct > 40

B11-046 C. michiganensis subsp. michiganensis

No Ct No Ct


Ct > 40 39.47

B18-024 P. caricapapayea

Ct > 40 Ct > 40

Table 4 Results of molecular, growth and pathogenicity tests performed on a panel of bacterial isolates. PC: positive control. Blank field indicate the condition was not tested. R: streptomycin resistant; S: susceptible to streptomycin. + : HR on tobacco, -: no HR .

Page 29 of 34



Draft

Figure 1 Agarose gel PCR identification of Pseudomonas syringae wild type isolates.

Page 30 of 34



Draft

Figure 2 Symptom development on apple leaves one week post-inoculation with Erwinia amylovora B16-130. Symptom development on apple leaves 3 weeks post-inoculation with Pseudomonas syringae B16-222.

Page 31 of 34



Draft

Figure 3 Hierarchical clustering of the observed symptoms produced by the Pseudomonas isolates on four different apple cultivars.

Page 32 of 34



Draft

Figure 4 Hierarchical clustering of the observed symptoms produced by the E. amylovora isolates on four different apple cultivars.

Page 33 of 34



DraftDiscrimination of apple diseases caused by Erwinia amylovora and Pseudomonas syringae

New tools for the identification of pome fruit bacterial diseases caused by Erwinia amylovora and Pseudomonas syringae are presented together with a hierarchical clustering of symptoms severity on four different apple cultivars.

Graphical Abstract

Page 34 of 34



Draft - University of Toronto T-Space · E. amylovora, the causative agent of fire blight, produces...

Documents

Transcript of Draft - University of Toronto T-Space · E. amylovora, the causative agent of fire blight, produces...