Immunity, Volume 44

Supplemental Information

MicroRNAs 24 and 27 Suppress Allergic Inflammation

and Target a Network of Regulators

of T Helper 2 Cell-Associated Cytokine Production

Heather H. Pua, David F. Steiner, Sana Patel, Jeanmarie R. Gonzalez, Jorge F.Ortiz-Carpena, Robin Kageyama, Ni-Ting Chiou, Antonia Gallman, Dimitride Kouchkovsky, Lukas T. Jeker, Michael T. McManus, David J. Erle, and K. Mark Ansel

1

SUPPLEMENTAL FIGURES Figure S1.

2

Figure S1 (related to Figure 1). Ago deficiency in T cells results in enhanced cytokine production, reduced cell numbers, and impaired proliferation. (A) Immunoblot of purified T cells from WT, Ago2 Δ/Δ, Ago1+/ΔAgo2 Δ/Δ and Ago1Δ/ΔAgo2 Δ/Δ mice. (B) EGFP expression measuring miRNA sensor activity in WT and Ago-deficient mice. (C,D) Intracellular staining for cytokine production in T cells cultured in ThN conditions. Numbers in quadrants are percent of live CD4+ singlets and each dot represents an individual mouse (n=4-5 mice from 3-4 independent experiments, one-way ANOVA with Tukey’s multiple comparison test). Flow cytometry analysis of T cells among total live cells (E) and naïve versus activated cells among CD4+ T cells (F) from spleen and peripheral lymph nodes. (G) Summary of the numbers and percentages of CD19+ B cells, CD4+ T cells and CD8+ T cells. Bars graphs are mean+s.d. (n=3-4 mice from 3 independent experiments, one-way ANOVA with Tukey’s multiple comparison test). (H) Proliferation of T cells labeled with CellTrace Violet dye and analyzed by flow cytometry. Numbers refer to the percentage of cells in each box indicated by a lower case letter. Data is representative of three biological replicates.

3

Figure S2.

Figure S2 (related to Figure 2). Individual miRNAs inhibit Th2 cytokine production. (A) IL-4 and IL-13 production by Dgcr8Δ/ΔTbx21-/- T cells cultured in full Th2 conditions (500U/ml IL-4 and anti-IFN-γ antibody) and transfected with miR-23, miR-24, miR-27, all mimics, or control mimic (CM). Each dot represents an individual mouse (n=5 from 2 independent experiments, two-tailed paired t-test). (B) IL-4 versus IL-13 production in Dgcr8Δ/ΔTbx21-/- CD4+ T cells transfected with single miRNAs. Highlighted are Mirc11 and Mirc22 cluster family members (red), let-7 family members (orange) and miR-19a (blue).

4

Figure S3.

Figure S3 (related to Figure 2). miR-23, miR-24 and miR-27 mimics specifically inhibit target sequences. (A, B) GFP expression measuring miRNA sensor activity in Mirc11-/-Mirc22ΔT/ΔT CD4+ T cells transfected with miRNA mimics and control mimic (CM) or WT cells transfected with CM. (C) Live cell count on day 5 or day 6 of culture of Dgcr8Δ/ΔTbx21-/- CD4+ T cells transfected with miRNA mimics expressed as a ratio when compared to CM (n=7 from 7 independent experiments, mean + s.e.m., one sample t-test).

5

Figure S4.

Figure S4 (related to Figure 3). Mirc11-/-Mirc22ΔT/ΔT mice have normal peripheral T cell numbers and in vitro proliferation. (A) Expression of miR-23, miR-24, and miR-27 by qPCR in CD4+ T cells (n=3-6 mice, mean + s.e.m., one-way ANOVA with Dunnett’s multiple comparison test) (B) GFP expression measuring miRNA sensor activity in WT versus Mirc11-/-Mirc22ΔT/ΔT CD4+ T cells. (C) Flow cytometry analysis of T cells from the spleen including naïve, activated, and regulatory subsets. Numbers in left plots are percent of live singlets. Numbers in middle left, middle right and right plots are percent of live CD4+ singlets. Quantification of the number of B220+ B cells, CD4+ T cells and CD8+ T cells from spleen (D) and peripheral lymph nodes (E). (F) Proliferation of T cells labeled with CellTrace Violet dye and analyzed by flow cytometry on day 3 of culture. (n=6 mice from 2 independent experiments for C-F, mean + s.e.m., one-way ANOVA with Bonferroni’s multiple comparison test).

6

Figure S5.

Figure S5 (related to Figure 5). Pathway analysis for miR-23 targets upstream of IL-4. IPA pathway analysis of gene and target networks significantly regulated upstream of IL-4 after transfection with miR-23 mimic versus control mimic in Dgcr8Δ/ΔTbx21-/- CD4+ T cells. Interactions between genes/targets and IL-4 (tan) and targets with genes/targets upstream of IL-4 (black) are depicted.

7

Figure S6.

Figure S6 (related to Figure 6). miR-24 and miR-27 siRNA screens identify candidate target genes. (A) Filtering strategy for candidate targets expressed in RNA sequencing data from miR-24 or miR-27 transfected Dgcr8Δ/ΔTbx21-/- CD4+ T cells. (B) After filtering on fold change from a Gene Set Enrichment Analysis leading edge analysis and P value from RNA sequencing data, remaining targets were rank ordered without bias to prior Th2 function for testing in a RNAi screen. siRNA re-testing of top 30 candidate targets measuring (C) IL-4 production by intracellular staining and (D) proliferation by CellTrace Violet dye dilution calculated by FlowJo. Bars are singlicate measures.

8

(excel file) Table S1 (related to Figure 2). Results of miRNA mimic screen in Dgcr8Δ/ΔTbx21-/- CD4+ T cells. Z scores for IL-4 and IL-13 production measured by intracellular cytokine staining. (excel file) Table S2 (related to Figure 5). Ingenuity Pathway Analysis output for miR-24 or miR-27 transfected Dgcr8Δ/ΔTbx21-/- CD4+ T cells. All genes with a significant change (P<0.05) in expression when compared with control mimic were included in the analysis. Displayed are significantly changed canonical pathways (P<0.05) and all identified upstream regulators. Candidate direct targets capable of regulating IL-4 in re-testing are highlighted in red. Table S3 (related to Figure 6). Candidate miR-24 and miR-27 targets from re-testing that regulate IL-4.

Gene Symbol

Gene Name Fold Change (RNAseq)

Target Scan

CLIP Base

Function

GATA3 GATA binding protein 3 (Gata3), mRNA.

0.61 27 27 Transcription factor that regulates Th2 differentiation and cytokine production(Zheng and Flavell, 1997; Zhu et al., 2004).

CCNK cyclin K (Ccnk), mRNA. 0.39 27 27 Interact with CDK9 (P-TEFb complex)(Fu et al., 1999; Lin et al., 2002) and CDK12 (genome stability)(Yu and Cortez, 2011).

GALNT3 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (Galnt3), mRNA.

0.13 27 27 Initiate mucin-type O-glycosylation(Bennett et al., 2012). Mutations associated with calcinosis and hyperphosphatemia.

AFF4 AF4/FMR2 family, member 4 (Aff4), mRNA.

0.43 27 27 Scaffold for super elongation complex, interacting with P-TEFb(Luo et al., 2012).

GPR174 G protein-coupled receptor 174 (Gpr174), mRNA.

0.53 27 24+27 Lysophostidylserine receptor(Makide et al., 2014). Single nucleotide polymorphism in Graves' disease(Chu et al., 2013; Szymanski et al., 2014).

CLCN3 chloride channel 3 (Clcn3), transcript variant e, mRNA.

0.40 24 24 Broadly expressed endosomal Cl channel. Important in brain and neutrophil respiratory burst(Stauber et al., 2012).

IKZF1 IKAROS family zinc finger 1 (Ikzf1), mRNA.

0.48 27 24+27 Transcription factor that regulates Th2 differentiation and cytokine production(Grogan et al., 2003; Quirion et al., 2009).

FBXW7 F-box and WD-40 domain protein 7 (Fbxw7), mRNA.

0.42 27 27 Component of ubiquitin ligase complex that promotes cell cycle exit(Onoyama and Nakayama, 2008).

CNOT6 CCR4-NOT transcription complex, subunit 6 (Cnot6), mRNA.

0.57 24 24 Catalytic component of poly(A) deadenylase complex that interact with miRISC(Behm-Ansmant et al., 2006; Piao et al., 2010).

9

SUPPLEMENTAL EXPERIMENTAL PROCEDURES Mouse strains

Targeted JMA83 (C57BL/6N-Atm1Brd) embryonic stem (ES) cells(Prosser et al.,

2011) were used to generate chimeric mice with a deletion of the cluster containing miR-

23a, miR-27a and miR-24-2 (Mirc11tm1Wtsi, here Mirc11-; Sanger MirKO ES cell line

Mir23a-Mir24-2 cluster 8N2, 036362-UCD, Mutant Mouse Regional Resource Centers).

These chimeras were crossed to Actin-cre mice (Tg(ACTB-cre)2Mrt, 019099, the Jackson

Laboratory) to delete the selection cassette. E14 (129P2/OlaHsd) ES cells were targeted

as described(Park et al., 2012) and used to generate chimeric mice with a conditionally

mutant allele of the cluster containing miR-23b, miR-27b, and miR-24-1 (Mirc22tm1.1Mtm,

here Mirc22f). These chimeras were crossed to Rosa26-Flp mice

(Gt(ROSA)26Sortm1(FLP1)Dym; 009086, the Jackson Laboratory) to delete the selection

cassette and the progeny crossed to Cd4-cre mice (Tg(CD4-cre)1Cwi; 4196, Taconic).

These two lines were intercrossed to generate mice with T cells lacking expression of all

Mirc11 and Mirc22 cluster miRNAs (here Mirc11-/-Mirc22ΔT/ΔT).

Dgcr8tm1.1Blel (here Dgcr8f/f); Gt(ROSA)26Sortm3(CAG-EYFP)Hze (here Rosa-YFP);Cd4-

cre mice (here Dgcr8Δ/Δ) were further crossed with Tbx21tm1Glm mice (here Tbx21-/-;

004648, the Jackson Laboratory) to generate Dgcr8f/fCd4-creTbx21-/-Rosa-YFP mice

(here Dgcr8Δ/ΔTbx21-/-). Conditional mutant Ago2tm1.1Tara (here Ago2f/f) and

Ago1tm1a(KOMP)Wtsi (here Ago1f/f; Mouse Genetics Project, Wellcome Trust Sanger

Institute) mice were crossed to Cd4-cre mice and intercrossed to generate Ago2f/f;Cd4-cre

(here Ago2 Δ/Δ), Ago1+/fAgo2f/fCd4-cre (here Ago1+/ΔAgo2 Δ/Δ), and Ago1f/fAgo2f/fCd-4cre

(here Ago1Δ/ΔAgo2 Δ/Δ) mice.

10

B6-Ly5.1/Cr (here CD45.1+) were purchased from Charles River

Laboratory.

T cell polarization cultures

Cells were cultured in DMEM high glucose media supplemented with 10% FCS,

pyruvate, nonessential amino acids, MEM vitamins, L-arginine, L-asparagine, L-

glutamine, folic acid, beta mercaptoethanol, penicillin, and streptomycin. Most

stimulations were performed with hamster anti-mouse CD3 (clone 2C11, 0.25µg/ml) and

anti-mouse CD28 (clone 37.51, 1µg/ml) antibodies on plates coated with goat anti-

hamster IgG (0.3mg/ml in PBS; MP Biomedicals). During the course of this study, a

revision was made to our culture conditions such that stimulations were performed with

either anti-mouse CD3 (clone 2C11, 1µg/ml) and anti-mouse CD28 (clone 37.51, 1µg/ml)

antibodies directly coated onto non-tissue coated treated plates or biotinylated anti-CD3

(clone 2C11, 0.25µg/ml) and anti-mouse CD28 (clone 37.51, 1µg/ml) on plates coated

with NeutrAvidin (5µg/ml, Thermo Fischer Scientific). Additional exogenous cytokines

and neutralizing antibodies were added throughout the culture to routine stimulation for

polarization (ThN: no additional reagents; Th2: 500 units/ml IL-4 added as a supernatant

from I3L6 cells(Tepper et al., 1989), and 5µg/ml anti-IFN-γ (cloneXMG1.2); Th1:

10ng/ml IL-12 (R&D Systems) and 10ug/ml anti-IL-4 (clone 11B11); Th17: 5ng/ml

recombinant human TGF-β (Peprotech), 25ng/ml recombinant murine IL-6 (Peprotech),

10ug/ml anti-IL-4 (clone11B11) and 10ug/ml anti-IFN-γ (cloneXMG1.2).

11

3’UTR cloning

Constructs containing near full length 3’UTRs of Gata3, Ikzf1, Cnot6 and Ccnk

were cloned into the psiCHECK-2 luciferase reporter construct (Promega). Primer

sequences were: Gata3 F: TAGTAGCTCGAGAGTGTGCGAAGAGTTCCTCC, Gata3

R: TAGTAGGCGGCCGCAACACACAGGGGCTAACAGT Ikf1 F:

TAGTAGGTCGACTAGCTGGTTATGCCTCCTTC, Ikzf1 R:

TAGTAGGCGGCCGCACAGCATATAGCCACCTTCA, Cnot6 F:

TAGTAGCTCGAGGCAGGAGGTAGTCACTTTCA, Cnot6 R:

TAGTAGGCGGCCGCACCAAAAGGAATAAAGCGAACA, Ccnk F:

TAGTAGCTCGAGTTGAAGAATAGACTGAGGGGG, Ccnk R:

TAGTAGGCGGCCGCTTTATTCGGGCAACTGACTG.

Intracellular staining, flow cytometry, sorting

For intracellular stains, cells were harvested after restimulation and stained with

viability dye eFluor780 (eBiosciences). For cytokine stains, cells were fixed for 8 min at

room temperature with 4% PFA, and permeabilized with 0.5% saponin buffer. For

transcription factor stains, unstimulated cells were fixed, permeabilized, and stained

using the FoxP3 Staining Kit (eBiosciences). For live cell stains, cells were stained with

propidium iodide (eBiosciences) to exclude dead cells. For all analyses, cells were

pregated on live singlets unless otherwise stated. For Dgcr8Δ/Δ and Dgcr8Δ/ΔTbx21-/-

analyses, only YFP+ cells were analyzed to exclude cells that failed to activate cre and

escaped deletion of Dgcr8 and activation of the Rosa-YFP reporter. T cell subsets

analyzed included CD4+ naïve (CD44loCD62Lhi), activated/effector memory (CD69+ or

12

CD44hiCD62Llo) and regulatory (CD25+). MFI is mean fluorescence intensity. Antibodies

used: CD4-Qdot605 (Life Technologies, RM4-5), CD8-eFluor 450 (53-6.7), CD3-V500

(BD Horizon, 500A2), B220-PE (eBiosciences, RA3-6B2), CD62L-FITC (eBioscience;

MEL-14), CD44-Alexa Fluor 700 (eBiosciences; IM7), CD69-PE-Cy7 (eBiosciences;

H1.2F3), CD11b-AlexaFluor488 (eBiosciences; M1/70), CD11c-Alexa 700 (Biolegend;

N418), Ly6G-V450 (BD Biosciences; 1A8), SiglecF-PE (BD Biosciences; E50-2440),

CD4-APC (BioLegend; N418), CD8a-eFluor 605 NC (eBiosciences; 53-6.7) and

CD45.2-V500 (BD Horizon, 104), IL-13-APC/PerCP-eFluor710 (eBiosciences;

eBio13A), IL-4-PE/APC (eBiosciences; 11B11), IL-5-PE (BioLegend; TRFK5), IFNg-

eFluor450 (eBiosciences; XMG1.2), IL-17A-Alexa Fluor 488 (eBiosciences; eBio17B7),

IL-10-APC (eBiosciences; JES5-16E3) and GATA3-PE (eBiosciences; E50-2440).

Samples were analyzed by flow cytometry (BD LSR II) or FACS sorted (Aria2 SORP).

qPCR

CD4+ T cells from the spleen and lymph nodes of mice were enriched by

Dynabead positive selection (Invitrogen, L3T4). Cells were lysed in Trizol LS (Life

Technologies), total RNA isolated, and RNA quantified on an ND1000

Spectrophotometer (NanoDrop). Reverse transcription of miRNA was performed with the

NCode miRNA First-Strand cDNA Synthesis Kit (Life Technologies). Forward primers

were the mature miRNA sequence(Kozomara and Griffiths-Jones, 2014) and a universal

reverse primer was used from the kit. Expression values were normalized to the 5.8S

ribosomal RNA (F: ATCGTAGGCACCGCTACGCCTGTCTG). qPCR was performed

13

in technical duplicates using FastStart Universal SYBR Green Master mix (Roche) on a

Realplex2 instrument (Eppendorf).

RNA sequencing analysis

The analytic pipeline included de-multiplexing the results, trimming adapter

sequences from the reads and aligning to the reference genome. Sequence alignment and

splice junction estimation was performed using Bowtie2(Langmead and Salzberg, 2012)

and TopHat(Trapnell et al., 2009), respectively. Genome alignments were restricted to

those reads that map uniquely to an annotated transcriptome provided by Ensembl (Flicek

et al., 2014). This subset of mappings was aggregated on a per-gene basis as raw input for

the program DESeq(Anders and Huber, 2010). DESeq normalizes by size factor (reads

per sample) as well as by library complexity and then utilizes either a Fischer’s Exact

Test (FET) type statistic or a Generalized Linear Model (GLM) (dependent on the type

and complexity of analysis).

Data from two of the miR-27 transfections were combined to single biologic

replicate (9+6 = 15 million total reads) to obtain a total of 11-31 million unique reads per

sample. Analysis was performed on batch normalized data sets based on principle

component analysis (sort 1 and 2 were similar, sort 3 and 4 were similar) and filtered on

genes with an average expression of 2 reads-per-million in at least one transfection

condition. Expression values were analyzed as log2(fold change) of cells transfected with

each miRNA mimic compared with control mimic. Raw data and processed data sets

have been deposited in GEO.

14

Cumulative distribution frequency plots were generated in R (www.r-project.org)

to display the log2(miRNA mimic/control mimic) against the cumulative frequency of

genes. The expression values from all expressed genes, all predicted targets from

TargetScan (http://www.targetscan.org, ref. (Garcia et al., 2011)), and corresponding

predicted 8mer target matches from TargetScan were plotted for each data set. Gene Set

Enrichment Analysis (www.broadinstitute.org/gsea) was performed using predicted 8mer

target matches from TargetScan. Plotted were the enrichment curve and rank order

location of each target in the total gene set from most downregulated to most upregulated

(left to right). QIAGEN’s Ingenuity Pathway Analysis (IPA, QIAGEN Redwood city,

www.quiagen.com/ingenuity) was used to analyze trimmed data sets (P<0.05, 656 genes

for miR-24/CM, 591 genes for miR-27/CM) in their core analysis which included

identification of upstream regulators and changes in canonical pathways. The pathways

function was used to plot the 9 candidate direct targets of miR-24 and miR-27 identified

by RNAi re-testing and map them to downstream direct and indirect expression changes.

Relationships were limited to “E” (expression) and “T” (transcription). The candidate

miR-27 target Ikzf1 and the genes identifying it as a major upstream regulator were

mapped and connected. In both pathways, relationships mapping genes to IL-4

downstream were independently added. For the RNAi rescreen, a rank order to test

candidate targets was assigned by adding the absolute value of the log2(miRNA/CM) + 1

for P<0.01 in RNA sequencing data +1 for connection to significantly up or

downregulated genes (log2(miRNA/CM)<-0.52 or >0.52, P<0.05) in the global

expression data by Ingenuity Pathway Analysis +1 for evidence of an Argonaute binding

15

peak in activated T cells in published data available on CLIP Base

(http://cbio.mskcc.org/~aakhan/clipseq/, ref. (Loeb et al., 2012)).

SUPPLEMENTAL REFERENCES Anders, S., and Huber, W. (2010). Differential expression analysis for sequence count data. Genome Biol 11, R106. Bennett, E.P., Mandel, U., Clausen, H., Gerken, T.A., Fritz, T.A., and Tabak, L.A. (2012). Control of mucin-type O-glycosylation: a classification of the polypeptide GalNAc-transferase gene family. Glycobiology 22, 736-756. Flicek, P., Amode, M.R., Barrell, D., Beal, K., Billis, K., Brent, S., Carvalho-Silva, D., Clapham, P., Coates, G., Fitzgerald, S., et al. (2014). Ensembl 2014. Nucleic Acids Res 42, D749-755. Kozomara, A., and Griffiths-Jones, S. (2014). miRBase: annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res 42, D68-73. Langmead, B., and Salzberg, S.L. (2012). Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357-359. Lin, X., Taube, R., Fujinaga, K., and Peterlin, B.M. (2002). P-TEFb containing cyclin K and Cdk9 can activate transcription via RNA. J Biol Chem 277, 16873-16878. Makide, K., Uwamizu, A., Shinjo, Y., Ishiguro, J., Okutani, M., Inoue, A., and Aoki, J. (2014). Novel lysophosphoplipid receptors: their structure and function. J Lipid Res 55, 1986-1995. Onoyama, I., and Nakayama, K.I. (2008). Fbxw7 in cell cycle exit and stem cell maintenance: insight from gene-targeted mice. Cell Cycle 7, 3307-3313. Stauber, T., Weinert, S., and Jentsch, T.J. (2012). Cell biology and physiology of CLC chloride channels and transporters. Compr Physiol 2, 1701-1744. Tepper, R.I., Pattengale, P.K., and Leder, P. (1989). Murine interleukin-4 displays potent anti-tumor activity in vivo. Cell 57, 503-512. Trapnell, C., Pachter, L., and Salzberg, S.L. (2009). TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25, 1105-1111. Yu, D.S., and Cortez, D. (2011). A role for CDK9-cyclin K in maintaining genome integrity. Cell Cycle 10, 28-32.