DNA Fingerprinting
description
Transcript of DNA Fingerprinting
![Page 1: DNA Fingerprinting](https://reader035.fdocuments.net/reader035/viewer/2022062409/56814bbb550346895db88edc/html5/thumbnails/1.jpg)
One test used in forensic labs is DNA fingerprint. It is also called a DNA profile. Analysts use the DNA profile from potential suspects and compare it against DNA found at a crime scene. There’s DNA profiling for paternity tests. These days you can send a sample of DNA and find out your ancestry to learn more about your origins. This is a very conclusive test because DNA is specific to each individual (unless you are an identical twin).
![Page 2: DNA Fingerprinting](https://reader035.fdocuments.net/reader035/viewer/2022062409/56814bbb550346895db88edc/html5/thumbnails/2.jpg)
HOW ARE DNA FINGERPRINTS MADE??? The process begins with a sample of DNA
Isolate & replicate the DNA
http://learn.genetics.utah.edu/content/labs/pcr/
![Page 3: DNA Fingerprinting](https://reader035.fdocuments.net/reader035/viewer/2022062409/56814bbb550346895db88edc/html5/thumbnails/3.jpg)
Cut the DNA with restriction enzymes (each enzyme looks for a specific pattern)
Place fragmented DNA in the wells of a polyacrylamide gel and electrophoresis is performed (negative charge on top by wells and positive charge on bottom)
+
-
![Page 4: DNA Fingerprinting](https://reader035.fdocuments.net/reader035/viewer/2022062409/56814bbb550346895db88edc/html5/thumbnails/4.jpg)
•DNA has a negative charge, so the fragments of DNA are attracted toward the positive charge (bottom of gel).
•The smaller fragments of DNA will be able to move quicker toward the bottom than the larger pieces.
•Thus DNA is separated by size (smaller pieces toward the bottom and the larger pieces toward the top).
HOW DOES IT WORK???
+
-
10
9
8
7
6
5
4
3
2
1http://www.dnalc.org/resources/animations/gelelectrophoresis.html
http://www.pbs.org/wgbh/nova/sheppard/cleared.html
![Page 5: DNA Fingerprinting](https://reader035.fdocuments.net/reader035/viewer/2022062409/56814bbb550346895db88edc/html5/thumbnails/5.jpg)
![Page 6: DNA Fingerprinting](https://reader035.fdocuments.net/reader035/viewer/2022062409/56814bbb550346895db88edc/html5/thumbnails/6.jpg)
ON PAPER WHAT WOULD IT LOOK LIKE?
![Page 7: DNA Fingerprinting](https://reader035.fdocuments.net/reader035/viewer/2022062409/56814bbb550346895db88edc/html5/thumbnails/7.jpg)
You would be given a sequence of DNA and told of a restriction enzyme that cuts at a particular sequence of base pairs.
You would then make a cut in the DNA (draw a line) to make the DNA fragments (you will be the restriction enzyme).
Remember: Restriction enzymes only cut 5’ to 3’
EXAMPLE:
GAATTCGGAATTCCATTGGTAAGAATTCGGTA
CTTAAGCCTTAAGGTAACCATTCTTAAGCCAT
Now count the number of DNA bases between each of the cut sites using the top DNA sequence only.
There are 7 bp between the 1st two cuts & then there are 15 bp between between the 2nd and
3rd cuts!!!!
7 15Restriction enzyme BAM H1: AATT
![Page 8: DNA Fingerprinting](https://reader035.fdocuments.net/reader035/viewer/2022062409/56814bbb550346895db88edc/html5/thumbnails/8.jpg)
Based on the counted number of base pairs in the DNA fragment, make a band at the appropriate spot in the gel using the ladder.
1234
56789
10
16
1211
131415
![Page 9: DNA Fingerprinting](https://reader035.fdocuments.net/reader035/viewer/2022062409/56814bbb550346895db88edc/html5/thumbnails/9.jpg)
![Page 10: DNA Fingerprinting](https://reader035.fdocuments.net/reader035/viewer/2022062409/56814bbb550346895db88edc/html5/thumbnails/10.jpg)
![Page 11: DNA Fingerprinting](https://reader035.fdocuments.net/reader035/viewer/2022062409/56814bbb550346895db88edc/html5/thumbnails/11.jpg)
DNA Fingerprints of a family (D=daughter, S=son)
What can you say about this family looking at their DNA fingerprints??
D1 & S1 are the biological offspring of both parentsD2 is the biological child of mom but not dadS2 is not the biological son of either of the parents tested
![Page 12: DNA Fingerprinting](https://reader035.fdocuments.net/reader035/viewer/2022062409/56814bbb550346895db88edc/html5/thumbnails/12.jpg)
![Page 13: DNA Fingerprinting](https://reader035.fdocuments.net/reader035/viewer/2022062409/56814bbb550346895db88edc/html5/thumbnails/13.jpg)
There’s been a murder!!!
![Page 14: DNA Fingerprinting](https://reader035.fdocuments.net/reader035/viewer/2022062409/56814bbb550346895db88edc/html5/thumbnails/14.jpg)
It’s time for some DNA Fingerprinting
• In the lab packet you need to do the following:– Circle chemicals needed– Underline the equipment needed– Highlight the purpose of this lab– Next to each step, write why you are doing this.
![Page 15: DNA Fingerprinting](https://reader035.fdocuments.net/reader035/viewer/2022062409/56814bbb550346895db88edc/html5/thumbnails/15.jpg)
Procedures for Casting GelsSeal the ends of the gel tray securely with strips of standard masking tape. Press the tape firmly to the edges of the gel tray to form a fluid-tight seal.
Place the gel tray flat on the lab table (Make it as level as possible).
Place the plastic comb into the appropriate slot of the gel tray. Gel combs should be placed within ½ inch of the end of the gel casting tray. The combs will form the wells into which the samples of DNA will be loaded.
Pour enough agarose to cover the gel comb teeth or to a depth of 0.5-0.75 cm. Do not move or handle the gel tray until the gel has solidified. This will take 10 to 20 minutes. It will appear cloudy, or opaque, when ready to use.
Carefully remove the comb from the solidified gel.
Remove the tape from the edges of the gel tray.
Place the tray into the DNA electrophoresis chamber so that the sample wells are at the black (cathode) end of the base. DNA samples will migrate towards the red (anode) end of the chamber during electrophoresis.