DNA Parent Verification & Genomics - Beefmaster

43
DNA Parent Verification & Genomics Jared E. Decker Beef Genetics Specialist

Transcript of DNA Parent Verification & Genomics - Beefmaster

Page 1: DNA Parent Verification & Genomics - Beefmaster

DNA Parent Verification & Genomics

Jared E . DeckerBeef Genet i cs Spec ia l i s t

Page 2: DNA Parent Verification & Genomics - Beefmaster
Page 3: DNA Parent Verification & Genomics - Beefmaster
Page 4: DNA Parent Verification & Genomics - Beefmaster

Parentage Verification

Simple question:Are the recorded parents the true parents?

Page 5: DNA Parent Verification & Genomics - Beefmaster

Parentage Verification:Rules of Inheritance

Each animal has two sets of chromosomes• Chromosomes are strings of DNA

inherited as a unitOne set inherited from the sireOne set inherited from the dam

Page 6: DNA Parent Verification & Genomics - Beefmaster

Parentage Verification:Rules of Inheritance

Sire Genotype

AA

BB

AB

Calf Genotype

AA or AB

BB or AB

AA, AB, or BB

Parentage Exclusion

BB

AA

Uninformative

Page 7: DNA Parent Verification & Genomics - Beefmaster

Parentage Verification:Rules of Inheritance

Sire Genotype:AA

Dam Genotype:BB

Animal Genotype:AB

Page 8: DNA Parent Verification & Genomics - Beefmaster

DNA Markers

STRShort Tandem Repeat

22 base pairs long:AGAGAGAGAGAGAGAGAGAGAG

26 base pairs long:AGAGAGAGAGAGAGAGAGAGAGAGAG

Page 9: DNA Parent Verification & Genomics - Beefmaster

DNA Markers

STRShort Tandem Repeat

Variant is length of the STRGenotype is the length of the two variants inheritede.g. 114 120

Page 10: DNA Parent Verification & Genomics - Beefmaster

DNA MarkersSTRShort Tandem Repeat

DNA strand slippage

Page 11: DNA Parent Verification & Genomics - Beefmaster

DNA MarkersSNPSingle Nucleotide Polymorphism

CGCCCGTCTTTGTAAGGAGACCACTGACGCCCGTCTTTATAAGGAGACCACTGA

Page 12: DNA Parent Verification & Genomics - Beefmaster

DNA MarkersSNPSingle Nucleotide Polymorphism

Easy to automate testing

Page 13: DNA Parent Verification & Genomics - Beefmaster

Parentage Verification

STRs cannot be directly compared to SNPs

If the parents of a young animal do not have SNPs data on file, they will need to be genotyped with SNPs

Page 14: DNA Parent Verification & Genomics - Beefmaster

DNA technology is much more than

parentage verification!

Page 15: DNA Parent Verification & Genomics - Beefmaster
Page 16: DNA Parent Verification & Genomics - Beefmaster

Genetic gain per year estimates from four

paths of selection (Four Paths) and segmented regressions of trait PBV on birth year for all cows (All Cows) or the subset of cows registered in the national herdbook (Reg

Cows) for six traits (milk, fat, and protein yields; SCS; PL; and

DPR).

Adriana García-Ruiz et al. PNAS 2016;113:E3995-E4004©2016 by National Academy of Sciences

Presenter
Presentation Notes
Genetic gain per year estimates from four paths of selection (Four Paths) and segmented regressions of trait PBV on birth year for all cows (All Cows) or the subset of cows registered in the national herdbook (Reg Cows) for six traits (milk, fat, and protein yields; SCS; PL; and DPR).
Page 17: DNA Parent Verification & Genomics - Beefmaster

Traditional EPDs

17

EPD

Own Performance

Pedigree

Progeny Performance

Presenter
Presentation Notes
Genomic-enhanced EPDs Combine information from traditional EPDs with genomic predictions The tool (EPDs) that the farmer uses has not changed, just become more accurate
Page 18: DNA Parent Verification & Genomics - Beefmaster

Two-Step Genomic-Enhanced EPDs

18

GE-EPD

Own Performance

Pedigree Genomic Test Result

Progeny Performance

Presenter
Presentation Notes
Genomic-enhanced EPDs Combine information from traditional EPDs with genomic predictions The tool (EPDs) that the farmer uses has not changed, just become more accurate
Page 19: DNA Parent Verification & Genomics - Beefmaster

Two-Step

Step 1: Create and validate genomic prediction using animals with DNA data and trait measurements. Includes work to validate the prediction.

Step 2: Predict genetic merit using DNA of animals with no trait data.

Page 20: DNA Parent Verification & Genomics - Beefmaster

Genomic Prediction

Gene Tests vs Genomic PredictionAn effect for each DNA variant is estimatedAnimals molecular breeding value is sum of DNA variant effects

A

B

B

B

A

A

B

B

B

A

A

B

A

A

A

A

B

B

MBV2.2

0.1 0.2 -0.1 0 0.1 -0.2 0.8 0.1 0.1

-0.1 0.2 -0.1 0 -0.1 0.2 0.8 0.1 0.1

Page 21: DNA Parent Verification & Genomics - Beefmaster

DNA Marker Effects

21

Weaning Weight

Page 22: DNA Parent Verification & Genomics - Beefmaster

DNA Marker Effects

22

Marbling

Page 23: DNA Parent Verification & Genomics - Beefmaster

One-Step Genomic-Enhanced PTAs

23

GE-EPD

Own Performance

Pedigree+

Genomic

Progeny Performance

Presenter
Presentation Notes
Genomic-enhanced EPDs Combine information from traditional EPDs with genomic predictions The tool (EPDs) that the farmer uses has not changed, just become more accurate
Page 24: DNA Parent Verification & Genomics - Beefmaster

Pedigree Relationship table uses averages

On average, a bull shares 25% of its DNA with its grandsires.

Genomic Relationship table uses actual relationships.

Bull shares 25.8% of his genes with his paternal grandsire and 15.4% with his maternal grandsire.

Presenter
Presentation Notes
One step genomic prediction used in registered cattle for which we have pedigree information.
Page 25: DNA Parent Verification & Genomics - Beefmaster

Pedigree Relationship MatrixPaternal

GrandsirePaternal

GranddamMaternal Grandsire

Maternal Granddam Sire Dam Animal

Paternal Grandsire 1 0 0 0 0 0 0.25

Paternal Granddam 0 1 0 0 0 0 0.25

Maternal Grandsire 0 0 1 0 0 0 0.25

MaternalGranddam 0 0 0 1 0 0 0.25

Sire 0 0 0 0 1 0 0.5

Dam 0 0 0 0 0 1 0.5

Animal 0.25 0.25 0.25 0.25 0.5 0.5 1

Page 26: DNA Parent Verification & Genomics - Beefmaster

Genomic Relationship MatrixPaternal

GrandsirePaternal

GranddamMaternal Grandsire

Maternal Granddam Sire Dam Animal

Paternal Grandsire 1 0 0.17 0 0 0 0.20

Paternal Granddam 0 1 0 0 0 0 0.30

Maternal Grandsire 0.17 0 1 0 0 0 0.33

MaternalGranddam 0 0 0 1 0 0 0.17

Sire 0 0 0 0 1 0.11 0.5

Dam 0 0 0 0 0.11 1 0.5

Animal 0.20 0.30 0.33 0.17 0.5 0.5 1.07

Page 27: DNA Parent Verification & Genomics - Beefmaster

Pedigree Matrix

Page 28: DNA Parent Verification & Genomics - Beefmaster

Pedigree and Genomic Matrix

Page 29: DNA Parent Verification & Genomics - Beefmaster

The Value of Genomics

Page 30: DNA Parent Verification & Genomics - Beefmaster

Selection Intensity

eBEEF.org fact sheet“Decreasing Generation Interval to Increase Genetic Progress”

∆𝐺𝐺 =𝒓𝒓 ∗ 𝜎𝜎𝑔𝑔 ∗ 𝑖𝑖

𝑳𝑳

Page 31: DNA Parent Verification & Genomics - Beefmaster

Jack Ward: Hereford Genetic Summit

$5,325

$7,475

$0

$2,000

$4,000

$6,000

$8,000

Traditional GE-EPDSpring 2014 Sales Data

Page 32: DNA Parent Verification & Genomics - Beefmaster

Progeny Equivalent Value

Ultrasound technicians charge between $15 and $25 per animal6 progeny equivalents x $15 to $25 = $90 to $150

Page 33: DNA Parent Verification & Genomics - Beefmaster

Value of Genomics:Simulation Study

Additional income of genetically superior commercial bulls

$89 to $565

Additional income of genetically superior seedstock bulls

$5,331 to $27,910

Total value of genetic improvement from genomic testing

$204 to $1,119

van Eenennaam, A. L., van der Werf, J. H. J., & Goddard, M. E. (2011). The value of using DNA markers for beef bull selection in the seedstock sector. Journal of Animal Science, 89(2), 307–320. http://doi.org/10.2527/jas.2010-3223

Page 34: DNA Parent Verification & Genomics - Beefmaster

Value of Genetically Superior Commercial Sires

van Eenennaam, A. L., van der Werf, J. H. J., & Goddard, M. E. (2011). The value of using DNA markers for beef bull selection in the seedstock sector. Journal of Animal Science, 89(2), 307–320. http://doi.org/10.2527/jas.2010-3223

Presenter
Presentation Notes
Grey – cow calf sector Black – processing sector Grass feed vs Grain feed. Figure 4. Breakdown of beef industry sector benefits resulting from the use of a genetically superior commercial sire sourced from a seedstock breeding program using performance records in the absence of DNA testing (none), or performance records in addition to intermediate- or high-accuracy DNA test information. Results are reported for indexes developed for terminal or self-replacing (maternal) herds targeting either the domestic Australian market, where steers are finished on pasture (grass), or a high-value market, where steers are finished on concentrate rations in feedlots (feedlot). Breeding objective traits of direct benefit to the processing sector (black) were assumed to be dressing percentage, salable meat percentage, rump fat depth, and marbling score, whereas those of direct benefit to the production sector (gray) were assumed to be sale BW–direct, sale BW–maternal, cow weaning rate, cow survival rate, cow BW, calving ease–direct, and calving ease–maternal. van Eenennaam, A. L., van der Werf, J. H. J., & Goddard, M. E. (2011). The value of using DNA markers for beef bull selection in the seedstock sector. Journal of Animal Science, 89(2), 307–320. http://doi.org/10.2527/jas.2010-3223
Page 35: DNA Parent Verification & Genomics - Beefmaster

Mike MacNeil at BIF

Value of genomics ranged from $159 to $169 based on breeding objective

Page 36: DNA Parent Verification & Genomics - Beefmaster

The Missouri SHOW-ME-SELECT™

Replacement Heifer Program

Page 37: DNA Parent Verification & Genomics - Beefmaster

Show-Me-SelectService Sires

Proven AI SireNatural Service Sire

Page 38: DNA Parent Verification & Genomics - Beefmaster

Show-Me-SelectService Sires

Proven AI SireNatural Service SireGenomic Enhanced Sire

Value of increased reliability

Page 39: DNA Parent Verification & Genomics - Beefmaster

Show-Me-SelectShow-Me-Plus Heifer

Page 40: DNA Parent Verification & Genomics - Beefmaster

Premiums for heifers with various classifications

Tier PregnancyShow-

Me-Plus CountMedian

PriceMean Price

Premium/Discount

Genomic PredictionPremium

Tier I Natural Service No 66 2250 2223 BaseTier I Natural Service Yes 3 2700 2683 460.61 460.61Tier I Mix No 3 2200 2133 -89.39Tier I AI No 76 2350 2354 130.89Tier I AI Yes 20 2538 2696 473.52 342.63Tier II Natural Service No 3 2100 2100 -122.73Tier II Mix No 1 2400 2400 177.27Tier II AI No 4 2550 2538 314.77Tier II AI Yes 10 2500 2598 374.77 60.00

Show-Me-Select™ Show-Me-Plus heifers have been tested with a heifer genomic prediction panel, including commercial heifer tests or breed association GE-EPDs.See http://agebb.missouri.edu/select/prgmreq.htm for more information.

Presenter
Presentation Notes
Summary data from the Southeast Missouri Show-Me-Select™ Bred Heifer Sale held at Fruitland Livestock Sales,
Page 41: DNA Parent Verification & Genomics - Beefmaster

Predicted premiums for heifers with various classifications, based on mixed model analysis of 2014 and 2015 sale reports.

Genomic ROI: Early Returns Suggest Premium for Show-Me-Plus Heifershttp://blog.steakgenomics.org/2016/02/genomic-roi-early-returns-suggest.htmlSee http://agebb.missouri.edu/select/prgmreq.htm for more information.

Classification Premium ROI

Artificial Insemination Pregnancy $130

Show-Me-Plus (Genomic Prediction) $204 326% to 700%

Premiums for heifers with various classifications

Presenter
Presentation Notes
Analyzing data from the Southeast Missouri Show-Me-Select™ Bred Heifer Sale held at Fruitland Livestock Sales, I also assessed the sales price impact of Show-Me-Plus heifer designation. I analyzed data from 2014 and 2015 to remove the effect of reputation purchases for specific consignors. I fit a mixed model of price per HEIFER in which number of heifers per lot and average weight of the heifers were fit as fixed effects and consignor, heifer pregnancy type nested within date, and Show-Me-Plus nested within date were fit as random effects. Including the effect of Show-Me-Plus designation was not statistically significant (p = 0.44). The nested mixed model predicts that in 2015, a Show-Me-Plus heifer received a $154 premium. For comparison, in 2015, AI bred heifers received a predicted $222 premium and Tier II heifers received a $58 premium. Return on investment to the seller.
Page 42: DNA Parent Verification & Genomics - Beefmaster
Page 43: DNA Parent Verification & Genomics - Beefmaster

http://eBEEF.orgA Steak in Genomics

http://blog.steakgenomics.org/https://www.facebook.com/SteakGenomics

Thanks!