Downloaded from on January 12, 2021 by ......2014/10/07 · Pat1 and Pat2 are not 58 needed for...
Transcript of Downloaded from on January 12, 2021 by ......2014/10/07 · Pat1 and Pat2 are not 58 needed for...
1
TETRAHYMENA POT2 IS A DEVELOPMENTALLY REGULATED PARALOG OF POT1 THAT LOCALIZES TO 1
CHROMOSOME BREAKAGE SITES BUT NOT TO TELOMERES 2
3
Stacey Cranerta1, Serena Heyseb1*, Benjamin R. Lingera**, Rachel Lescasseb***, Carolyn Pricea# 4
5
aDepartment of Cancer Biology, University of Cincinnati, OH 45267, USA. bDepartment of 6
Molecular Genetics, Microbiology, and Biochemistry, University of Cincinnati, OH 45267, USA. 7
1These authors contributed equally to this work 8
9
10
11
Running Head: Pot2 localizes to chromosome breakage sites 12
13
14
15
#Address correspondence to Carolyn Price. E. Mail; [email protected] 16
17
*Current address: The Procter and Gamble Company, Cincinnati, OH 45202, USA 18
**Current address: Department of Chemistry, Indiana Wesleyan University, Marion, IN 46953, 19
USA 20
***Current address: Education Nationale, Académie de Créteil, France 21
22
Accession numbers for new sequences: POT1: KM406495, POT2: KM406494, PAT1: 23
KM406496, TPT1: KM406497 24
25
26
EC Accepts, published online ahead of print on 10 October 2014Eukaryotic Cell doi:10.1128/EC.00204-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
2
ABSTRACT 27
Tetrahymena telomeres are protected by a protein complex composed of Pot1, Tpt1, 28
Pat1 and Pat2. Pot1 binds the 3’ overhang and serves multiple roles in telomere maintenance. 29
Here we describe Pot2, a paralog of Pot1, which has evolved a novel function during 30
Tetrahymena sexual reproduction. Pot2 is unnecessary for telomere maintenance during 31
vegetative growth as telomere structure is unaffected by POT2 macronuclear gene disruption. 32
Pot2 is expressed only in mated cells where it accumulates in developing macronuclei around 33
the time of two chromosome processing events: Internal Eliminated Sequence (IES) excision 34
and chromosome breakage. Chromatin immunoprecipitation (ChIP) demonstrated Pot2 35
localization to regions of chromosome breakage but not to telomeres or IESs. Pot2 association 36
with Chromosome Breakage Sites (CBSs) occurs slightly before chromosome breakage. Pot2 37
did not bind CBS or telomeric DNA in vitro suggesting that it is recruited to CBSs by another 38
factor. The telomere proteins Pot1, Pat1 and Tpt1 and the IES binding factor Pdd1 fail to co-39
localize with Pot2. Thus, Pot2 is the first protein found to associate specifically with CBSs. The 40
selective association of Pot2 versus Pdd1 with CBSs or IESs indicates a mechanistic difference 41
between the chromosome processing events at these two sites. Moreover, ChIP revealed that 42
histone marks characteristic of IES processing, H3K9me3 and H3K27me3, are absent from 43
CBSs. Thus, the mechanisms of chromosome breakage and IES excision must be 44
fundamentally different. Our results lead to a model where Pot2 directs chromosome breakage 45
by recruiting telomerase and/or the endonuclease responsible for DNA cleavage to CBSs. 46
47
INTRODUCTION 48
Telomeres are dynamic complexes of protein and nucleic acid that protect the ends of 49
linear eukaryotic chromosomes (1, 2). The telomere proteins prevent the chromosome terminus 50
from being recognized as DNA damage. They also regulate access of telomerase, the enzyme 51
that synthesizes telomeric DNA to maintain telomere length (2, 3). In the ciliate Tetrahymena 52
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
3
thermophila, telomeres are bound by a four protein complex composed of Pot1 (formally Pot1a), 53
Tpt1, Pat1, and Pat2 (4, 5). The complex binds to the 3’ single-strand overhang that is present 54
on the G-rich strand of the telomeric DNA (the G-overhang). Pot1 binds the overhang directly, 55
Tpt1 binds to Pot1 and together the two proteins stop the overhang from eliciting a DNA 56
damage response and prevent excessive telomere elongation (5, 6). Pat1 and Pat2 are not 57
needed for telomere protection but they are required for telomerase to maintain telomere length 58
(4, 5). The POT1 gene was originally identified as one of two Tetrahymena homologs (POT1 59
and POT2) of the Oxytricha Telomere End Binding Protein (TEBP) (6). The POT1 and POT2 60
genes lie ~1.3 kb apart in the macronuclear genome suggesting they arose through gene 61
duplication (Fig. 1A). The encoded proteins have 42% sequence identity with each other and 62
∼25% identity to TEBP. Although the role of Pot1 in telomere maintenance and end protection is 63
well established (6), the function of Pot2 has remained unclear. We now address the role of 64
Pot2 and show that it functions during Tetrahymena genome reorganization but that it is not 65
needed for telomere maintenance during normal vegetative cell growth. 66
Tetrahymena have an unusual nuclear organization that is generated through genome 67
reorganization during the sexual stage of the life cycle (7). The cells are bi-nucleated with a 68
somatic macronucleus that is transcriptionally active during vegetative growth and a germline 69
micronucleus that is silent with its chromatin in a heterochromatic state (8). During sexual 70
reproduction, the old parental macronucleus is destroyed and a zygotic copy of the 71
micronucleus gives rise to new micronuclei and macronuclei (7, 9). Formation of the new 72
macronucleus involves a developmental program during which the micronucleus-derived 73
chromosomes are reorganized and matured into a transcriptionally active state. There are two 74
major genomic reorganization events: chromosome breakage with new telomere addition and 75
Internal Eliminated Sequence (IES) excision. Chromosome breakage is the process whereby 76
the five large micronuclear chromosomes are broken into ∼200 smaller units and telomeric 77
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
4
repeats are added de novo to the broken chromosome ends (10-12). IES excision involves 78
removal of nearly one third of the micronuclear genome by excising segments of DNA and 79
ligating the broken ends back together (13, 14). Subsequent DNA amplification generates a 80
copy number of ∼45 for all chromosomes except the rDNA which is amplified to ∼9000 copies 81
(7, 15). 82
Chromosome breakage occurs at a well conserved 15 base-pair consensus sequence 83
that contains a 10-bp invariant core (16, 17). About 200 of these loci, termed chromosome 84
breakage sites (CBSs), exist in the micronuclear genome (11, 18). After breakage, telomeres 85
are added to the newly formed ends by the enzyme telomerase (10, 12). It is not yet known 86
whether telomere addition occurs concurrently with, or shortly after, breakage and the proteins 87
involved in DNA cleavage and telomerase recruitment remain to be identified. While the rDNA is 88
also processed by this mechanism, after cleavage two rDNA molecules are ligated to form a 89
palindrome with telomeres on each end (15, 19). 90
Unlike chromosome breakage, there is no consensus sequence for IES excision. 91
Instead, the parental macronucleus is used as a template for directing removal of sequences in 92
the developing macronucleus by an RNAi-like mechanism (8, 14). Early in conjugation, the 93
micronucleus is transcribed into long non-coding RNA which is then processed into small RNAs, 94
termed scan RNAs (scnRNAs), by a Dicer-like protein Dcl1 (20-22). The scnRNAs then “scan” 95
the genome of the parental macronucleus and if sequence homologous to a scnRNA is found, 96
the RNA is degraded (23). The RNAs that were not degraded contain sequences that are 97
absent from the parental macronucleus and thus represent sequences to be targeted for 98
excision from the developing macronucleus. The remaining scnRNAs are transported to the 99
developing macronucleus where they target homologous sequences for excision by mediating 100
histone methylation to generate tri-methylated H3K9 and H3K27 (H3K9Me3 and H3K27Me3) (8, 101
24-26). The H3K9Me3 and H3K27Me3 marks are recognized by the HP1-like protein Pdd1 and 102
by Tpb2 a PiggyBac transposase-like protein (27, 28). Pdd1 is needed for assembly of the 103
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
5
marked IESs into heterochromatin bodies while Tpb2 carries out the actual DNA cleavage (29, 104
30). Pdd1 also has poorly understood roles early in conjugation when it localizes to both the 105
parental macro- and micronuclei (28, 29). 106
Interestingly, gene disruptions in essentially all components of the IES excision pathway 107
examined to date prevent not only IES excision but also chromosome breakage (21-23, 26-28, 108
31, 32). PDD1 is a notable exception in that somatic knockout of early expression leaves 109
chromosome breakage unaffected although cells are unable to complete IES excision (28). At 110
first sight, the finding that most IES components are required for chromosome breakage 111
suggests that the two DNA processing pathways utilize essentially the same RNAi based 112
mechanism. However, the requirement for early expression of Pdd1 in order to complete IES 113
excision but not chromosome breakage raises the possibility that chromosome breakage 114
proceeds by a mechanistically different process that can be indirectly affected by the status of 115
the IES excision pathway. For example, disruption of IES excision might trigger a developmental 116
checkpoint which prevents the cell from proceeding with the chromosome breakage program. 117
Here, we show that the telomere protein paralog Pot2 is developmentally regulated with 118
expression coinciding with chromosome breakage and telomere addition. Moreover, Pot2 119
localizes to sites of chromosome breakage but not to telomeres or IESs. Thus, Pot2 is the first 120
protein to be specifically associated with chromosome breakage. We also show that CBSs lack 121
H3K9 and H3K27 methylation. This result indicates that IES excision and chromosome 122
breakage must proceed via different mechanisms. 123
124
MATERIALS AND METHODS 125
Growth, mating, and transformation of Tetrahymena. Cells were grown in 1X SPP or 1.5X 126
PPYS media with 1X antibiotic/antimycotic as described previously (33). To obtain growth 127
curves, cells were maintained in log phase growth (1-2x105 cells/mL). Cell lines with disruption 128
of the macronuclear POT2 gene were generated by using biolistic transformation to introduce a 129
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
6
gene replacement construct containing the Neo3 drug selection cassette into the POT2 gene 130
locus of Cu428 and B2086 cells (Sup Fig. 1A). The cells were selected with increasing 131
concentrations of paromomycin until all copies of the macronuclear POT2 gene were replaced. 132
Cells were checked at intervals to verify that they retained the full gene replacement. For 133
mating, wild type Cu428 and B2086 or POT2 knockout cells were starved in 10 mM Tris buffer 134
pH 7.5 for 18-24 hours, 1x105 cells/mL of each mating type were then mixed and aliquots were 135
taken at indicated times. The percent of cells in each stage was assessed by fluorescent 136
microscopy after staining with 0.01% acridine orange. The POT1 and PDD1 macronuclear 137
knockout cell lines were as previously described (6, 28). The PDD1 micronuclear knockout cell 138
line was provided by Douglas Chalker (Washington University, Missouri). 139
140
Telomere analysis. Genomic DNA from wild type or POT2 macronuclear knockout cells was 141
digested with HindIII and analyzed by Southern blot using a sub-telomeric probe specific to the 142
rDNA (Table 1) as described previously (34). Analysis of the G-overhang length was performed 143
as described (6). 144
RT-PCR. RNA was purified using the Qiagen RNAeasy kit then treated with DNase. Reverse 145
transcription was performed using random hexamers. The cDNA was then diluted and used as 146
a template for PCR. 147
148
Generation of Pot2 antibody. Pot2 antibody was made by immunizing rabbits with denatured, 149
full-length Pot2 expressed in E. coli. Antibody was purified on a column made by coupling 150
purified Pot2 to NHS-activated Sepharose 4 Fast Flow (GE). Antibody was eluted with Pierce 151
gentle elution buffer before dialysis into TBS and addition of 0.02% NaAzide and 10% glycerol. 152
Pot1, Pat1 and Tpt1 antibodies were as previously described (5, 6). Pdd1 antibody was from 153
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
7
Abcam (ab5339) and H3K27Me3 and H3K9Me3 antibodies were from Millipore (07-449 and 07-154
442). 155
156
Immunolocalization. Fixation was performed as previously described (35). 3.0 mL of mating 157
cells were fixed with 10 μl of fixative (2:1, saturated mercuric chloride: 95% EtOH) for 5 min. 158
Cells were pelleted, resuspended in 100% MeOH, dropped on slides and air dried. Slides were 159
blocked with PBT buffer (3% BSA, 0.1% Tween 20, 60 mM PIPES, 25 mM HEPES, 10 mM 160
EGTA, and 2 mM MgCl2, pH 6.9) for 1 hr and then incubated with a 1:100 dilution of purified 161
Pot2 antibody in PBT (0.35 mg/ml) followed by 1:500 dilution of Cy2-conjugated goat anti-rabbit 162
secondary antibody. Counter staining was with 0.1 μg/ml DAPI for 10 min. 163
164
11 kb PCR. The 11 kb PCR assay was performed using one primer complementary to the 165
telomeric repeats (F3) and one internal primer that hybridized within the 17S RNA coding 166
sequence (R3c) (Table 1). The PCR was performed using 5Prime PCR extender® kit, the 167
conditions were as follows: 10 pmol R3c, 10 pmol F3, 160 ng of genomic DNA, 2 μl 10X PCR 168
extender Buffer, 0.4 µl 10 mM dNTP's, and 0.3 μl enzyme mix. 94°C 2 min, 40 cycles of 94°C 169
20 sec, 50°C 20 sec, 72°C 2 min, then 72°C 5 min. 170
171
Chromatin Immunoprecipitation (ChIP). Cells were washed with 10 mM Tris pH 7.5, fixed 172
with formaldehyde, the DNA sheared by sonication and the soluble fraction prepared as 173
previously described (6). 50 μL of soluble chromatin, at 5x106 cells/mL, was used per 174
immunoprecipitation in 1 ml of lysis buffer (150 mM NaCl, 25 mM Tris, pH 7.5, 5 mM EDTA, pH 175
8.0, 1% Triton X-100, 0.1% SDS, 0.5% NaDoc, and 1X protease inhibitor cocktail). Samples 176
were incubated with antibody overnight with rotation at 4°C, Protein A beads were added for ≥2 177
hours and the beads were processed as described previously (4). Briefly, a sample of input 178
chromatin was collected for DNA isolation. DNA was purified by boiling the beads with 50 μL 179
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
8
10% Chelex slurry in water (Chelex® 100 from BioRad) (36). The samples were treated with 180
Proteinase K (100 μg/mL) for 30 min at 55°C then boiled again for 10 minutes. The supernatant 181
was collected, the beads were re-extracted with 50 μL ddH20, and supernatants pooled. The 182
supernatant was used directly as a template for real-time quantitative PCR. The PCR was 183
performed using SYBR® Advantage® qPCR Premix from Clontech Laboratories, Inc. The 184
conditions were as follows; 95°C for 2 min, followed by 40 cycles of 95°C for 15 sec, 55°C for 20 185
sec, 72°C for 30 sec . The primers are shown in Table 1. 186
187
Protein isolation and DNA binding analysis. Full length TAP-tagged Pot1 was purified from 188
insect cells using IgG beads and the tag was removed by TEV cleavage. MBP-tagged Pot2 was 189
purified from insect cells on amylose resin. MBP-tagged Pot1 and Pot2 N-terminal domains (a.a. 190
1-287 for Pot1 and a.a. 1-270 for Pot2) were expressed in E. coli and purified on amylose resin. 191
The truncation site was based on modeling of structural homology to the Oxytricha TEBP DNA-192
binding domain using Phyre2 and included both predicted OB folds. For DNA binding studies, 193
oligonucleotides (Table 1) were 5’ end labeled with 32P γ-ATP and duplexes were formed by 194
heating and slow cooling. The 15 μl binding reactions contained 25-200 ng of purified protein 195
and 4 fmol of labeled oligonucleotide in 40 mM Tris pH 7.5, 125 mM NaCl, 5% glycerol, 1 mM 196
DTT, and 0.25% NP-40. After 30 min incubation at room temperature, binding reactions were 197
separated in 5% non-denaturing acrylamide gels made with 1X TBE and 2.5% glycerol. Gels 198
were run with 0.5X TBE at 130V and analyzed by Phosphor Imaging. 199
200
RESULTS 201
POT2 is unnecessary for macronuclear telomere maintenance 202
To gain more insight into the function of Pot2, we disrupted the macronuclear POT2 203
gene by replacing the endogenous gene locus with a neomycin resistance cassette (Fig. S1A). 204
Southern blot analysis confirmed full gene replacement, indicating that POT2 is not essential 205
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
9
(Fig. S1B). The knockout cells exhibited normal cytology (data not shown) and the growth rate 206
was unaffected (Fig. 1B). Thus, unlike Pot1 which is essential, Pot2 is not needed for growth of 207
vegetative cells. 208
Since Pot1 is required for several aspects of macronuclear telomere maintenance, we 209
asked if Pot2 also has telomeric functions. To determine the effect of Pot2 loss on telomere 210
length, we used Southern-blot analysis to compare the size of the rDNA telomeric restriction 211
fragments from wild type and POT2 knockout cells. Unlike Pot1 depletion which causes rapid 212
telomere elongation (6), loss of Pot2 had no effect on telomere length (Fig. 1C). As Pot1 213
depletion also causes an increase in G-overhang length and a change in the 3’ terminal 214
nucleotide, we next asked whether Pot2 loss affects G-overhang structure. This was achieved 215
using a previously described oligonucleotide ligation and primer extension procedure (Fig. 1D) 216
(33). An adaptor complex composed of a unique sequence DNA duplex with a 5 nt extension of 217
C-strand telomeric repeat was hybridized and then ligated to the G-overhangs on telomeric DNA 218
isolated from wild type or POT2 knockout cells. The oligonucleotide with the C-strand extension 219
(the guide oligo) was then primer extended with T4 DNA polymerase to the junction with the 220
telomere duplex DNA and the reaction products were visualized by gel electrophoresis. In initial 221
experiments, we monitored ligation of a series of adaptor complexes harboring guide oligos with 222
different permutations of the C-strand telomeric repeat. Only guide oligos with a 3’CCCA 223
extension allowed ligation of the adaptor complex to the telomere (data not shown), indicating 224
that the overhang terminated with the sequence 5’-G4T and hence was unchanged by loss of 225
Pot2 (33). When we performed the primer extension reaction and visualized the reaction 226
products, we found that the pattern of products obtained with DNA from wild type and POT2 227
knockout cells was essentially the same. Most products corresponded to overhangs of 14 or 20 228
nucleotides, indicating that overhang length was unaffected by Pot2 loss (Fig. 1E). As expected, 229
DNA from POT1 knockout cells gave rise to longer primer extension products indicating G-230
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
10
overhang elongation (6, 33). Overall our results indicate that Pot2 is not needed for length 231
regulation or correct G-overhang processing at macronuclear telomeres. 232
233
234
Pot2 is expressed during macronuclear development at the time of new telomere 235
synthesis 236
Since Pot2 is not needed for telomere maintenance in vegetative cells, a likely 237
alternative role would be in new telomere synthesis or one of the other processing events that 238
take place when cells mate (Fig. 2A). To determine if Pot2 expression is developmentally 239
regulated, we isolated RNA from conjugating cells and used RT-PCR to examine transcript 240
abundance for both POT2 and POT1 throughout the mating process. Wild type cells of opposite 241
mating types were starved for 24 hours, mixed to initiate mating and RNA was isolated at two 242
hour intervals until 18 hours post mixing. RNA was isolated again at 24 hours, then the mated 243
cells were fed so they could resume vegetative growth and RNA was isolated two hours later at 244
26 hours. RNA was also collected from vegetatively growing and starved cells. The RT-PCR 245
analysis revealed that POT2 is expressed during macronuclear development and the 246
expression pattern is quite different from that of POT1 (Fig. 2B). 247
POT1 mRNA was detected in actively dividing vegetative cells but not in starved cells. It 248
was then up-regulated ∼2 hours after initiating mating and remained abundant until 6 hours. 249
This timing of expression spans the pre-zygotic meiotic and mitotic divisions. POT1 mRNA 250
abundance then diminished as conjugation proceeded until 14 hours when a slight up-regulation 251
occurred to coincide with DNA amplification from 4N to 8N after anlagen II (31, 37, 38). POT1 252
mRNA also accumulated after re-feeding which coincides with the final rounds of DNA 253
amplification in the new macronucleus (37, 38). 254
In contrast to POT1, the POT2 mRNA was undetectable or of very low abundance in 255
vegetative cells and during early time points after the initiation of mating (Fig. 2B). The transcript 256
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
11
was first detected at the10 hour time point which corresponded to the anlagen II stage (Fig. 2A) 257
when cells start the process of macronuclear development. Transcript levels remained elevated 258
until 14 hours by which time most cells were separated. This pattern of expression overlaps that 259
seen for proteins involved in late stages of IES excision (28, 39, 40). Since, chromosome 260
breakage is also thought to occur around this time, our observations suggested that Pot2 may 261
have a role in either IES excision or chromosome breakage. An additional increase in POT2 262
expression was observed at the 24 hour time point. The reason for the increase is unclear as 263
chromosome processing and conjugation events should be complete by this time (Fig 2A). 264
To determine if the timing of POT2 transcription coincides with the onset of chromosome 265
breakage, we used a PCR reaction to detect the 11kb rDNA (Fig S2A and Fig. 2C) (32). The 266
11kb molecule is a byproduct of rDNA processing that is only seen in conjugating cells following 267
chromosome breakage and new telomere addition. It is an excellent marker for these events 268
because the product gradually disappears from progeny cells after 11 population doublings 269
meaning that it is absent from the parental cells used for mating (41). When we performed the 270
PCR assay with DNA isolated from the same batches of mated cells used for the transcript 271
analysis (Fig. 2B), the first time point that the 11kb rDNA product could be detected was 12 272
hours after initiating mating (Fig. 2C). At this time point, the cells were leaving the anlagen II 273
stage of development and the pairs were beginning to separate. More 11 kb rDNA product was 274
detected at 14 hours by which time most cells had separated (Fig. 2A) and it rose further by 24 275
hours. The initial appearance of the 11 kb rDNA product at 12-14 hours indicates that 276
chromosome breakage and new telomere synthesis occur around the time of cell separation 277
and that POT2 transcription starts earlier. 278
To further explore the link between Pot2 expression and chromosome processing, we 279
examined the distribution of Pot2 protein in mated cells. Antibodies to Pot2 were raised for this 280
purpose and used to perform immunolocalization studies with mated and unmated cells (Fig. 281
2D, Fig. S2B). As expected from the transcript analysis, no Pot2 was observed in unmated cells 282
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
12
and it remained absent during the early stages of conjugation. The protein was first detected at 283
the anlagen II stage when it localized to the developing macronucleus. It was not present in the 284
micronuclei or the old macronucleus. One antibody gave some staining of the oral apparatus but 285
this was not observed with a second antibody (Fig. S2C) and hence was non-specific. Thus, the 286
timing of Pot2 expression and localization to the developing macronucleus is consistent with a 287
role in IES excision or chromosome breakage and new telomere synthesis. 288
289
Pot2 localizes to sites of chromosome breakage 290
If Pot2 is involved in IES excision or chromosome breakage, it is likely to associate with 291
IESs or CBSs. To test for this, we performed ChIP with cells harvested at the various stages in 292
macronuclear development (Fig. 3, Fig, S3A). Mated wild type cells were harvested at different 293
time points and portions of the culture were used to monitor progression through macronuclear 294
development and the timing of chromosome breakage (Fig. 3A). The remaining cells were 295
cross-linked with formaldehyde, the chromatin sheared and precipitated with antibody to Pot2. 296
Precipitations were also performed with antibody to Pot1 or Pdd1 as positive controls for 297
telomere or IES association. The precipitated DNA was purified and analyzed by real-time PCR. 298
Primer sets were designed to monitor association with two different CBSs, an IES, the rDNA 299
telomere and an internal rDNA control sequence. As expected, ChIP with Pot1 antibody 300
consistently enriched for the rDNA telomere (Fig. 3C) while Pdd1 antibody enriched for the IES 301
(Fig. 3D). However, the Pot2 antibody enriched for the CBSs but not the telomere or the IES 302
(Fig. 3B). CBS enrichment was apparent by 8 hours, it peaked between 10-12 hours and then 303
declined at 14 hours. When we used the 11 kb PCR assay to monitor the timing of chromosome 304
breakage, we found that this occurred slightly later than Pot2 association with the CBSs (Fig. 305
3A). The 11 kb rDNA was first detected at 10-12 hours and it became much more abundant by 306
14 hours. These results indicate that Pot2 binds directly or indirectly at regions of chromosome 307
breakage prior to CBS cleavage but it does not localize to telomeres or IESs. 308
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
13
We attempted to confirm the above ChIP data using HA antibody and cells expressing 309
HA-tagged Pot2. The cells had the endogenous macronuclear POT2 gene replaced with 310
sequence encoding N- or C-terminally tagged Pot2. However when these cells were used for 311
ChIP we obtained inconsistent results (data not shown). Since the timing of Pot2 expression 312
coincides with the start of mRNA production in the developing macronucleus (Fig S3B), the 313
problem may have been that the tagged protein encoded by the parental macronucleus was 314
replaced by wild type Pot2 expressed from the developing macronucleus. A similar 315
phenomenon would explain the lack of phenotype seen after mating POT2 macronuclear 316
knockout cells (data not shown). We attempted to directly test the role of Pot2 in chromosome 317
breakage by generating cell lines with combined micro- and macronuclear gene disruptions but 318
the micronuclear POT2 gene locus was refractory to disruption. 319
320
Pot2 does not bind directly to CBS or telomeric DNA in vitro 321
Since Pot2 localizes to CBSs, we next asked whether it can bind directly to the CBS 322
consensus sequence or to other DNA sequences. MBP-tagged Pot2 was expressed in insect 323
cells using baculovirus, purified on amylose resin (Fig. S4B) and tested for DNA binding 324
specificity using gel shift assays. Purified Pot1 was used as a positive control for telomeric DNA 325
binding (Fig. S4B). As Pot2 is predicted to contain several OB folds (Fig. 1A) and these motifs 326
primarily bind single-stranded nucleic acid (42), we tested for binding both to an oligonucleotide 327
duplex corresponding to the CBS consensus sequence and to the individual oligonucleotides 328
corresponding to the two strands of this sequence. However, no binding was observed (Fig. 329
4A). We also tested for binding to telomeric G-strand DNA but only detected binding by a 330
contaminating protein in the Pot2 preparation (Fig. 4B, Fig. S4D). As expected, Pot1 bound the 331
telomeric G-strand DNA with high affinity. 332
Although an N-terminal tag does not prevent Pot1 from associating with telomeres (6), 333
we were concerned that that the MBP tag might disrupt Pot2 binding. It was not possible to 334
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
14
perform binding assays with the untagged full-length Pot2 because the protein became 335
insoluble when the tag was removed. Since the isolated DNA-binding domains of POT family 336
members are generally soluble and bind DNA with high affinity (43, 44), we sought to avoid 337
potential problems due to the MBP tag by expressing C-terminal truncations of Pot1 and Pot2 338
that contained the predicted OB-fold domain. These putative DNA-binding domains were quite 339
soluble and the Pot1 truncation bound telomeric G-strand DNA as expected, indicating correct 340
protein folding However, the Pot2 truncation failed to bind any single or double stranded 341
telomeric or CBS substrate tested (Fig S4A). While we cannot rule a problem due to incorrect 342
folding of the isolated domain, our results suggest that that Pot2 does not bind directly to the 343
CBS consensus sequence. Thus, the association of Pot2 with CBSs may be via an unknown 344
binding partner. Alternatively, binding may only occur in the context of a nucleosome. The 345
inability of Pot2 to bind telomeric DNA fits with the lack of telomere localization seen in the ChIP 346
analysis, again indicating that Pot2 is not a canonical telomere binding protein. 347
348
POT2 associates with CBSs without Pat1 or Tpt1 349
At the telomere, Pot1 functions in combination with Tpt1, Pat1 and Pat2. Since Pot1 and 350
Pot2 have significant sequence identity and a similar domain structure, we wished to know 351
whether Pot2 also functions in association with these proteins. Initially we examined the mRNA 352
expression profile of two other components of the telomeric G-overhang binding complex; the 353
Pot1-binding partner Tpt1, and Pat1 which binds to Tpt1. As before, RNA was isolated from 354
mated cells at various time points during conjugation and macronuclear development. RT-PCR 355
analysis indicated that Pat1 and Tpt1 were both expressed in vegetative cells as expected. 356
They were also expressed during macronuclear development but their patterns of up- and 357
down-regulation were less distinct than those of Pot1 or Pot2 (Fig. 5A). Overall the profiles were 358
more similar to that of Pot1 as both Pat1 and Tpt1 were present during the early stages of 359
conjugation and at 26 hours after refeeding. 360
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
15
We next used ChIP to examine the association of Tpt1 and Pat1 with CBSs, IESs and 361
telomeres. The ChIP was performed with mated wild type cells and Tpt1 or Pat1 antibody (5). 362
The chromatin was from the same mating experiments shown in Fig. 3. Our analysis revealed 363
that the Tpt1 and Pat1 antibodies both enriched for telomeric DNA but not for CBS or IES DNA 364
(Fig. 5B). In each case, the overall ChIP profile was similar to that observed with antibody to 365
Pot1. We therefore conclude that Pat1 and Tpt1 do not associate with Pot2 at CBSs and that 366
the binding partners of Pot2 are different from those of Pot1. 367
368
CBSs lack H3K27Me3, and H3K9Me3 369
Our finding that Pot2 localizes to CBSs but not IESs indicates that there are likely to be 370
mechanistic differences between the processes of chromosome breakage and IES excision. 371
This conclusion is supported by our observation that Pdd1 localizes to IESs but not CBSs (Fig. 372
3D) and a report that this is also true for the Pdd1 interaction partner Pdd3 (39). To further 373
explore possible mechanistic differences between the two DNA processing pathways, we used 374
ChIP to determine if the heterochromatin marks H3K9Me3 and H3K27Me3 accumulate at or 375
near CBSs prior to chromosome breakage. The generation of these histone modifications is an 376
obligatory step in the scnRNA-mediated IES excision pathway because they are recognized by 377
proteins needed for the DNA cleavage reaction (Pdd1 and Tpb2) (9, 26, 29, 30, 45). Thus, their 378
absence from CBSs would indicate a major difference between the IES and chromosome 379
breakage pathways. To test for histone methylation at CBSs, we performed ChIP (Fig. 6A-B) 380
using antibody to tri-methylated H3K9 or H3K27 and chromatin from the mating time courses 381
described above. Analysis of the precipitated DNA confirmed previous studies indicating that 382
H3K9Me3 and H3K27Me3 accumulate at IESs with H3K27 methylation peaking slightly before 383
H3K9 methylation (26, 46). Interestingly, only low levels of CBS DNA were precipitated by the 384
tri-methylated H3K9 or H3K27 antibody and there was no significant enrichment of CBS DNA 385
relative to the control rDNA sequence. Thus, the nucleosomes at or near CBSs do not 386
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
16
accumulate H3K9Me3 and H3K27Me3 marks during the course of macronuclear development. 387
We therefore conclude that, the mechanisms of chromosome breakage and IES excision must 388
be quite different. 389
Given this mechanistic difference, it is interesting that disruption of IES excision can also 390
impair chromosome breakage. The one exception in the literature is the macronuclear knockout 391
of PDD1 which leaves chromosome breakage intact (28). Since the macronuclear knockout 392
disrupts only early Pdd1 expression, we revisited this observation using cells with a full 393
macronuclear and micronuclear gene disruption to prevent both early and late Pdd1 expression. 394
Chromosome breakage was monitored with the 11 kb rDNA assay using DNA isolated from 395
mated cells. Consistent with published data, disruption of early Pdd1 expression had no effect 396
on the timing or the amount of 11 kb PCR product that was generated (Fig. S3C, left panel). 397
However, disruption of early and late Pdd1 expression not only delayed the occurrence of 398
chromosome breakage, but decreased the overall amount of 11 kb PCR product (Fig. S3C, right 399
panel). Thus, it appears that impaired chromosome breakage is a general, but most likely 400
indirect, outcome of impaired IES excision. 401
402
DISCUSSION 403
Here we describe a new member of the POT (Protection of Telomeres) protein family, 404
Tetrahymena Pot2, which functions outside of the established telomere maintenance pathway. 405
Although Pot2 resembles Pot1 in sequence and predicted protein structure, Pot2 is unable to 406
bind telomeric DNA, it does not localize to telomeres and it is not needed for telomere length 407
regulation or other aspects of macronuclear telomere maintenance. Instead, Pot2 is expressed 408
during the sexual stage of the Tetrahymena life cycle when it accumulates in the developing 409
macronucleus slightly before the onset of chromosome breakage and new telomere synthesis. 410
ChIP studies revealed that Pot2 localizes to CBSs, the sequences that mark the site of 411
chromosome breakage, but not to IESs. Thus, Pot2 is the first protein in Tetrahymena to be 412
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
17
specifically linked to the process of chromosome breakage and new telomere synthesis. 413
Although Pot1 and its binding partners Tpt1 and Pat1 localize to telomeres in mated cells, we 414
did not detect them at CBSs. This means that Pot2 must function at CBSs in conjunction with 415
novel interaction partners and since Pot2 does not appear to bind directly to the CBS consensus 416
sequence, these proteins may direct Pot2 to the CBS. Taken together our results indicate that 417
Pot2 has evolved a role independent of the telomere protection and maintenance functions 418
normally associated with the POT family of proteins. 419
The functional evolution of POT proteins is not without precedence. Mouse has two Pot 420
proteins, Pot1a and Pot1b, with 72% sequence identity. Both participate in telomere end 421
protection but they show only partial functional overlap as the primary role of Pot1a is to inhibit 422
DNA damage signaling while Pot1b prevents telomeric C-strand resection (47, 48). Arabidopsis 423
has three Pot proteins, Pot1a, Pot1b and Pot1c, which exhibit a greater degree of functional 424
divergence. Pot1b and Pot1c both appear to participate in telomere end protection but Pot1a is 425
necessary for telomerase action (49-51). Pot1a does not bind telomeric DNA but instead is a 426
component of the telomerase holoenzyme (49, 52). 427
We attempted to determine the role of Tetrahymena Pot2 during macronuclear 428
development through POT2 gene disruption, but we were only able to disrupt the macronuclear 429
gene and this did not give rise to a phenotype. The lack of phenotype most likely reflected 430
rescuing Pot2 expression from the micronucleus-derived gene during macronuclear 431
development. Nonetheless, our finding that Pot2 localizes to CBSs but apparently does not bind 432
either telomeric DNA or the CBS consensus sequence, suggests several novel functions for this 433
member of the POT protein family. One possibility is that Pot2 interacts with telomerase in a 434
manner akin to Arabidopsis Pot1a to direct addition of telomeric repeats at the site of 435
chromosome breakage (see model in Fig. 6C). Some form of telomerase recruitment factor is 436
likely to be necessary because the broken ends lack sequence complementary to the 437
telomerase RNA template (16, 17) and hence are not good substrates to seed new telomere 438
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
18
addition (12).Thus far, we have been unable to detect an interaction between Pot2 and 439
telomerase by precipitating Pot2 and assaying the precipitate for telomerase activity. However 440
this negative result could be explained if the interaction is transient, it occurs only on chromatin 441
or if involves only a small fraction of the telomerase present in mated cells. An alternative, but 442
not mutually exclusive role for Pot2 might be to recruit the machinery responsible for the DNA 443
cleavage reaction. Cleavage at the CBS must be tightly regulated to prevent inappropriate 444
chromosome breakage in the micronucleus and to ensure rapid telomere addition to the newly 445
broken ends in the developing macronucleus. A delay in telomere addition would allow the 446
broken ends to be recognized as DNA damage and resected by nuclease leading to loss of 447
adjacent coding sequence (32, 40). Pot2 does not appear to contain an endonuclease domain 448
so it is unlikely to carry out the DNA cleavage reaction. However, by associating simultaneously 449
with a CBS recognition factor and telomerase, Pot2 would be well positioned to coordinate DNA 450
cleavage with new telomere addition (Fig. 6C). 451
Our finding that Pot2 associates with CBSs but not IESs, while the converse is true for 452
Pdd1, prompted us to look more closely for differences between the chromosome breakage and 453
IES excision pathways. The discovery that CBS lack tri-methlyated H3K9 and H3K27 indicates 454
a fundamental mechanistic difference in the two chromosome processing pathways. 455
Generation of H3K9Me3 and H3K27Me3 marks at IESs is the culmination of the RNAi-based 456
scanning process to delineate IESs from the surrounding macronuclear-destined sequence (8, 457
25, 26, 46). Moreover, these marks are required for the subsequent cleavage reaction because 458
they are recognized by Pdd1 and the transposase-like protein Tpb2 (14, 27, 29). Thus, the lack 459
of H3K9Me3 and H3K27Me3 on CBSs means that chromosome breakage is unlikely to be 460
driven by scnRNA mediated heterochromatin formation. Given that CBSs contain a well 461
conserved consensus sequence, they are likely to be marked for cleavage by a protein that 462
directly recognizes this sequence. As the ultimate fate of IESs and CBSs is quite different (DNA 463
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
19
elimination and re-ligation versus cleavage with telomere addition) it is logical that the cell would 464
mark the two regions differently. 465
It remains to be seen whether any components of the IES excision pathway are used in 466
chromosome breakage. While Tpb2 is a candidate to cleave the DNA at CBSs (27), a 467
transposase-like protein may be an inappropriate choice as there is no subsequent ligation 468
reaction. It is still unclear why disruption of IES excision should also prevent or greatly reduce 469
chromosome breakage. However, cells that are unable to carry out IES excision exhibit a 470
disruption in their developmental program as they arrest with two micronuclei and two 471
macronuclei, rather than one micronucleus and two macronuclei, and they are unable to resume 472
growth on refeeding (21-23, 25, 26, 53). Thus, disruption of IES excision may lead to a 473
developmental checkpoint that also prevents chromosome breakage. 474
In summary, our finding that Pot2 localizes to CBSs but not to telomeres reveals a novel 475
function for a telomere protein homolog. While further studies are required to delineate the 476
precise role of Pot2 in chromosome breakage, the current analysis of Pot2 has uncovered a 477
clear functional separation between the two chromosome processing events associated with 478
Tetrahymena macronuclear development. The study also provides hints of a broader 479
developmental checkpoint as the explanation for much of the apparent overlap between 480
chromosome breakage and IES excision pathways. Overall, the work begins to unravel the 481
functional evolution of telomere proteins in Tetrahymena and starts to differentiate the process 482
of chromosome breakage from its better understood counterpart IES excision. 483
484
ACKNOWLEDGEMENTS 485
We thank Douglas Chalker for the PDD1 knockout cells, Jacob Naduparambil for 486
assistance with early experiments and members of the Price lab for helpful discussions. This 487
work was supported by National Institutes of Health (NIH) grant RO1 GM088728 to CMP. BRL 488
was supported by NIH grant T32 CA117846 and SC by NIH grant T32 ES007250. 489
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
20
490
REFERENCES 491
1. O'Sullivan RJ, Karlseder J. 2010. Telomeres: protecting chromosomes against 492
genome instability. Nat Rev Mol Cell Biol 11:171-181. 493
2. Stewart JA, Chaiken MF, Wang F, Price CM. 2012. Maintaining the end: roles of 494
telomere proteins in end-protection, telomere replication and length regulation. Mutation 495
research 730:12-19. 496
3. Pfeiffer V, Lingner J. 2013. Replication of telomeres and the regulation of telomerase. 497
Cold Spring Harb Perspect Biol 5:a010405. 498
4. Letchoumy Premkumar V, Cranert S, Linger BR, Morin GB, Minium S, Price C. 499
2013. The 3' overhangs at Tetrahymena telomeres are packaged by four proteins: 500
Pot1a, Tpt1, Pat1 and Pat2. Eukaryot Cell. 501
5. Linger BR, Morin GB, Price CM. 2011. The Pot1a-associated proteins Tpt1 and Pat1 502
coordinate telomere protection and length regulation in Tetrahymena. Molecular biology 503
of the cell 22:4161-4170. 504
6. Jacob NK, Lescasse R, Linger BR, Price CM. 2007. Tetrahymena POT1a regulates 505
telomere length and prevents activation of a cell cycle checkpoint. Molecular and cellular 506
biology 27:1592-1601. 507
7. Karrer KM. 2012. Nuclear dualism. Methods Cell Biol 109:29-52. 508
8. Chalker DL, Meyer E, Mochizuki K. 2013. Epigenetics of ciliates. Cold Spring Harb 509
Perspect Biol 5:a017764. 510
9. Chalker DL. 2008. Dynamic nuclear reorganization during genome remodeling of 511
Tetrahymena. Biochim Biophys Acta 1783:2130-2136. 512
10. Fan Q, Yao M. 1996. New telomere formation coupled with site-specific chromosome 513
breakage in Tetrahymena thermophila. Molecular and cellular biology 16:1267-1274. 514
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
21
11. Hamilton E, Bruns P, Lin C, Merriam V, Orias E, Vong L, Cassidy-Hanley D. 2005. 515
Genome-wide characterization of tetrahymena thermophila chromosome breakage sites. 516
I. Cloning and identification of functional sites. Genetics 170:1611-1621. 517
12. Yu GL, Blackburn EH. 1991. Developmentally programmed healing of chromosomes by 518
telomerase in Tetrahymena. Cell 67:823-832. 519
13. Chalker DL, Yao MC. 2011. DNA elimination in ciliates: transposon domestication and 520
genome surveillance. Annual review of genetics 45:227-246. 521
14. Mochizuki K. 2012. Developmentally programmed, RNA-directed genome 522
rearrangement in Tetrahymena. Dev Growth Differ 54:108-119. 523
15. Tanaka H, Yao MC. 2009. Palindromic gene amplification--an evolutionarily conserved 524
role for DNA inverted repeats in the genome. Nature reviews. Cancer 9:216-224. 525
16. Yao MC, Zheng K, Yao CH. 1987. A conserved nucleotide sequence at the sites of 526
developmentally regulated chromosomal breakage in Tetrahymena. Cell 48:779-788. 527
17. Yao MC, Yao CH, Monks B. 1990. The controlling sequence for site-specific 528
chromosome breakage in Tetrahymena. Cell 63:763-772. 529
18. Hamilton EP, Williamson S, Dunn S, Merriam V, Lin C, Vong L, Russell-Colantonio 530
J, Orias E. 2006. The highly conserved family of Tetrahymena thermophila chromosome 531
breakage elements contains an invariant 10-base-pair core. Eukaryotic cell 5:771-780. 532
19. Kapler GM. 1993. Developmentally regulated processing and replication of the 533
Tetrahymena rDNA minichromosome. Curr Opin Genet Dev 3:730-735. 534
20. Mochizuki K, Gorovsky MA. 2004. Conjugation-specific small RNAs in Tetrahymena 535
have predicted properties of scan (scn) RNAs involved in genome rearrangement. 536
Genes Dev 18:2068-2073. 537
21. Malone CD, Anderson AM, Motl JA, Rexer CH, Chalker DL. 2005. Germ line 538
transcripts are processed by a Dicer-like protein that is essential for developmentally 539
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
22
programmed genome rearrangements of Tetrahymena thermophila. Molecular and 540
cellular biology 25:9151-9164. 541
22. Mochizuki K, Gorovsky MA. 2005. A Dicer-like protein in Tetrahymena has distinct 542
functions in genome rearrangement, chromosome segregation, and meiotic prophase. 543
Genes Dev 19:77-89. 544
23. Mochizuki K, Fine NA, Fujisawa T, Gorovsky MA. 2002. Analysis of a piwi-related 545
gene implicates small RNAs in genome rearrangement in tetrahymena. Cell 110:689-546
699. 547
24. Aronica L, Bednenko J, Noto T, DeSouza LV, Siu KW, Loidl J, Pearlman RE, 548
Gorovsky MA, Mochizuki K. 2008. Study of an RNA helicase implicates small RNA-549
noncoding RNA interactions in programmed DNA elimination in Tetrahymena. Genes 550
Dev 22:2228-2241. 551
25. Liu Y, Mochizuki K, Gorovsky MA. 2004. Histone H3 lysine 9 methylation is required 552
for DNA elimination in developing macronuclei in Tetrahymena. Proceedings of the 553
National Academy of Sciences of the United States of America 101:1679-1684. 554
26. Liu Y, Taverna SD, Muratore TL, Shabanowitz J, Hunt DF, Allis CD. 2007. RNAi-555
dependent H3K27 methylation is required for heterochromatin formation and DNA 556
elimination in Tetrahymena. Genes Dev 21:1530-1545. 557
27. Cheng CY, Vogt A, Mochizuki K, Yao MC. 2010. A domesticated piggyBac 558
transposase plays key roles in heterochromatin dynamics and DNA cleavage during 559
programmed DNA deletion in Tetrahymena thermophila. Molecular biology of the cell 560
21:1753-1762. 561
28. Coyne RS, Nikiforov MA, Smothers JF, Allis CD, Yao MC. 1999. Parental expression 562
of the chromodomain protein Pdd1p is required for completion of programmed DNA 563
elimination and nuclear differentiation. Mol Cell 4:865-872. 564
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
23
29. Schwope RM, Chalker DL. 2014. Mutations in Pdd1 reveal distinct requirements for its 565
chromodomain and chromoshadow domain in directing histone methylation and 566
heterochromatin elimination. Eukaryotic cell 13:190-201. 567
30. Vogt A, Mochizuki K. 2013. A domesticated PiggyBac transposase interacts with 568
heterochromatin and catalyzes reproducible DNA elimination in Tetrahymena. PLoS 569
genetics 9:e1004032. 570
31. Nikiforov MA, Smothers JF, Gorovsky MA, Allis CD. 1999. Excision of micronuclear-571
specific DNA requires parental expression of pdd2p and occurs independently from DNA 572
replication in Tetrahymena thermophila. Genes Dev 13:2852-2862. 573
32. Lin IT, Chao JL, Yao MC. 2012. An essential role for the DNA breakage-repair protein 574
Ku80 in programmed DNA rearrangements in Tetrahymena thermophila. Molecular 575
biology of the cell 23:2213-2225. 576
33. Jacob NK, Skopp R, Price CM. 2001. G-overhang dynamics at Tetrahymena 577
telomeres. The EMBO journal 20:4299-4308. 578
34. Jacob NK, Stout AR, Price CM. 2004. Modulation of telomere length dynamics by the 579
subtelomeric region of tetrahymena telomeres. Molecular biology of the cell 15:3719-580
3728. 581
35. Wenkert D, Allis CD. 1984. Timing of the appearance of macronuclear-specific histone 582
variant hv1 and gene expression in developing new macronuclei of Tetrahymena 583
thermophila. The Journal of cell biology 98:2107-2117. 584
36. Nelson JD, Denisenko O, Sova P, Bomsztyk K. 2006. Fast chromatin 585
immunoprecipitation assay. Nucleic Acids Res 34:e2. 586
37. Allis CD, Colavito-Shepanski M, Gorovsky MA. 1987. Scheduled and unscheduled 587
DNA synthesis during development in conjugating Tetrahymena. Dev Biol 124:469-480. 588
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
24
38. Yin L, Gater ST, Karrer KM. 2010. A developmentally regulated gene, ASI2, is required 589
for endocycling in the macronuclear anlagen of Tetrahymena. Eukaryotic cell 9:1343-590
1353. 591
39. Nikiforov MA, Gorovsky MA, Allis CD. 2000. A novel chromodomain protein, pdd3p, 592
associates with internal eliminated sequences during macronuclear development in 593
Tetrahymena thermophila. Molecular and cellular biology 20:4128-4134. 594
40. Rexer CH, Chalker DL. 2007. Lia1p, a novel protein required during nuclear 595
differentiation for genome-wide DNA rearrangements in Tetrahymena thermophila. 596
Eukaryotic cell 6:1320-1329. 597
41. Pan WC, Blackburn EH. 1981. Single extrachromosomal ribosomal RNA gene copies 598
are synthesized during amplification of the rDNA in Tetrahymena. Cell 23:459-466. 599
42. Lewis KA, Wuttke DS. 2012. Telomerase and telomere-associated proteins: structural 600
insights into mechanism and evolution. Structure 20:28-39. 601
43. Lei M, Podell ER, Cech TR. 2004. Structure of human POT1 bound to telomeric single-602
stranded DNA provides a model for chromosome end-protection. Nature structural & 603
molecular biology 11:1223-1229. 604
44. Croy JE, Podell ER, Wuttke DS. 2006. A new model for Schizosaccharomyces pombe 605
telomere recognition: the telomeric single-stranded DNA-binding activity of Pot11-389. 606
Journal of molecular biology 361:80-93. 607
45. Smothers JF, Mizzen CA, Tubbert MM, Cook RG, Allis CD. 1997. Pdd1p associates 608
with germline-restricted chromatin and a second novel anlagen-enriched protein in 609
developmentally programmed DNA elimination structures. Development 124:4537-4545. 610
46. Taverna SD, Coyne RS, Allis CD. 2002. Methylation of histone h3 at lysine 9 targets 611
programmed DNA elimination in tetrahymena. Cell 110:701-711. 612
47. Wu L, Multani AS, He H, Cosme-Blanco W, Deng Y, Deng JM, Bachilo O, Pathak S, 613
Tahara H, Bailey SM, Deng Y, Behringer RR, Chang S. 2006. Pot1 deficiency initiates 614
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
25
DNA damage checkpoint activation and aberrant homologous recombination at 615
telomeres. Cell 126:49-62. 616
48. Hockemeyer D, Daniels JP, Takai H, de Lange T. 2006. Recent expansion of the 617
telomeric complex in rodents: Two distinct POT1 proteins protect mouse telomeres. Cell 618
126:63-77. 619
49. Surovtseva YV, Shakirov EV, Vespa L, Osbun N, Song X, Shippen DE. 2007. 620
Arabidopsis POT1 associates with the telomerase RNP and is required for telomere 621
maintenance. EMBO J 26:3653-3661. 622
50. Shakirov EV, Surovtseva YV, Osbun N, Shippen DE. 2005. The Arabidopsis Pot1 and 623
Pot2 proteins function in telomere length homeostasis and chromosome end protection. 624
Molecular and cellular biology 25:7725-7733. 625
51. Shakirov EV, Song X, Joseph JA, Shippen DE. 2009. POT1 proteins in green algae 626
and land plants: DNA-binding properties and evidence of co-evolution with telomeric 627
DNA. Nucleic Acids Res 37:7455-7467. 628
52. Cifuentes-Rojas C, Kannan K, Tseng L, Shippen DE. 2011. Two RNA subunits and 629
POT1a are components of Arabidopsis telomerase. Proceedings of the National 630
Academy of Sciences of the United States of America 108:73-78. 631
53. Bednenko J, Noto T, DeSouza LV, Siu KW, Pearlman RE, Mochizuki K, Gorovsky 632
MA. 2009. Two GW repeat proteins interact with Tetrahymena thermophila argonaute 633
and promote genome rearrangement. Molecular and cellular biology 29:5020-5030. 634
635
636
637
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
26
FIGURE LEGENDS 638
Table 1. List of oligonucleotides used in experiments. 639
640
Figure 1. Cell growth and telomere maintenance are unaffected by POT2 macronuclear 641
gene disruption. (A) Schematic of the macronuclear POT1 and POT2 gene loci and the 642
encoded proteins. Black boxes, exons; arrows, transcription start sites; grey boxes, predicted 643
OB-folds. (B) Growth curves for wild type cells (black line) and two POT2 knockout clones 644
(dashed lines). PD, population doubling. (C) Southern blot showing rDNA telomere length in wild 645
type cells (WT) and three different POT2 knockout clones (POT2 KO). The probe was to the 646
subtelomeric region of the rDNA. M indicates size markers. (D-E) Ligation and primer extension 647
assay to measure G-overhang length. (D) Top diagram illustrates the assay. Bottom diagram 648
illustrates the products expected for a 14 nt overhang. (E) Polyacrylamide gel showing reaction 649
products obtained with DNA from wild type (lane 1), POT1 KO (lane 2) or POT2 KO cells (lane 650
3). Products corresponding to overhangs of 14, 20, 26, and 32 nucleotides are marked at the 651
right; positions of the marker oligonucleotides are shown on the left. 652
653
Figure 2. Pot2 expression and localization during macronuclear development. A. Cartoon 654
depicting stages of Tetrahymena conjugation and macronuclear development. After 2-3 hours of 655
starvation cells pair and the micronuclei undergo two rounds of meiosis. Three of the four nuclei 656
are degraded and the remaining nucleus undergoes mitosis to form two haploid pronuclei. One 657
of the pronuclei is exchanged with the partner cell and the pronuclei then fuse to form a diploid 658
zygotic nucleus. After two rounds of mitosis (Anlagen I), two of the mitotic products begin to 659
develop into new macronuclei (Anlagen II) while two remain as micronuclei. The cells separate 660
and complete macronuclear development before degrading one of the new micronuclei. The 661
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
27
cells remain with one micronucleus and two macronuclei until nutrients become available at 662
which point they resume vegetative growth. (B) POT1 and POT2 mRNA expression profile. RT-663
PCR was performed with RNA collected from vegetatively growing cells (V), starved cells (S), or 664
mated cells harvested at the indicated times after the initiation of mating. Cells were re-fed after 665
24 hours and RNA was collected two hours later (26 hours). PCR with genomic DNA (G) 666
monitored DNA contamination, RT-PCR with U1 snRNA controlled for RNA quality and loading. 667
(C) Chromosome breakage analysis using the 11 kb PCR assay. The assay was performed with 668
DNA isolated at the indicated time points from the mated cells used in (B). PCR of the U1 669
snRNA gene controlled for DNA quality and loading. (D) Immunolocalization of Pot2. Cells at 670
the indicated stages in conjugation and macronuclear development were stained with Pot2 671
antibody and counterstained with DAPI. Arrow heads, micronuclei; arrows, developing 672
macronuclei; stars, parental macronuclei. 673
674
Figure 3. Pot2 localizes to sites of chromosome breakage. (A) Panel I, Representative 675
images of acridine orange stained cells showing stages of macronuclear development used for 676
scoring. Panel II, Percent of cells at the indicated stages of macronuclear development at each 677
time point. Values are the average from the three ChIP experiments shown in (B-D), error bars 678
represent S.E.M. Panel III, 11 kb PRC assay for chromosome breakage. Samples were from 679
one of the time courses used to generate data in panel II and (B-D). (B-D) ChIP analysis of 680
chromatin association throughout macronuclear development. Chromatin was collected at 8, 10, 681
12 and 14 hours after the initiation of mating. Input DNA and precipitated DNA were quantified 682
by real time PCR, n = 3 independent experiments, error bars represent S.E.M. ChIP was 683
performed with Pot2 (B), Pot1 (C) and Pdd1 (D) antibody. 684
685
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
28
Figure 4. Pot2 lacks binding specificity for CBS or telomeric DNA. Mobility shift assays 686
using purified Pot1 and Pot2 and oligonucleotides corresponding to the telomeric G-strand 687
overhang (A) or the CBS 4L-6 duplex and the two strands of CBS 4L-6 DNA (B). The bracket in 688
(A) marks DNA-protein complexes formed by a contaminant in the Pot2 preparation (see Fig. 689
S4). 690
691
Figure 5. Pat1 and Tpt1 localize to telomeres but not sites of chromosome breakage. (A) 692
mRNA expression profile for POT2, POT1, PAT1 and TPT1 during conjugation and 693
macronuclear development. RNA was collected and analyzed by RT-PCR as described for Fig. 694
2B. (B) ChIP analysis of Pat1 and Tpt1 association with CBS 4L-6, IES M-element (M-El) and 695
telomeres throughout macronuclear development. Chromatin was from the mating time courses 696
shown in Fig. 2. ChIP was with antibody to Pat1 or Tpt1, n = 3 experiments, error bars represent 697
S.E.M. 698
699
Figure 6. H3K27Me3 and H3K9Me3 do not accumulate at sites of chromosome breakage. 700
(A) ChIP analysis to detect methylated histone H3 at CBS 4L-6, IES M-element (M-El) and 701
telomeres during macronuclear development. Chromatin was from the mating time courses 702
shown in Fig. 2. ChIP was with antibody to H3K27Me3 (A) and H3K9Me3 (B), n = 3 703
experiments, error bars represent S.E.M. (B) Model showing possible roles for Pot2 in recruiting 704
the endonuclease responsible for chromosome cleavage and telomerase. MDS, macronuclear 705
destined sequence, RF, recruitment factor. 706
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
Oligo Name Sequence Used for POT2 R5 5'-CTAGTTCTCATATACATGTATTTG RT-PCR of POT2
POT2 F13 5'-TGACTACACAAATGTGCAAAGAC RT-PCR of POT2 POT1 F1 5'- GCCTTGACCCTATTCCAATG RT-PCR of POT1
POT1 R1 5' ACGTGGTGCTTTTCTCTTTCT RT-PCR of POT1
U1 snRNA F1 5'-CTTACCTGGCTGGAGTTTGCTATC RT-PCR of U1 snRNA
U1 snRNA R1 5’-GCGGAGACAGCACTAAGTGCACG RT-PCR of U1 snRNA
R3c 5'-CGCAGTTTCGCTGTTCAATA 11 kb PCR
F3 5'-CCCCAACCCCAACCCCAACCCCA 11 kb PCR
CBS 4L-6 F1 5’-TCTTTTACAAAAATTGGCTTTATTGA ChIP of CBS 4L-6
CBS 4L-6 R1 5’-TTTCAGAACACATCACCGATATTT ChIP of CBS 4L-7
CBS 3R-2 F1 5'- AACCAACCTCTTTCGACTTAGGAAT ChIP of CBS 3R-2
CBS 3R-2 R1 5'-CAGCAATCAGGAAATAACATACCAC ChIP of CBS 3R-3
IES M-El F 5’-GTGTGGTACAATAGGTTGTCGTAG ChIP of IES M-element
IES M-El R 5’-TTGAAAGCTAAGTAGCCTTCTTGC ChIP of IES M-element
26S rRNA subtel 5'GAACTTCAATCTTTGACTAGC ChIP of rDNA subtel
26S rRNA subtel 5'AATTTCTTTGACATTGAGTAAAAGTTATTTATT
ChIP of rDNA subtel
rDNA internal 5'TGAAATTGCAAGGTAGGTTTC ChIP of rDNA int
rDNA internal 5'CATAGTTACTCCCGCCGTT ChIP of rDNA int
CBS 4L-6 F 5'GAATTGCATATAAACCAACCTCTTTTTAAATATCGGTG
Pot1/Pot2 EMSA
CBS 4L-6 R 5'CACCGATATTTAAAAAGAGGTTGGTTTATATGCAATTC
Pot1/Pot2 EMSA
Tel G-strand 5'TTGGGGTTGGGGTTGGGGTT Pot1/Pot2 EMSA
Tel C 5'CCCAACCCCAACCCCAACCC Pot1/Pot2 DBD EMSA
Tel G (20) 5'GTTGGGGTTGGGGTTGGGGT Pot1/Pot2 DBD EMSA
Tel G (14) 5'GTTGGGGTTGGGGT Pot1/Pot2 DBD EMSA
Tet G (12) 5'TGGGGTTGGGGT Pot1/Pot2 DBD EMSA
CBS 20 F 5'TATAAAGAGGTTGGTTTATT Pot1/Pot2 DBD EMSA
CBS 20 R 5'AATAAACCAACCTCTTTATA Pot1/Pot2 DBD EMSA
hTel 5'GGTTAGGGTTAGGGTTAGGG Pot1/Pot2 DBD EMSA
Tel Dup G-strand 5’-GGCTTAAGC(GGGGTT)7GGGGT Pot1/Pot2 DBD EMSA
Tel Dup C-strand 5’-ACCCC(AACCCC)4GCTTAAGCC Pot1/Pot2 DBD EMSA
Cranert et al. Table 1
on May 29, 2021 by guest
http://ec.asm.org/
Dow
nloaded from