Downloaded from on April 30, 2020 by ...€¦ · 8 9 íX /Z/U v /v v ]}vo Z Z Z v/v( ]}o}P] U/v...

1

Title: Impact of currently marketed tampons and menstrual cups on Staphylococcus aureus growth 1

and TSST-1 production in vitro. 2

3

Running Title: Impact of tampons and cups on Staphylococcus aureus 4

5

Louis Nonfoux1, Myriam Chiaruzzi1, Cédric Badiou1, Jessica Baude1, Anne Tristan1,2, Jean Thioulouse4, 6

Daniel Muller3, Claire Prigent Combaret3, Gérard Lina1,2# 7

8

1. CIRI, Centre International de Recherche en Infectiologie, Inserm U1111, Université Lyon 1, Ecole 9

Normale Supérieure de Lyon, CNRS UMR 5308, Lyon, France, 10

2. Centre National de Référence des Staphylocoques, Institut des Agent infectieux, Hôpital de la Croix 11

Rousse, Hospices Civils de Lyon, Lyon, France 12

3. Université de Lyon, Université Claude Bernard Lyon 1, CNRS, INRA, VetAgro Sup, UMR Ecologie 13

Microbienne, 43 bd du 11 Novembre, F-69622 Villeurbanne, France 14

4. Université de Lyon, Université Lyon 1, CNRS, Laboratoire de Biométrie et Biologie Evolutive 15

UMR5558, F-69622 Villeurbanne, France 16

17

Corresponding author: Gerard Lina 18

CIRI INSERM U111, équipe Pathogénie des staphylocoques, Faculté de Médecine Lyon Est, site 19

Laennec, 7 Rue Guillaume Paradin, 69372 Lyon cedex 08 20

[email protected] 21

22

AEM Accepted Manuscript Posted Online 20 April 2018Appl. Environ. Microbiol. doi:10.1128/AEM.00351-18Copyright © 2018 American Society for Microbiology. All Rights Reserved.

on May 19, 2020 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

2

Abstract 23

Fifteen currently marketed intravaginal protection products (11 types of tampon and four menstrual 24

cups) were tested by the modified tampon sac method to determine their effect on Staphylococcus 25

aureus growth and toxic shock toxin 1 (TSST-1) production. Most tampons reduced S. aureus growth 26

and TSST-1 production, with differences based on brand and composition, and S. aureus growth was 27

higher in de-structured than in unaltered tampons. We observed higher S. aureus growth and toxin 28

production in menstrual cups than in tampons, potentially due to the additional air introduced to the 29

bag by cups, with differences based on cup composition and size. 30

31

Importance 32

Menstrual toxic shock syndrome is a rare but severe disease. It occurs in healthy women vaginally 33

colonized by Staphylococcus aureus producing toxic shock syndrome toxin 1 using intravaginal 34

protection such as tampons or menstrual cups. Intravaginal protection induces TSS production by 35

collecting catamenial products which act as a growth medium for S. aureus. Previous studies have 36

evaluated the impact of tampon composition on S. aureus producing toxic shock syndrome toxin 1, 37

but they are not recent and did not include menstrual cups. This study demonstrates that highly 38

reproducible results for S. aureus growth and TSST-1 production can be obtained using a simple 39

protocol that reproduces the physiological conditions of tampon and cup usage as closely as possible, 40

providing recommendations for tampon or cup use to both manufacturers and consumers. Notably, 41

our results do not show that menstrual cups are safer than tampons and suggest that they require 42

similar precautions. 43

44

45

Keywords: Tampon, menstrual cup, Staphylococcus aureus, Toxic shock syndrome toxin 1, biofilm 46

47


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

3

Introduction 48

Toxic shock syndrome (TSS) is a rare but severe disease characterized by fever, hypotension, a skin 49

rash with subsequent desquamation, and multiple organ dysfunctions (1). It can occur in healthy 50

menstruating women using intravaginal protection such as tampons or menstrual cups and colonized 51

by Staphylococcus aureus producing the toxic shock syndrome toxin (TSST-1) (2-5). Intravaginal 52

protection-induced TSS is linked to the potential ability of the colonizing S. aureus strain to use the 53

catamenial products collected in the tampon or cup as a growth medium and proliferate (6). S. 54

aureus produces TSST-1 when it reaches a threshold concentration, which then gains access to the 55

bloodstream and induces the systemic illness (7,8). 56

S. aureus tightly regulates TSST-1 production by several systems, such as the quorum sensing system 57

Agr. Its production is additionally affected by physical and chemical factors such as oxygen, carbon 58

dioxide and divalent cation concentration, pH, and temperature by other two component sensor 59

systems such as SaeRS and SrrAB (9-12). 60

Menstrual TSS was initially described in women using tampons made of high-absorbency fibers 61

composed of carboxymethylcelllulose and polyester, which favoured S. aureus growth and TSST-1 62

production (13). Although carboxymethylcelllulose and polyester fibers are no longer used, the 63

disease continues to occur in menstruating women using currently marketed tampons made of 64

cotton, viscose, and rayon (14), and a case of menstrual TSS was also described in a woman using a 65

silicone menstrual cup (5). 66

Previous studies have investigated whether tampons made of cotton or rayon affect S. aureus 67

growth and TSST-1 production using bacterial cultivation with or without the addition of tampons, 68

and found that none of them amplified TSST-1 production (15-20). However, these reports are 69

several decades old and the experimental conditions were generally quite different from typical 70

tampon use, sometimes including sterilization of the tampons before the experiment, a volume of 71

broth medium exceeding both tampon absorption capacity and normal menstrual flow volume, 72

longer incubation times, or incubation without oxygen limitation in accordance with vaginal gas 73


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

4

conditions. Tampon composition may have changed over time, for example with the introduction of 74

viscose. Most importantly, tampon use continues to be associated with menstrual TSS and a case of 75

menstrual TSS has been described associated with a silicone menstrual cup, calling the effect of 76

menstrual cups on S. aureus growth and TSST-1 production into question (5,14). 77

78

The aim of this study was to re-evaluate the impact of currently marketed tampons and menstrual 79

cups on S. aureus growth and TSST-1 production using experimental conditions close to typical 80

tampon and cup usage, without tampon sterilization and with an appropriate amount of broth 81

medium and oxygen access. 82

83

Material and methods 84

Strains 85

S. aureus strain ST20140321 was isolated from the tampon of a patient with menstrual TSS in 2014. 86

The strain was genotyped using diagnostic DNA microarrays and identibac S. aureus Genotyping® 87

(Alere), as described (21). It is classified as an agr3, methicillin sensitive, complex clonal 30, TSST-1 88

producing strain. 89

We used the pACL1484 plasmid (Table 1) for the construction of the GFP-ST20140321 S. aureus strain 90

(LUG2902). pACL1484 is a pSK236-derived shuttle plasmid containing the gene encoding GFPuvr, a 91

derivative of the GFPuv gene (22). The PCR primers used to clone the S. aureus 16S rRNA gene 92

promoter in pALC1484 are listed in Table 1. Chromosomal DNA from S. aureus strain SH1000 was 93

used as the PCR template and amplified regions were ligated into the EcoR1 and XbaI sites of 94

pALC1484. The plasmid was then introduced into S. aureus RN4220 by electroporation (23), and 95

chloramphenicol-resistant colonies were selected before the plasmid was transferred into S. aureus 96

strain SH1000 (24) and to clinical S. aureus ST20140321 via standard electroporation or transduction 97

techniques (25). 98


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

5

Tampons and menstrual cups 99

Eleven types of tampons manufactured by Tampax®, Nett®, OB®, and Natracare® and four types of 100

menstrual cups manufactured by be’Cup® and Me Luna® were purchased from supermarkets. 101

Tampax compak® Regular and Super plus are made of rayon and cotton, Natracare® Régulier and 102

Super plus are made of cotton, Nett® ProComfort® Nuit super, Normal, and Super plus are made of 103

viscose, and OB® ProComfort® light days, Super, Normal, and Super plus are made of cotton and 104

viscose. Tampon absorbency was determined by measuring weight gain after an 8h incubation in 100 105

mL of sterile water and is summarized in Table 2. Applicators and plastic wrappers were removed 106

with sterile gloves before the experiment. The be’Cup® (size 1 and size 2) menstrual cups were made 107

of silicone and the Me Luna® cups were made of thermoplastic elastomer (TPE; Classic model, size S 108

and M). They were pre-treated by sequential ebullition for 3 and 7 min, as advised by the 109

manufacturers. 110

Experimental procedure 111

We used the tampon sac method described by Reiser et al., with several modifications (26). Tampons 112

and menstrual cups were inserted into 532 mL sterile plastic bags (Whirl Pak®) using sterile gloves 113

followed by the addition of 15 mL of either Brain Heart Infusion (BHI) (Difco) alone or BHI solution 114

with 105 CFU/mL of S. aureus strain LUG2902. Excess air introduced during the insertion of the 115

tampon or cup into the bags was removed by manual deflation and the bags were then hermetically 116

sealed. The bags were incubated vertically at 37°C with shaking (200 rpm) for 8h. BHI solution 117

inoculated with 105 CFU/mL S. aureus ST20140321 was also incubated in the same conditions without 118

tampons or menstrual cups as a positive control. 4 mL of solution was sampled from the plastic bag 119

at the end of the incubation. Tampons were kneaded within the bag for 5 seconds and the fluid was 120

expressed by compression of the tampon and collected for bacterial and toxin quantification as 121

described below. 122


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

6

BHI was also incubated with each tampon for 8h at 37°C with shaking (200 rpm) to determine 123

whether the tampons or cups released molecules. Tampons were then kneaded within the bag for 5 124

seconds and BHI was recovered from tampon by compression. The pre-incubated BHI broth, 125

denominated BHI-T, were sterilized by filtration (0.22 μm Micropore) and conserved at 4°C before 126

being used as culture medium for LUG2902 S. aureus in microplates. 180μL of BHI-T from each 127

tampon was inoculated with 20μL of LUG2902 (107 CFU/mL). Plates were incubated for 8h at 37°C in 128

SPARK 10M, and Tecan® and absorbances were observed every 10 min at λ =600nm. The amount of 129

S. aureus and TSST-1 was quantified as described below. 130

To examine the impact of specific fibers, tampons were deconstructed under sterile conditions by 131

laceration with a sterile scalpel before use as described below. 132

To examine the impact of the composition of menstrual cup, cups were cut in section of 1X1.5 cm 133

under sterile condition with a sterile scalpel before use as described below. 134

Each cup was inserted in the vertical position in a sterile plastic bag to examine biofilm formation. 15 135

mL of either BHI or BHI with 105 CFU/mL ST20140321 of S. aureus were put into the cavities of the 136

cups, excess air was removed by manual deflation, and the bags were hermetically sealed. The plastic 137

bags were then incubated vertically at 37°C without shaking for 8h, and the bacterial solution was 138

harvested for bacterial and toxin quantification at the end of the incubation. Cups were washed 3 139

times with 300 mL Phosphate Buffer Saline (PBS) (Difco) before sonication in 150 mL of PBS for 10 140

min at 100% using the BactoSonic (BANDELIN Electronics), and the number of S. aureus released by 141

sonication was quantified as described below. 142

S. aureus and TSST-1 quantification 143

The number of bacteria in diverse solutions was estimated by flow cytometry using an Accuri C6 Flow 144

Cytometer (BD Biosciences) following the manufacturer’s recommendations. The concentration was 145

confirmed by the inoculation of a trypticase soy agar (TSA, Difco) plate using the easySpiral ® 146


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

7

automatic plater (Interscience), and the exact number of CFU was determined with the Scan1200® 147

automatic colony counter (Interscience) after 24 h of incubation at 37°C in an aerobic atmosphere. 148

TSST-1 in the supernatant was quantified by a specific enzyme-linked immunosorbent assay (ELISA; 149

Toxin Technology) as recommended by the manufacturer. 150

Observation of the S. aureus colonization of tampon fibers and menstrual cups by confocal 151

microscopy 152

Tampons of each brand were by laceration with a sterile scalpel . A piece of approximately 0.5 cm3 of 153

each fiber were incubated inside the wells of a 24-well plate (Falcon) in the presence of 1mL of a 154

standardized cell suspension 107 CFU/mL of S. aureus LUG2902 in BHI. After 2, 4, 6, 8, and 24h of 155

incubation without agitation, the fibers were washed 5 times with 2 ml of PBS and mounted on glass 156

slides in the presence of Aqua-Poly/Mount mounting medium (Polysciences Inc., Warrington, PA). 157

Sections of 1X1.5 cm of Be’cup size 1 made of silicone and Meluna size S made of in TPE seal were 158

mechanically attached to the bottom of wells of 24-well plate (Falcon) before been incubated with 159

3 mL of a standardized suspension of S. aureus LUG2902 (107 CFU/mL) in BHI. After 2, 4, 6, 8h of 160

incubation without agitation, pieces of cup were recovered, washed 5 times with 5 ml of PBS and 161

mounted on glass slides in the presence of Aqua-Poly/Mount mounting medium. 162

Images were acquired with a Zeiss® LSM 800 confocal microscope (Zeiss, Oberkochen, Germany) 163

using an 40x oil objective. Fibers (pseudocolored red) were observed using 405 nm as the excitation 164

wavelength and 400-570 nm as the emission wavelengths, and GFP-S. aureus (pseudocolored green) 165

was visualized using 488nm as the excitation wavelength and 504-555 nm as the emission 166

wavelengths. Z-stacks were acquired using 1μm-serial optical sections and images were merged 167

using the ZEN®V2.3 software package. 168

Statistical analysis 169

The data were analyzed using SPSS version 12.0. Bacterial CFUs and TSST-1 concentrations between 170


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

8

groups were compared by Student’s t-test. The Spearman correlation was used to evaluate the 171

relationship between continuous variables such as TSST-1, S. aureus CFU and tampon absorbency 172

volumes. 173

174

Results 175

Impact of tampons and cups on S. aureus growth 176

A calibrated suspension of S. aureus was cultivated during 8 h in BHI broth at 37°C inside sterile 177

plastic bags, in the presence or absence of a tampon or cup to determine whether tampons and cups 178

affect S. aureus growth (Table 2 and 3). The bacterial solution was collected for bacterial 179

quantification using both a flow cytometer and plate spreading followed by enumeration with an 180

automatic colony counter at the end of the incubation. No aerobic growth was observed in BHI after 181

8h of incubation with any tampon or menstrual cup in the absence of S. aureus inoculation. 182

Tampons and cups affect S. aureus growth as shown in Tables 2 and 3. S. aureus growth was lower 183

than the positive control in the presence of tampons, with final bacterial concentrations ranging 184

from 7.9 x 106 ± 3 x 106 CFU/mL to 8.2 x 108 ± 3 x 108 CFU/mL versus 2.5 x 109 ± 0.2 x 109 CFU/mL with 185

the positive control. S. aureus growth was not statistically correlated with tampon absorbance, but 186

S. aureus behavior varied significantly as function of tampon composition. S. aureus growth was 187

lower with tampons composed of a mix of rayon and cotton than with those composed of viscose 188

with or without the addition of cotton or cotton alone (P<0.001). S. aureus growth was equivalent 189

with tampons made of viscose or a mix of viscose and cotton, and lower than with tampons made of 190

cotton alone (P<0.001). 191

In the presence of menstrual cups, S. aureus growth was close to the positive control but statistically 192

different, with final bacterial concentrations ranging from 5.7 x 108 ± 4 x 108 CFU/mL to 4.4 x 109 ± 1.1 193

x 109 CFU/mL control (p<0.05). S. aureus growth was significantly lower with cups made from TPE 194


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

9

than with those made from silicone (P<0.001). 195

Impact of tampons and cups on TSST-1 production by S. aureus 196

TSST-1 was also quantified in S. aureus growth supernatant in the absence or presence of tampons or 197

cups (Tables 2 and 3). TSST-1 production ranged from 0.1 to 70.5 ± 7.5 μg/ml in the presence of 198

tampons, while the control was 73.9 ± 8.5 μg/ml. TSST-1 production was significantly lower in the 199

presence of tampons than the control (P<0.001), except with one tampon made of cotton (Natracare 200

Super plus®). TSST-1 production in the presence of tampons made of viscose alone or a mix of cotton 201

and rayon was similar, and lower than that in the presence of tampons made with a mix of cotton 202

and viscose (p<0.001). The production of TSST-1 with these 3 tampon compositions was also 203

significantly lower than that in the presence of tampons made of cotton alone (p<0.001). We 204

observed a strong correlation between TSST-1 production and S. aureus growth (p<0.001). 205

In contrast to tampons, TSST-1 production was increased in the presence of 3 of the 4 cups tested 206

(87.3 ± 4.1 to 108.7 ± 23.2 μg/ml versus 73.9 ± 8.5 μg/ml), both TPE cups (P<0.05) and one of the two 207

silicon cups. TSST-1 production in the other silicone cup (be’Cup® size 1, 50.6 ± 8.5 μg/ml) was lower 208

than that seen in the control (P=0.03). TSST-1 increased with the size of the cup, and the production 209

of TSST-1 significantly increased with S. aureus growth (P=0.001). 210

The search for molecules interfering with S. aureus in tampons and menstrual cups 211

To understand how tampon composition and menstrual cups modify S. aureus growth and TSST-1 212

production, we first examined whether tampons or cups released molecules that could interfere with 213

S. aureus. Tampons and cups were incubated in BHI for 8h at 37°C before removal, and the pre-214

incubated BHI broth (BHI-T) was used as the template for this experiment. We compared S. aureus 215

growth and TSST-1 production in BHI and BHI-T and found no difference in S. aureus growth and 216

TSST-1 production with the use of any tampon or menstrual cup during the pre-incubation (data not 217

shown). These results suggest that tampons and cups do not release molecules that significantly 218


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

10

interfere with S. aureus. 219

Does tampon structure modify S. aureus growth and TSST-1 production? 220

Since Tierno et al. suggested that structure of tampons may impact S. aureus growth and TSST-1 221

production (18), we examined the impact of tampon structure on S. aureus growth and TSST-1 222

production after determining that tampons and cups do not release any inhibiting molecules. 223

Tampons composed of rayon and cotton (Tampax compak® Super plus), viscose and cotton (OB® 224

ProComfort® Super plus), viscose alone (Nett® PROCOMFORT Normal), and cotton alone (Natracare®, 225

Regular) were deconstructed with a sterile scalpel in sterile plates. Deconstructed and unaltered 226

tampons were placed in plastic bags and incubated with S. aureus as described below. S. aureus 227

growth was again significantly inhibited by the presence of each of the four unaltered tampons 228

(structured), regardless of composition (p<0.001) as well as by the deconstructed tampons (p<0.001) 229

(Figure 1). Interestingly, S. aureus growth was significantly higher in deconstructed than unaltered 230

tampons if they were composed of cotton and rayon (3 folds, p=0,04) or cotton and viscose (16 folds, 231

p=0.01) but not in tampons made of cotton or viscose alone. 232

Similar results were observed for TSST-1 production. TSST-1 production was higher in deconstructed 233

than unaltered tampons (p<0.001), and was 7 times higher in mixed cotton and rayon tampons, 4 234

times higher in cotton tampons, 54 times higher in viscose tampons, and 21 times higher in mixed 235

cotton and viscose tampons. 236

Tampon composition modifies S. aureus growth and TSST-1 production 237

We observed that S. aureus growth and toxin production was inhibited in the presence of tampon 238

fibers in the deconstructed samples, varying according to the nature of the fibers (Figure 1). S. aureus 239

inhibition was highest in the presence of mixed cotton and rayon fibers, followed by mixed cotton 240

and viscose, viscose alone, and cotton alone. 241

We investigated the interactions of GFP-labelled S. aureus cells with tampon fibers using confocal 242

microscopy (Figure 2). We selected 4 types of tampon composed of different fibers: mixed rayon and 243


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

11

cotton (Tampax compak® Super plus), mixed viscose and cotton (OB® ProComfort® Super plus), 244

cotton alone (Natracare®, Super plus) and viscose alone (Nett® PROCOMFORT Super plus). S. aureus 245

colonized the tampon fibers to varying degrees, depending on the incubation time and the nature of 246

fibers. Higher colonization of tampon fibers was seen at short incubation times (2 and 4 hours) 247

compared to longer incubations (6, 8 and 24 h). However, heterogeneous adhesion was seen 248

between S. aureus and fibers, and no strong differences in colonization level by S. aureus was 249

observed between the fibers of the different tampons (Figure 2). 250

Does cup composition modifies S. aureus growth and TSST-1 production ? 251

We quantified biofilm formation to understand how S. aureus growth and TSST-1 production were 252

affected by cup composition. Silicone and TPE menstrual cups (be’Cup® size 2 (silicone), and Me 253

Luna® size S (TPE)) were inserted vertically in sterile bags and used as S. aureus growth recipients for 254

8 hours at 37°C in static conditions. We then quantified bacteria in the growth medium (i.e. 255

planktonic cells) and in the biofilm formed at the surface of the cup after disruption by sonication 256

(Figure 3). S. aureus growth and TSST-1 production were significantly lower in static conditions than 257

with shaking (Table 3; p≤0.002) for the control and the two cups. In static conditions, the total 258

number of S. aureus was not significantly different between either of the two cups and the control. 259

Interestingly, the number of S. aureus biofilm was higher in the silicone be’Cup® size 2 than in the 260

TPE Me Luna®. Microscopy analysis of GFP-labelled S. aureus interaction with sections of cups on the 261

showed that S. aureus biofilm was more developed at 4, 6 and 8 hours with cup made of silicone 262

than with those made of TPE, with more fluorescent bacteria on the surface and a thicker biofilm 263

(Figure 4). 264

In static conditions, TSST-1 production in the presence of both the be’Cup® and Me Luna® menstrual 265

cups was significantly lower than in the control (Figure 3, p=0.045 and p<0.001, respectively). TSST-1 266

was also significantly lower in the presence of the Me Luna® (TPE) than the be’Cup® (Silicone) (Figure 267

3; p=0.002). Since shape of menstrual cup Me Luna® and the be’Cup® s were not identical, it 268


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

12

remained unclear if difference of volume of air or in composition of these menstrual cup was 269

responsible for the variation of TSST-1 production. Thus Be’cup® size 1 made of silicone and Me 270

Luna®a size S made of in TPE were cut in sections of 1X1.5 cm before the experiments in sac method 271

with shaking (Figure 5). Interestingly, bacterial growth was significantly affected by alteration of the 272

two models of cup. S. aureus growth was higher with sections of cups than with native cups (1.9 X 273

with Be’cup® and X1.5 with Me Luna®). We suspect that presence of sections increased the shaking 274

of the medium and favoured S. aureus growth. Since toxins production depended to the bacterial 275

concentration, ratio of toxin/ CFU of bacteria was used to compare the effect of cup alteration. Ratio 276

toxin/CFU was similar with the two models of cup with unaltered cup and sections of cups. 277

Moreover, when the cup was cut in sections ratio toxin/CFU decrease dramatically compared to 278

unaltered cup. Our results suggested that aeration more than composition of cup influences toxin 279

production. 280

281

Discussion 282

Menstrual TSS is a rare but severe disease that occurs in women using intravaginal protection such as 283

tampons or menstrual cups who are vaginally colonized by S. aureus producing TSST-1 (2-5). 284

Intravaginal protection promotes menstrual TSS indirectly by collecting catamenial products which 285

can act as a growth medium for S. aureus present in the vagina with favorable temperature, 286

atmospheric (oxygen), and acidic pH neutralization conditions (6,9,10). The historical association 287

between one tampon brand with a unique chemical composition and menstrual TSS and in vitro 288

experiments has highlighted the direct impact tampons can have on S. aureus proliferation and TSST-289

1 production (13). The aim of this study was to re-examine the impact of currently marketed 290

tampons and menstrual cups on S. aureus growth and TSST-1 production in vitro. 291

We designed novel experimental conditions inspired by the tampon sac method described by Reiser 292

et al. (26) including non-sterilized tampons, sterile hermetic bags manually deflated to limited the air 293

introduced with the product, and a volume of broth medium limited to 15 ml that could be entirely 294


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

13

absorbed by each tampon and allow for an 8 hour incubation (the manufacturers recommend 295

against using the products for more than 8 hours). Under these experimental conditions, designed to 296

be simple while reproducing as much of the physiological conditions of tampon and cup use as 297

possible, we obtained highly reproducible results for S. aureus growth and TSST-1 production. We 298

believe that our method meets the standards required for such an investigation. 299

Using this procedure, we found that TSST-1 production correlated with S. aureus growth, all tampons 300

tested inhibited S. aureus growth, and most of them reduced TSST-1 production. Only one cotton 301

tampon did not influence TSST-1 production, and none enhanced S. aureus growth and TSST-1 302

production as seen previously using carboxymethylcelllulose and polyester tampons (6,20,27). Our 303

results were in agreement with previous reports (15-20), and we observed varying impacts of 304

tampon brand and model on S. aureus behaviors. Schematically, the addition of tampons composed 305

of cotton (Natracare®) to the S. aureus in broth medium has little impact on bacterial growth and 306

TSST-1 production, while the addition of viscose (Nett®), mixed cotton and rayon (Tampax®), or 307

mixed cotton and viscose (OB®) tampons inhibited S. aureus growth and TSST-1 production more 308

effectively. Our results did not support the hypothesis of Tierno et al., suggesting that tampons 309

composed exclusively of cotton could be intrinsically safer than those made of mixed cotton and 310

rayon or viscose or tampons composed exclusively of viscose as previously observed (16, 18). 311

The observed differences between tampon brands could not be explained by contaminant or 312

additive molecules released from the tampons that could interfere with S. aureus during the 313

experiments. Confocal analysis revealed little interaction between S. aureus and cotton tampon 314

fibers, with clusters of staphylococci seen in contact with fibers during the early timepoints (2 to 4 315

hours) that later disappeared. This observation suggests that S. aureus is not able to produce stable 316

biofilm in contact to the four types of fibers tested (cotton, viscose, or mixed cotton and rayon or 317

cotton and viscose). Interestingly, the differences observed between tampons persist but 318

dramatically decrease when the tampons are deconstructed. This suggests that in addition to the 319

nature of the fiber with the possible presence of additive products not dissociable from them (with 320


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

14

the exception of carboxymethylcelllulose), the structure of the tampon and possibly the fiber density 321

have major impacts on S. aureus growth and TSST-1 production. The space between the fibers in the 322

tampon may contribute to the intake of air in the vagina, and could represent the major site of S. 323

aureus growth and toxin production, as previously suggested (15,28). Long tampon carriage may also 324

alter the structure in a manner favoring S. aureus growth and TSST-1 production, advocating for 325

short use time and frequent changing. 326

We also examined the impact of menstrual cups on S. aureus growth and TSST-1 production using 327

the same experimental procedure, and observed higher S. aureus growth and toxin production with 328

cups than with tampons. We suspect that this difference may be explained by the experimental 329

procedure, specifically that a higher volume of air was inserted in the bag with cups than with 330

tampons due to their shape, known to favor S. aureus growth and TSST-1 production (9,10). 331

This was confirmed by the significant increase in S. aureus growth and TSST-1 production observed 332

with larger models of cup, regardless of the brand or composition. Interestingly, when the incubation 333

was performed with shaking, S. aureus growth was higher in the presence of the silicone be’Cup® cup 334

than the TPE Me Luna® cup, but the opposite result was found for TSST-1 production. When the 335

incubation was performed without shaking, a similar total number of S. aureus was observed with 336

silicone or TPE cups and the control. However, biofilm and TSST-1 production was higher with the 337

silicone be’Cup® than the TPE Me Luna® cup. Oxygen permeability of silicone compared to TPE may 338

explain the difference (29). It was confirmed for the biofilm formation by confocal microscopy using 339

section of cups. Additionally, to differentiate the respective role shape and composition of menstrual 340

cups that both differs between the two brands, we repeated sac method experiments with sections 341

cut from the different cups. With these sections, we were able to totally deflate the plastic bag fill 342

with sections of cup and did not observed difference of TSST-1 production between cup anymore. 343

Our results suggest that aeration like to the shape and volume of the cup more than composition of 344

cup influences toxin production. While our results with the cups were obtained with in vitro 345

experiments, they suggest some indications for cup use. Our results show that the menstrual cup is a 346


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

15

risk factor for menstrual toxic shock syndrome. When it is possible small size of menstrual cup should 347

be recommended. Air inserted in the vagina along with the cup may favor S. aureus growth and TSST-348

1 production in the catamenial products collected in the cup. When the volume of menstrual fluid 349

exceeds that of the cup receptacle, the TSST-1 produced in the fluid is in contact with the vaginal 350

mucosa, allowing toxin transcytosis into the blood and the development of menstrual toxic shock 351

syndrome. Time-based advice on cup emptying and removal should be modulated with the volume 352

of menstrual loss (30). 353

Additionally, a significant remaining biofilm of S. aureus was detected after 8 hours and 3 washes 354

with water, regardless of cup model or composition. Manual instructions of menstrual cup indicate 355

that the cup could be removed, emptied, and rinsed with tap water before being re-inserted, but our 356

results suggest that women may reinsert a contaminated cup when following this advice. A protocol 357

including a second cup that allows for cup sterilization by boiling between uses should be 358

recommended. 359

In conclusion, we showed that none of the cotton, viscose, or mixed cotton and rayon or cotton and 360

viscose tampons enhance in vitro S. aureus growth and toxin production, using a new method for 361

bacterial cultivation in the presence of intravaginal protection that reproduces physiological 362

conditions. Some of them even decrease S. aureus growth and toxin production by a mechanism that 363

seems unrelated to the release of molecules from the tampon. We observed a slight increase of S. 364

aureus growth and toxin production with menstrual cups, due to the introduction of a higher volume 365

of air than that occurring with tampons in our in vitro system. Use of small size of cup should be 366

advised to limit this effect. Additionally, S. aureus forms a compact biofilm in contact of cup, resistant 367

to simple washes with water. Boiling menstrual cup between uses of cup should be recommended. 368

Both intravaginal devices appear to be risk factors for the development of menstrual toxic shock 369

syndrome and precautions should be advised. 370

371

372


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

16

Funding 373

This work was supported by the LABEX ECOFECT (ANR-11-LABX-0048) of Université de Lyon within 374

the programme "Investissements d'Avenir" (ANR-11-IDEX-0007) operated by the French National 375

Research Agency (ANR) and FINOVI foundation. 376

377

Acknowledgements 378

We are grateful to the members of the Centre national de Référence des Staphylocoques and Isaline 379

Jacquemond for fruitful comments and technical help. 380

381

References 382

1. Stevens D. 1996. The toxic shock syndromes. Infect. Dis. Clin. North. Am. 10:727-746. 383

2. Shands K, Schmid G, Dan B, Blum D, Guidotti R, Hargrett N, Anderson R, Hill D, Broome C, 384

Band J, Fraser D. 1980. Toxic-shock syndrome in menstruating women: association with 385

tampon use and Staphylococcus aureus and clinical features in 52 cases. N. Engl. J. Med. 386

303:1436-1442. 387

3. Bergdoll M, Crass B, Reiser R, Robbins R, Davis J. 1981. A new staphylococcal enterotoxin, 388

enterotoxin F, associated with toxic-shock-syndrome Staphylococcus aureus isolates. Lancet. 389

1:1017-1021. 390

4. Schlievert P, Shands K, Dan B, Schmid G, Nishimura R. 1981. Identification and 391

characterization of an exotoxin from Staphylococcus aureus associated with toxic-shock 392

syndrome. J. Infect. Dis. 143:509-516. 393

5. Mitchell M, Bisch S, Arntfield S, Hosseini-Moghaddam S. 2015. A confirmed case of toxic 394

shock syndrome associated with the use of a menstrual cup. Can. J. Infect. Dis. Med. 395


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

17

Microbiol. 26:218-220. 396

6. Melish M, Murata S, Fukunaga C, Frogner K, McKissick C. 1989. Vaginal tampon model for 397

toxic shock syndrome. Rev. Infect. Dis. 1 Suppl 1:S238-246. 398

7. Sarafian S, Morse S. 1987. Environmental factors affecting toxic shock syndrome toxin-1 399

(TSST-1) synthesis. J. Med. Microbiol. 24:75-78. 400

8. Davis C, Kremer M, Schlievert P, Squier C. 2003. Penetration of toxic shock syndrome toxin-1 401

across porcine vaginal mucosa ex vivo: permeability characteristics, toxin distribution, and 402

tissue damage. Am. J. Obstet. Gynecol. 189:1785-1791. 403

9. Recsei P, Kreiswirth B, O'Reilly M, Schlievert P, Gruss A, Novick R. 1986. Regulation of 404

exoprotein gene expression in Staphylococcus aureus by agr. Mol. Gen. Genet. 202:58-61. 405

10. Todd J, Todd B, Franco-Buff A, Smith C, Lawellin D. 1987. Influence of focal growth 406

conditions on the pathogenesis of toxic shock syndrome. J. Infect. Dis. 155: 673-81. 407

11. Baroja M, Herfst C, Kasper K, Xu S, Gillett D, Li J, Reid G, McCormick J. 2016. The SaeRS Two-408

Component System Is a Direct and Dominant Transcriptional Activator of Toxic Shock 409

Syndrome Toxin 1 in Staphylococcus aureus. J. Bacteriol. 198:2732-2742. 410

12. Pragman A, Ji Y, Schlievert P. 2007. Repression of Staphylococcus aureus SrrAB using 411

inducible antisense srrA alters growth and virulence factor transcript levels. Biochemistry. 412

46:314-321. 413

13. Kehrberg M, Latham R, Haslam B, Hightower A, Tanner M, Jacobson J, Barbour A, Noble V, 414

Smith C. 1981. Risk factors for staphylococcal toxic-shock syndrome. Am. J. Epidemiol. 415

114:873-879. 416

14. DeVries A, Lesher L, Schlievert P, Rogers T, Villaume L, Danila R, Lynfield R. 2011. 417

Staphylococcal toxic shock syndrome 2000-2006: epidemiology, clinical features, and 418

molecular characteristics. PLoS. One. 6:e22997. 419

15. Robbins R, Reiser R, Hehl G, Bergdoll M. 1987. Production of toxic shock syndrome toxin 1 420

by Staphylococcus aureus as determined by tampon disk-membrane-agar method. J. Clin. 421


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

18

Microbiol. 25:1446-1449. 422

16. Reiser R, Hinzman S, Bergdoll M. 1987. Production of toxic shock syndrome toxin 1 by 423

Staphylococcus aureus restricted to endogenous air in tampons. J. Clin. Microbiol. 25:1450-424

1452. 425

17. Fischetti V, Chapman F, Kakani R, James J, Grun E, Zabriskie J. 1989. Role of air in growth 426

and production of toxic shock syndrome toxin 1 by Staphylococcus aureus in experimental 427

cotton and rayon tampons. Rev. Infect. Dis. 11 Suppl 1:S176-181. 428

18. Tierno P, Hanna B. 1994. Propensity of tampons and barrier contraceptives to amplify 429

Staphylococcus aureus Toxic shock syndrome toxin-I. Infect Dis Obstet Gynecol 2:140-145. 430

19. Schlievert P. 1995. Comparison of cotton and cotton/rayon tampons for effect on production 431

of toxic shock syndrome toxin. J. Infect. Dis. 172:1112-1114. 432

20. Parsonnet J, Modern P, Giacobbe K. 1996. Effect of tampon composition on production of 433

toxic shock syndrome toxin-1 by Staphylococcus aureus in vitro. J. Infect. Dis. 173:98-103. 434

21. Monecke S, Luedicke C, Slickers P, Ehricht R. 2009. Molecular epidemiology of 435

Staphylococcus aureus in asymptomatic carriers. Eur. J. Clin. Microbiol. Infect. Dis. 28:1159–436

1165. 437

22. Wolz C, Pöhlmann-Dietze P, Steinhuber A, Chien Y, Manna A, van Wamel W, Cheung A. 438

2000. Agr-independent regulation of fibronectin-binding protein(s) by the regulatory locus 439

sar in Staphylococcus aureus. Mol. Microbiol. 36:230-243. 440

23. Kreiswirth B, Löfdahl S, Betley M, O'Reilly M, Schlievert P, Bergdoll M, Novick R. 1983. The 441

toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. 442

Nature. 305:709-712. 443

24. Horsburgh M, Aish J, White I, Shaw L, Lithgow J, Foster S. 2002. SigmaB modulates virulence 444

determinant expression and stress resistance: characterization of a functional rsbU strain 445

derived from Staphylococcus aureus 8325-4. J. Bacteriol. 184:5457-5467. 446

25. Schenk S, Laddaga R. 1992. Improved method for electroporation of Staphylococcus aureus. 447


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

19

FEMS. Microbiol. Lett. 73:133-138. 448

26. Reiser R, Denzin L, Bergdoll M. 1988. Effects of blood and different media on the production 449

of toxic shock syndrome toxin 1 by Staphylococcus aureus in the tampon sac method. J. Clin. 450

Microbiol. 26:2672-2674. 451

27. Wong A, Downs S. 1989. Investigation by improved syringe method of effect of tampons on 452

production in vitro of toxic shock syndrome toxin 1 by Staphylococcus aureus. J. Clin. 453

Microbiol. 27:2482-2487. 454

28. Schlievert P, Nemeth K, Davis C, Peterson M, Jones B. 2010 Staphylococcus aureus exotoxins 455

are present in vivo in tampons. Clin. Vaccine. Immunol. 17:722-727. 456

29. Massey LK. 2003. Permeability properties of plastics and elastomers. A guide to packaging 457

and barrier materials. 2nd Ed. Plastic Design Library/Willam Andrew Publishing, Norwich, NY. 458

30. Fraser I, Warner P, Marantos P. 2001. Estimating menstrual blood loss in women with 459

normal and excessive menstrual fluid volume. Obstet. Gynecol. 8:806-814. 460

461

Table 1. Plasmids and primers used for GFP labelling S. aureus strain LUG2902. 462

Plasmids and primers Description Source

Plasmids

pACL1484 Promoterless gfpuvr shuttle vector A. Cheung

pLUG1283 16S rRNA gene promoter cloned into EcoRI-XbaI site of

pACL1484

This study

Primers

P16s-for- EcoRI CGGAATTCAGCGTAAGGAATTACACTTT This study

P16s-rev- XbaI GCTCTAGATGATGTTTGATTAGCTCATAAATAC This study

Restriction site is underlined. 463


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

20

Table 2. Physico-chemical characteristics of the tampons and their effects on S. aureus growth and 464

TSST-1 production. 465

Product Composition

Tampon

Absorbency

*

(mL)

S. aureus bacterial counts TSST-1 concentration

(cfu/mL) P

value*

(ng/mL) P value*

Positive

Control

Medium

alone - - 2.5 109 ± 0.2 109

-

73.9 ± 8.5

-

Tampons

Tampax

compak®

Régulier

Cotton and

rayon 26.2 ± 1.2 3.2 107 ± 2 107 <0.001

0.1 ± 0 <0.001

Super plus

Cotton and

rayon 40.6 ± 0.3 7.9 106 ± 3 106 <0.001

1.4 ± 0.3 <0.001

Natracare®

Régulier Cotton 28.2 ± 1.2 8.2 108 ± 3 108 <0.001 17.9 ± 3.1 <0.001

Super plus Cotton 36.1 ± 1.1 7.4 108 ± 5 108 <0.001 70.5 ± 7.5 NS

Nett®

PROCOMFO

RT

Nuit super Viscose 25.3 ± 0.3 1.7 108 ± 0.7 108 <0.001 1.3 ± 0.7 <0.001

Normal Viscose 21.9 ± 0.2 1.9 108 ± 1 108 <0.001 0.7 ± 0.2 <0.001


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

21

Super plus Viscose 34.4 ± 0.5 1.0 108 ± 0.4 108 <0.001 0.7 ± 0.2 <0.001

OB®

ProComfort®

Light days

Cotton and

viscose 18,1 ± 1.2 2.1 108 ± 0.6 108 <0.001

0.8 ± 0.1 <0.001

Super

Cotton and

viscose 30.5 ± 1.5 1.1 108 ± 0.6 108 <0.001

2.1 ± 1.0 <0.001

Normal

Cotton and

viscose 25.2 ± 1.2 3.2 108 ± 1 108 <0.001

2.5 ± 1.3 <0.001

Super plus

Cotton and

viscose 35.7 ± 0.5 1.1 108 ± 0.6 108 <0.001

1.8 ± 0.8 <0.001

Values are means ± standard deviation (n=3 to 8). Student’s t-tests were used to compare bacterial 466

CFUs and TSST-1 concentrations in the presence of tampons to the control. 467

468

469

470

471

472

473

474

475

476


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

22

Table 3. Characteristics of menstrual cups and their effects on S. aureus growth and TSST-1 477

production. 478

Product Composition

(diameter

/ height;

cm)

S. aureus bacterial counts TSST-1 concentration

(CFU/mL) P value*

(ng/mL) P value*

Positive

Control

Medium alone - - 2.5 109 ± 0.2 109 - 73.9 ± 8.5 -

Cups

be’Cup®

Size 1 Silicone 4/4.5 1.1 109 ± 0.3 109 0.001 50.6 ± 8.5 0.03

Size 2 Silicone 4.5/5 4.4 109 ± 1.1 109 0.001 87.3 ± 4.1 0.001

Me Luna®

Size S TPE 3.8/4.5 5.7 108 ± 4 108 <0.001 87.3 ± 4.1 0.043

Size M TPE 4.5/5 7.6 108 ± 2 108 0.001 108.7 ±

23.2 0.03

TPE, thermoplastic elastomers. Values are means ± standard deviation (n=3 to 8). Student’s t-tests 479

were used to compare bacterial CFUs and TSST-1 concentrations in presence of cups to the control. 480

481

482

483

484


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

23

Figure 1: Effects of tampon fiber composition and their folding impact on S. aureus growth and TSST-485

1 production. S. aureus was incubated in BHI in sterile bags in the presence or absence of unaltered 486

tampons (black) or tampons deconstructed by dilacerations (white) for 8 hours at 37°C with shaking 487

before S. aureus and TSST-1 quantification. Results shown are means of 3 experiments ± standard 488

deviation. Student’s t-tests were used to compare bacterial CFUs and TSST-1 concentrations in the 489

presence of deconstructed tampons to deconstructed tampons. (*, P<0.05) 490

491

Figure 2. Effects of tampon fiber composition and incubation time on S. aureus colonization. The 492

fibers of tampons composed of cotton alone (Natracare, Super plus), mixed rayon and cotton 493

(Tampax compak® Super plus), mixed viscose and cotton (OB® ProComfort® Super plus), and viscose 494

alone (Nett® PROCOMFORT Super plus) were incubated for 2, 4, 6, 8 or 24 hours, at 37°C without 495

agitation in the presence of the GFP-labelled S. aureus strain LUG2902. Fibers were then washed, 496

mounted under coverslides, and observed by confocal microscopy as described in Materials and 497

Methods. 3D projections were reconstructed using the ZEN®V2.3 software package from z-stacks 498

with 1-μm serial optical sections. Tampon fibers are colored red and S. aureus cells are labeled green. 499

500

Figure 3. Biofilm formation and TSST-1 production by S. aureus differs between cups. S. aureus was 501

incubated in BHI in sterile bags in the presence of be’Cup® size 2 (silicone) and Me Luna® size S (TPE) 502

menstrual cups for 8 hours at 37°C without shaking, before separating biofilm and planktonic S. 503

aureus cells. Cell numbers and TSST-1 production were quantified in both biofilm and planktonic 504

compartments, and the total number of bacteria represents the sums of results from biofilm and 505

planktonic compartments. Results shown are means of 3 experiments +/- standard deviation. 506

Student’s t-tests were used to compare bacterial CFUs in presence of TPE cups versus silicone cups, 507

and to compare TSST-1 concentrations in the presence of cups versus the control (*, P<0.05). 508

509

510


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

24

Figure 4. Biofilm formation by S. aureus on sections of cup made of silicone and TPE. Sections of 511

1X1.5 cm of Be’cup size 1 made of silicone and Meluna size S made of in TPE seal were incubated in 512

presence of GFP-labelled S. aureus LUG2902 without agitation. After 4, 6 and 8 hours, sections of cup 513

were recovered, washed and mounted under coverslides, and observed by confocal microscopy as 514

described in Materials and Methods. 3D projections were reconstructed using the ZEN®V2.3 software 515

package from z-stacks with 1-μm serial optical sections. S. aureus cells are labeled green. (A) and (B) 516

correspond to 2D observation at different location of the while (C) correspond to the 3D projection 517

from z-stacks. 518

519

Figure 5. Differential impact of shape and composition of menstrual cups on TSST-1 production. 520

S. aureus was incubated in BHI in sterile bags in the presence of unaltered or sections of 1X1.5 cm of 521

Be’cup size 1 made of silicone and Meluna size S made of in TPE. be’Cup® size 1 (silicone) and Me 522

Luna® size S (TPE) menstrual cups for 8 hours at 37°C with shaking, before separating biofilm and 523

planktonic S. aureus cells. Bacterial numbers and TSST-1 production were quantified in planktonic 524

compartments were quantified as previously described. Results are expressed as ratio of TSST1 525

(ng/mL)/ bacteria (CFU/mL) and are means of at list 3 experiments +/- standard deviation. Student’s 526

t-tests were used to compare ratio between the control (medium) and unaltered or sections of 527

menstrual cup in silicone or TPE ,and between unaltered or sections of cup in silicone and TPE (*, 528

P<0.05). 529

530


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Downloaded from on April 30, 2020 by ...€¦ · 8 9 íX /Z/U v /v v ]}vo Z Z Z v/v( ]}o}P] U/v...

Documents

Transcript of Downloaded from on April 30, 2020 by ...€¦ · 8 9 íX /Z/U v /v v ]}vo Z Z Z v/v( ]}o}P] U/v...