DNA Parent Verification & Genomics - Beefmaster
Transcript of DNA Parent Verification & Genomics - Beefmaster
![Page 1: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/1.jpg)
DNA Parent Verification & Genomics
Jared E . DeckerBeef Genet i cs Spec ia l i s t
![Page 2: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/2.jpg)
![Page 3: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/3.jpg)
![Page 4: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/4.jpg)
Parentage Verification
Simple question:Are the recorded parents the true parents?
![Page 5: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/5.jpg)
Parentage Verification:Rules of Inheritance
Each animal has two sets of chromosomes• Chromosomes are strings of DNA
inherited as a unitOne set inherited from the sireOne set inherited from the dam
![Page 6: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/6.jpg)
Parentage Verification:Rules of Inheritance
Sire Genotype
AA
BB
AB
Calf Genotype
AA or AB
BB or AB
AA, AB, or BB
Parentage Exclusion
BB
AA
Uninformative
![Page 7: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/7.jpg)
Parentage Verification:Rules of Inheritance
Sire Genotype:AA
Dam Genotype:BB
Animal Genotype:AB
![Page 8: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/8.jpg)
DNA Markers
STRShort Tandem Repeat
22 base pairs long:AGAGAGAGAGAGAGAGAGAGAG
26 base pairs long:AGAGAGAGAGAGAGAGAGAGAGAGAG
![Page 9: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/9.jpg)
DNA Markers
STRShort Tandem Repeat
Variant is length of the STRGenotype is the length of the two variants inheritede.g. 114 120
![Page 10: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/10.jpg)
DNA MarkersSTRShort Tandem Repeat
DNA strand slippage
![Page 11: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/11.jpg)
DNA MarkersSNPSingle Nucleotide Polymorphism
CGCCCGTCTTTGTAAGGAGACCACTGACGCCCGTCTTTATAAGGAGACCACTGA
![Page 12: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/12.jpg)
DNA MarkersSNPSingle Nucleotide Polymorphism
Easy to automate testing
![Page 13: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/13.jpg)
Parentage Verification
STRs cannot be directly compared to SNPs
If the parents of a young animal do not have SNPs data on file, they will need to be genotyped with SNPs
![Page 14: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/14.jpg)
DNA technology is much more than
parentage verification!
![Page 15: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/15.jpg)
![Page 16: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/16.jpg)
Genetic gain per year estimates from four
paths of selection (Four Paths) and segmented regressions of trait PBV on birth year for all cows (All Cows) or the subset of cows registered in the national herdbook (Reg
Cows) for six traits (milk, fat, and protein yields; SCS; PL; and
DPR).
Adriana García-Ruiz et al. PNAS 2016;113:E3995-E4004©2016 by National Academy of Sciences
![Page 17: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/17.jpg)
Traditional EPDs
17
EPD
Own Performance
Pedigree
Progeny Performance
![Page 18: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/18.jpg)
Two-Step Genomic-Enhanced EPDs
18
GE-EPD
Own Performance
Pedigree Genomic Test Result
Progeny Performance
![Page 19: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/19.jpg)
Two-Step
Step 1: Create and validate genomic prediction using animals with DNA data and trait measurements. Includes work to validate the prediction.
Step 2: Predict genetic merit using DNA of animals with no trait data.
![Page 20: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/20.jpg)
Genomic Prediction
Gene Tests vs Genomic PredictionAn effect for each DNA variant is estimatedAnimals molecular breeding value is sum of DNA variant effects
A
B
B
B
A
A
B
B
B
A
A
B
A
A
A
A
B
B
MBV2.2
0.1 0.2 -0.1 0 0.1 -0.2 0.8 0.1 0.1
-0.1 0.2 -0.1 0 -0.1 0.2 0.8 0.1 0.1
![Page 21: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/21.jpg)
DNA Marker Effects
21
Weaning Weight
![Page 22: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/22.jpg)
DNA Marker Effects
22
Marbling
![Page 23: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/23.jpg)
One-Step Genomic-Enhanced PTAs
23
GE-EPD
Own Performance
Pedigree+
Genomic
Progeny Performance
![Page 24: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/24.jpg)
Pedigree Relationship table uses averages
On average, a bull shares 25% of its DNA with its grandsires.
Genomic Relationship table uses actual relationships.
Bull shares 25.8% of his genes with his paternal grandsire and 15.4% with his maternal grandsire.
![Page 25: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/25.jpg)
Pedigree Relationship MatrixPaternal
GrandsirePaternal
GranddamMaternal Grandsire
Maternal Granddam Sire Dam Animal
Paternal Grandsire 1 0 0 0 0 0 0.25
Paternal Granddam 0 1 0 0 0 0 0.25
Maternal Grandsire 0 0 1 0 0 0 0.25
MaternalGranddam 0 0 0 1 0 0 0.25
Sire 0 0 0 0 1 0 0.5
Dam 0 0 0 0 0 1 0.5
Animal 0.25 0.25 0.25 0.25 0.5 0.5 1
![Page 26: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/26.jpg)
Genomic Relationship MatrixPaternal
GrandsirePaternal
GranddamMaternal Grandsire
Maternal Granddam Sire Dam Animal
Paternal Grandsire 1 0 0.17 0 0 0 0.20
Paternal Granddam 0 1 0 0 0 0 0.30
Maternal Grandsire 0.17 0 1 0 0 0 0.33
MaternalGranddam 0 0 0 1 0 0 0.17
Sire 0 0 0 0 1 0.11 0.5
Dam 0 0 0 0 0.11 1 0.5
Animal 0.20 0.30 0.33 0.17 0.5 0.5 1.07
![Page 27: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/27.jpg)
Pedigree Matrix
![Page 28: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/28.jpg)
Pedigree and Genomic Matrix
![Page 29: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/29.jpg)
The Value of Genomics
![Page 30: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/30.jpg)
Selection Intensity
eBEEF.org fact sheet“Decreasing Generation Interval to Increase Genetic Progress”
∆𝐺𝐺 =𝒓𝒓 ∗ 𝜎𝜎𝑔𝑔 ∗ 𝑖𝑖
𝑳𝑳
![Page 31: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/31.jpg)
Jack Ward: Hereford Genetic Summit
$5,325
$7,475
$0
$2,000
$4,000
$6,000
$8,000
Traditional GE-EPDSpring 2014 Sales Data
![Page 32: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/32.jpg)
Progeny Equivalent Value
Ultrasound technicians charge between $15 and $25 per animal6 progeny equivalents x $15 to $25 = $90 to $150
![Page 33: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/33.jpg)
Value of Genomics:Simulation Study
Additional income of genetically superior commercial bulls
$89 to $565
Additional income of genetically superior seedstock bulls
$5,331 to $27,910
Total value of genetic improvement from genomic testing
$204 to $1,119
van Eenennaam, A. L., van der Werf, J. H. J., & Goddard, M. E. (2011). The value of using DNA markers for beef bull selection in the seedstock sector. Journal of Animal Science, 89(2), 307–320. http://doi.org/10.2527/jas.2010-3223
![Page 34: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/34.jpg)
Value of Genetically Superior Commercial Sires
van Eenennaam, A. L., van der Werf, J. H. J., & Goddard, M. E. (2011). The value of using DNA markers for beef bull selection in the seedstock sector. Journal of Animal Science, 89(2), 307–320. http://doi.org/10.2527/jas.2010-3223
![Page 35: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/35.jpg)
Mike MacNeil at BIF
Value of genomics ranged from $159 to $169 based on breeding objective
![Page 36: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/36.jpg)
The Missouri SHOW-ME-SELECT™
Replacement Heifer Program
![Page 37: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/37.jpg)
Show-Me-SelectService Sires
Proven AI SireNatural Service Sire
![Page 38: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/38.jpg)
Show-Me-SelectService Sires
Proven AI SireNatural Service SireGenomic Enhanced Sire
Value of increased reliability
![Page 39: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/39.jpg)
Show-Me-SelectShow-Me-Plus Heifer
![Page 40: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/40.jpg)
Premiums for heifers with various classifications
Tier PregnancyShow-
Me-Plus CountMedian
PriceMean Price
Premium/Discount
Genomic PredictionPremium
Tier I Natural Service No 66 2250 2223 BaseTier I Natural Service Yes 3 2700 2683 460.61 460.61Tier I Mix No 3 2200 2133 -89.39Tier I AI No 76 2350 2354 130.89Tier I AI Yes 20 2538 2696 473.52 342.63Tier II Natural Service No 3 2100 2100 -122.73Tier II Mix No 1 2400 2400 177.27Tier II AI No 4 2550 2538 314.77Tier II AI Yes 10 2500 2598 374.77 60.00
Show-Me-Select™ Show-Me-Plus heifers have been tested with a heifer genomic prediction panel, including commercial heifer tests or breed association GE-EPDs.See http://agebb.missouri.edu/select/prgmreq.htm for more information.
![Page 41: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/41.jpg)
Predicted premiums for heifers with various classifications, based on mixed model analysis of 2014 and 2015 sale reports.
Genomic ROI: Early Returns Suggest Premium for Show-Me-Plus Heifershttp://blog.steakgenomics.org/2016/02/genomic-roi-early-returns-suggest.htmlSee http://agebb.missouri.edu/select/prgmreq.htm for more information.
Classification Premium ROI
Artificial Insemination Pregnancy $130
Show-Me-Plus (Genomic Prediction) $204 326% to 700%
Premiums for heifers with various classifications
![Page 42: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/42.jpg)
![Page 43: DNA Parent Verification & Genomics - Beefmaster](https://reader031.fdocuments.net/reader031/viewer/2022012503/617cf03506d5d00ebd6a04b3/html5/thumbnails/43.jpg)
http://eBEEF.orgA Steak in Genomics
http://blog.steakgenomics.org/https://www.facebook.com/SteakGenomics
Thanks!