Dna Final Report

download Dna Final Report

of 36

Transcript of Dna Final Report

  • 7/29/2019 Dna Final Report

    1/36

    1. Introduction

    Computer chip manufacturers are furiously racing to make the next

    microprocessor that will topple speed records. Sooner or later, though, thiscompetition is bound to hit a wall. Microprocessors made of silicon will

    eventually reach their limits of speed and miniaturization. Chip makers need

    a new material to produce faster computing speeds.

    Scientists have found the new material they need to build the next

    generation of microprocessors. Millions of natural supercomputers exist

    inside living organisms, including your body. DNA (deoxyribonucleic acid)molecules, the material our genes are made of, have the potential to perform

    calculations many times faster than the world's most powerful human-built

    computers. DNA might one day be integrated into a computer chip to create

    a so-called biochip that will push computers even faster. DNA molecules

    have already been harnessed to perform complex mathematical problems.

    Despite their respective complexities, biological and mathematical

    operations have some similarities:

    The very complex structure of a living being

    is the result of applying simple operations to initial

    information encoded in a DNA sequence.

    The very complex structure of a living being

    is the result of applying simple operations toinitial information encoded in a DNA sequence

    (genes).

    All complex math problems can be reduced

    to simple operations like addition and subtraction.

  • 7/29/2019 Dna Final Report

    2/36

    For the same reasons that DNA was presumably selected for living

    organisms as a genetic material, its stability and predictability in reactions,

    DNA strings can also be used to encode information for mathematical

    systems.

    Human DNA

    While still in their infancy, DNA computers will be capable of

    storing billions of times more data than your personal computer. Scientists

    are using genetic material to create nano-computers that might take the place

    of silicon-based computers in the next decade.

    Israeli scientists have built a DNA computer so tiny that a trillion of

    them could fit in a test tube and perform a billion operations per second with

    99.8 percent accuracy.

    Instead of using figures and formulas to solve a problem, the

    microscopic computer's input, output and software are made up of DNA

  • 7/29/2019 Dna Final Report

    3/36

    molecules -- which store and process encoded information in living

    organisms.

    Scientists see such DNA computers as future competitors to for their

    more conventional cousins because miniaturization is reaching its limits and

    DNA has the potential to be much faster than conventional computers.

    "We have built a nanoscale computer made of biomolecules that is so

    small you cannot run them one at a time. When a trillion computers run

    together they are capable of performing a billion operations," Professor

    Ehud Shapiro of the Weizmann Institute in Israel told.

    It is the first programmable autonomous computing machine in which

    the input, output, software and hardware are all made of biomolecules.

    Although too simple to have any immediate applications it could form

    the basis of a DNA computer in the future that could potentially operate

    within human cells and act as a monitoring device to detect potentially

    disease-causing changes and synthesize drugs to fix them.

    The model could also form the basis of computers that could be used

    to screen DNA libraries in parallel without sequencing each molecule, which

    could speed up the acquisition of knowledge about DNA.

  • 7/29/2019 Dna Final Report

    4/36

  • 7/29/2019 Dna Final Report

    5/36

    When it is all mixed together in the test tube, the software and

    hardware operate on the input molecule to create the output.

    The DNA computer also has very low energy consumption, so if it is

    put inside the cell it would not require much energy to work.

    DNA computing is a very young branch of science that started less

    than a decade ago, when Leonard Adleman of the University of Southern

    California pioneered the field by using DNA in a test tube to solve a

    mathematical problem.

    Scientists around the globe are now trying to marry computer

    technology and biology by using nature's own design to process information.

    DNA to Chip formation

  • 7/29/2019 Dna Final Report

    6/36

    Scientific Idea Of DNA Computer

    For biological systems, DNA is a master problem solver, storing and

    manipulating prodigious amounts of information. Recently, researchers have

    been investigating whether the problem-solving power of DNA can be used

    to solve nonbiological problems, specifically, problems from computer

    science that are out of the reach of traditional computers. Would a DNA

    computer actually work? To answer this question, one must turn to

    mathematics.

    In a groundbreaking 1994 paper, Leonard Adleman described a

    laboratory experiment involving DNA and a problem known as the Directed

    Hamiltonian Path Problem. Because of their massive complexity, this problem and others like it have eluded solution by conventional computers;

    no known algorithm can solve them in a reasonable amount of time. DNA

    has the potential to solve these kinds of problems because of its capacity to

    store a great deal of information compactly and to speedily perform

  • 7/29/2019 Dna Final Report

    7/36

  • 7/29/2019 Dna Final Report

    8/36

    Information Storage In DNA

    For traditional computers, these two questions have been answered

    affirmatively. And this is why traditional computers work: What they do can

    be represented mathematically and proven to produce the right answers.

    Fuses may blow, screens may freeze up, and the Pentium chip might be

    faulty, but the underlying mathematics is flawless. What the DNA computer

    needed was similar mathematical bedrock. Happily for the investment

    capitalists, mathematicians have provided the proof.

    These results lift the DNA computer out of the realm of science

    fiction and put it on a firm mathematical foundation.

  • 7/29/2019 Dna Final Report

    9/36

  • 7/29/2019 Dna Final Report

    10/36

  • 7/29/2019 Dna Final Report

    11/36

    First Invented DNA Chip

    DNA computer components -- logic gates and biochips -- will take

    years to develop into a practical, workable DNA computer. If such a

    computer is ever built, scientists say that it will be more compact, accurateand efficient than conventional computers. In the next section, we'll look at

    how DNA computers could surpass their silicon-based predecessors, and

    what tasks these computers would perform.

  • 7/29/2019 Dna Final Report

    12/36

    4. The Experiment

    The Adleman experiment

    Adleman is often called the inventor of DNA computers. His article in

    a 1994 issue of the journal Science outlined how to use DNA to solve a

    well-known mathematical problem, called the directed Hamilton Path

    problem , also known as the "traveling salesman" problem. The goal of the

    problem is to find the shortest route between a numbers of cities, going

    through each city only once. As you add more cities to the problem, the

    problem becomes more difficult. Adleman chose to find the shortest route between seven cities.

    Directed Hamilton Path problem

    You could probably draw this problem out on paper and come to a

    solution faster than Adleman did using his DNA test-tube computer. Here

    are the steps taken in the Adleman DNA computer experiment:

  • 7/29/2019 Dna Final Report

    13/36

    1. Strands of DNA represent the seven cities. In genes,

    genetic coding is represented by the letters A, T, C and

    G. Some sequence of these four letters represented each

    city and possible flight path.2. These molecules are then mixed in a test tube, with some

    of these DNA strands sticking together. A chain of these

    strands represents a possible answer.

    3. Within a few seconds, all of the possible combinations of

    DNA strands, which represent answers, are created in the

    test tube.

    4. Adleman eliminates the wrong molecules through

    chemical reactions, which leaves behind only the flight

    paths that connect all seven cities.

    There is no better way to understand how something works than by

    going through an example step by step. So lets solve our own directed

    Hamiltonian Path problem, using the DNA methods demonstrated by

    Adleman. The concepts are the same but the example has been simplified to

    make it easier to follow and present.

    Suppose that I need to visit four cities: Houston, Chicago, Miami, and

    NY, with NY being my final destination. The airline Im taking has aspecific set of connecting flights that restrict which routes I can take (i.e.

    there is a flight from L.A. to Chicago, but no flight from Miami to Chicago).

    What should my itinerary be if I want to visit each city only once?

  • 7/29/2019 Dna Final Report

    14/36

    It should take you only a moment to see that there is only one route.

    Starting from L.A. you need to fly to Chicago, Dallas, Miami and then to

    N.Y. Any other choice of cities will force you to miss a destination, visit a

    city twice, or not make it to N.Y. For this example you obviously dont need

    the help of a computer to find a solution. For six, seven, or even eight cities,

    the problem is still manageable. However, as the number of cities increases,

    the problem quickly gets out of hand. Assuming a random distribution of

    connecting routes, the number of itineraries you need to check increases

    exponentially. Pretty soon you will run out of pen and paper listing all the

    possible routes, and it becomes a problem for a computer......or perhaps

    DNA. The method Adleman used to solve this problem is basically the

    shotgun approach mentioned previously. He first generated all the possible

    itineraries and then selected the correct itinerary. This is the advantage of

    DNA. Its small and there are combinatorial techniques that can quickly

    generate many different data strings. Since the enzymes work on many DNAmolecules at once, the selection process is massively parallel.

    When the number of cities gets to around one hundred it could take

    hundreds of years of conventional computer time to solve the problem, even

    with the most advanced parallel processing available.

    Adleman developed a method of manipulating DNA which, in effect,

    conducts trillions of computations in parallel. Essentially he coded each city

    and each possible flight as a sequence of 4 components. For example he

    coded one city as GCAG and another as TCGG.

  • 7/29/2019 Dna Final Report

    15/36

    Giving cities codes

    Specifically, the method based on Adlemans experiment would be as

    follows:

    1. Generate all possible routes.2. Select itineraries that start with the proper city and end

    with the final city.

    3. Select itineraries with the correct number of cities.

    4. Select itineraries that contain each city only once.

    Part I: Generate all possible routes

    Strategy : Encode city names in short DNA sequences. Encode

    itineraries by connecting the city sequences for which routes exist.

  • 7/29/2019 Dna Final Report

    16/36

    DNA can simply be treated as a string of data. For example, each city

    can be represented by a "word" of six bases:

    1. Los Angeles GCTACG

    2. Chicago CTAGTA

    3. Dallas TCGTAC

    4. Miami CTACGG

    5. New York ATGCCG

    The entire itinerary can be encoded by simply stringing together these

    DNA sequences that represent specific cities. For example, the route from

    L.A -> Chicago -> Dallas -> Miami -> New York would simply be

    GCTACGCTAGTATCGTACCTACGGATGCCG, or equivalently it could

    be represented in double stranded form with its complement sequence.

    So how do we generate this? Synthesizing short single stranded DNA

    is now a routine process, so encoding the city names is straightforward. The

    molecules can be made by a machine called a DNA synthesizer or even

    custom ordered from a third party. Itineraries can then be produced from the

    city encodings by linking them together in proper order. To accomplish this

    you can take advantage of the fact that DNA hybridizes with its

    complimentary sequence. For example, you can encode the routes between

    cities by encoding the compliment of the second half (last three letters) of

    the departure city and the first half (first three letters) of the arrival city. For

    example the route between Miami (CTACGG) and NY (ATGCCG) can be

    made by taking the second half of the coding for Miami (CGG) and the first

    half of the coding for NY (ATG). This gives CGGATG. By taking the

    complement of this you get, GCCTAC, which not only uniquely represents

  • 7/29/2019 Dna Final Report

    17/36

    the route from Miami to NY, but will connect the DNA representing Miami

    and NY by hybridizing itself to the second half of the code representing

    Miami (...CGG) and the first half of the code representing NY (ATG...). For

    example:

    Random itineraries can be made by mixing city encodings with the

    route encodings. Finally, the DNA strands can be connected together by an

    enzyme called ligase . What we are left with are strands of DNA representing

    itineraries with a random number of cities and random set of routes. For

    example:

    We can be confident that we have all possible combinations including

    the correct one by using an excess of DNA encodings, say 10^13 copies of

    each city and each route between cities. Remember DNA is a highly

    compact data format, so numbers are on our side.

    Part II: Select itineraries that start and end with the correct cities

    Strategy : Selectively copy and amplify only the section of the DNA

    that starts with LA and ends with NY by using the Polymerase Chain

    Reaction .

    After Part I , we now have a test tube full of various lengths of DNA

    that encode possible routes between cities. What we want are routes that

    start with LA and end with NY. To accomplish this we can use a techniquecalled Polymerase Chain Reaction (PCR), which allows you to produce

    many copies of a specific sequence of DNA. PCR is an iterative process that

    cycles through a series of copying events using an enzyme called

    polymerase . Polymerase will copy a section of single stranded DNA

  • 7/29/2019 Dna Final Report

    18/36

    starting at the position of a primer , a short piece of DNA complimentary to

    one end of a section of the DNA that you're interested in. By selecting

    primers that flank the section of DNA you want to amplify, the polymerase

    preferentially amplifies the DNA between these primers, doubling theamount of DNA containing this sequence. After many iterations of PCR, the

    DNA you're working on is amplified exponentially. So to selectively

    amplify the itineraries that start and stop with our cities of interest, we use

    primers that are complimentary to LA and NY. What we end up with after

    PCR is a test tube full of double stranded DNA of various lengths, encoding

    itineraries that start with LA and end with NY.

    Part III: Select itineraries that contain the correct number of

    cities.

    Strategy : Sort the DNA by length and select the DNA whose length

    corresponds to 5 cities.

    Our test tube is now filled with DNA encoded itineraries that start

    with LA and end with NY, where the number of cities in between LA and

    NY varies. We now want to select those itineraries that are five cities long.

    To accomplish this we can use a technique called Gel Electrophoresis ,

    which is a common procedure used to resolve the size of DNA. The basic

    principle behind Gel Electrophoresis is to force DNA through a gel matrix

    by using an electric field. DNA is a negatively charged molecule under mostconditions, so if placed in an electric field it will be attracted to the positive

    potential. However since the charge density of DNA is constant (charge per

    length) long pieces of DNA move as fast as short pieces when suspended in

    a fluid. This is why you use a gel matrix. The gel is made up of a polymer

  • 7/29/2019 Dna Final Report

    19/36

    that forms a meshwork of linked strands. The DNA now is forced to thread

    its way through the tiny spaces between these strands, which slows down the

    DNA at different rates depending on its length. What we typically end up

    with after running a gel is a series of DNA bands, with each bandcorresponding to a certain length. We can then simply cut out the band of

    interest to isolate DNA of a specific length. Since we known that each city is

    encoded with 6 base pairs of DNA, knowing the length of the itinerary gives

    us the number of cities. In this case we would isolate the DNA that was 30

    base pairs long (5 cities times 6 base pairs).

    Part IV: Select itineraries that have a complete set of cities

    Strategy : Successively filter the DNA molecules by city, one city at a

    time. Since the DNA we start with contains five cities, we will be left with

    strands that encode each city once.

    DNA containing a specific sequence can be purified from a sample of

    mixed DNA by a technique called affinity purification . This is

    accomplished by attaching the compliment of the sequence in question to a

    substrate like a magnetic bead. The beads are then mixed with the DNA.

    DNA, which contains the sequence you're after then hybridizes with the

    complement sequence on the beads. These beads can then be retrieved and

    the DNA isolated.

    So we now affinity purifies fives times, using a different city

    complement for each run. For example, for the first run we use L.A.'-beads

    (where the ' indicates compliment strand) to fish out DNA sequences which

    contain the encoding for L.A. (which should be all the DNA because of step

  • 7/29/2019 Dna Final Report

    20/36

    3), the next run we use Dallas'-beads, and then Chicago'-beads, Miami'-

    beads, and finally NY'-beads. The order isnt important. If an itinerary is

    missing a city, then it will not be "fished out" during one of the runs and will

    be removed from the candidate pool. What we are left with are the itinerariesthat start in LA, visit each city once, and end in NY. This is exactly what we

    are looking for. If the answer exists we would retrieve it at this step.

    Reading out the answer

    One possible way to find the result would be to simply sequence the

    DNA strands. However, since we already have the sequence of the cityencodings we can use an alternate method called graduated PCR . Here we

    do a series of PCR amplifications using the primer corresponding to L.A.,

    with a different primer for each city in succession. By measuring the various

    lengths of DNA for each PCR product we can piece together the final

    sequence of cities in our itinerary. For example, we know that the DNA

    itinerary starts with LA and is 30 base pairs long, so if the PCR product for

    the LA and Dallas primers was 24 base pairs long, you know Dallas is the

    fourth city in the itinerary (24 divided by 6). Finally, if we were careful in

    our DNA manipulations the only DNA left in our test tube should be DNA

    itinerary encoding LA, Chicago, Miami, Dallas, and NY. So if the

    succession of primers used is LA & Chicago, LA & Miami, LA & Dallas,

    and LA & NY, then we would get PCR products with lengths 12, 18, 24, and

    30 base pairs.

    The incredible thing is that once the DNA sequences had been created

    he simply "just added water" to initiate the "computation". The DNA strands

    then began their highly efficient process of creating new sequences based on

  • 7/29/2019 Dna Final Report

    21/36

    the input sequences.

    If an "answer" to the problem for a given set of inputs existed then it

    should amongst these trillions of sequences. The next (difficult) step was to

    isolate the "answer" sequences. To do this Adleman used a range of DNAtools. For example, one technique can test for the correct start and end

    sequences, indicating that the strand has a solution for the start and end

    cities. Another step involved selecting only those strands which have the

    correct length, based on the total number of cities in the problem

    (remembering that each city is visited once).

    Finally another technique was used to determine if the sequence for each

    city was included in the strand. If any strands were left after these processes

    then:

    A solution to the problem existed, and

    The answer(s) would be in the sequence(s)

    on the remaining strands.

    His attempt at solving a seven-city, 14 flight map took seven days of

    lab work. This particular problem can be manually solved in a few minutes

    but the key point about Adleman's work is that it will work on a much larger

    scale, when manual or conventional computing techniques become

    overwhelmed. "The DNA computer provides enormous parallelism... in one

    fiftieth of a teaspoon of solution approximately 10 to the power 14 DNA

    'flight numbers' were simultaneously concatenated in about one second".

  • 7/29/2019 Dna Final Report

    22/36

    Caveats

    Adleman's experiment solved a seven city problem, but there are two

    major shortcomings preventing a large scaling up of his computation. The

    complexity of the traveling salesman problem simply doesnt disappear

    when applying a different method of solution - it still increases

    exponentially. For Adlemans method, what scales exponentially is not the

    computing time, but rather the amount of DNA. Unfortunately this places

    some hard restrictions on the number of cities that can be solved; after the

    Adleman article was published, more than a few people have pointed out

    that using his method to solve a 200 city HP problem would take an amount

    of DNA that weighed more than the earth. Another factor that places limits

    on his method is the error rate for each operation. Since these operations are

    not deterministic but stochastically driven (we are doing chemistry here),

    each step contains statistical errors, limiting the number of iterations you can

    do successively before the probability of producing an error becomes greater

    than producing the correct result. For example an error rate of 1% is fine for 10 iterations, giving less than 10% error, but after 100 iterations this error

    grows to 63%.

    Conclusions of Experiment

    So will DNA ever be used to solve a traveling salesman problem with

    a higher number of cities than can be done with traditional computers? Well,considering that the record is a whopping 13,509 cities, it certainly will not

    be done with the procedure described above. It took this group only three

    months, using three Digital Alpha Server 4100s (a total of 12 processors)

    and a cluster of 32 Pentium-II PCs. The solution was possible not because of

  • 7/29/2019 Dna Final Report

    23/36

    brute force computing power, but because they used some very efficient

    branching rules. This first demonstration of DNA computing used a rather

    unsophisticated algorithm, but as the formalism of DNA computing becomes

    refined, new algorithms perhaps will one day allow DNA to overtakeconventional computation and set a new record.

    On the side of the "hardware" (or should I say "wetware"),

    improvements in biotechnology are happening at a rate similar to the

    advances made in the semiconductor industry. For instance, look at

    sequencing ; what once took a graduate student 5 years to do for a PhD

    thesis takes Celera just one day. With the amount of government funded

    research dollars flowing into genetic-related R&D and with the large

    potential payoffs from the lucrative pharmaceutical and medical-related

    markets, this isn't surprising. Just look at the number of advances in DNA-

    related technology that happened in the last five years. Today we have not

    one but several companies making "DNA chips," where DNA strands are

    attached to a silicon substrate in large arrays (for example Affymetrix's genechip). Production technology of MEMS is advancing rapidly, allowing for

    novel integrated small scale DNA processing devices. The Human Genome

    Project is producing rapid innovations in sequencing technology. The future

    of DNA manipulation is speed, automation, and miniaturization.

    And of course we are talking about DNA here, the genetic code of life

    itself. It certainly has been the molecule of this century and most likely the

    next one. Considering all the attention that DNA has garnered, it isnt too

    hard to imagine that one day we might have the tools and talent to produce a

    small integrated desktop machine that uses DNA, or a DNA-like

    biopolymer, as a computing substrate along with set of designer enzymes.

    http://www.affymetrix.com/http://www.affymetrix.com/
  • 7/29/2019 Dna Final Report

    24/36

    Perhaps it wont be used to play Quake IV or surf the web -- things that

    traditional computers are good at -- but it certainly might be used in the

    study of logic, encryption, genetic programming and algorithms, automata,

    language systems, and lots of other interesting things that haven't even beeninvented yet.

    The Restricted Model:

    Since Adleman's original experiment, several methods to reduce error

    and improve efficiency have been developed. The problems with

    implementing a DNA computer can be separated into two types:

    o Physical obstructions: difficulties with large scale

    systems and coping with errors

    o Logical obstructions: concerning the versatility of

    molecular computers and their capacity to

    efficiently accommodate a wide variety of

    computational problems

    The Restricted model of DNA computing solves several physical

    problems with the unrestricted model. The Restricted model simplifies the

    physical obstructions in exchange for some additional logical considerations.

    The purpose of this restructuring is to simplify biochemical operations and

    reduce the errors due to physical obstructions.

  • 7/29/2019 Dna Final Report

    25/36

    The Restricted model of DNA computing:

    o Separate: isolate a subset of DNA from a sample

    o Merging: pour two test tubes into one to perform

    union

    o Detection: Confirm presence/absence of DNA in a

    given test tube

    Despite these restrictions, this model can still solve NP-complete

    problems such as the 3-colourability problem, which decides if a map can be

    colored with three colors in such a way that no two adjacent territories havethe same color.

    Certain assumptions must be made about the oligonucleotides used in

    the manipulations:

    o Under easily achievable conditions (temperature,

    pH, etc.) each oligonucleotide reliably forms stable

    hybrids with its Watson-Crick complement

    o Under easily achievable conditions, each

    oligonucleotide reliably dissociates from its

    Watson-Crick complement

    o Under neither of the conditions above does any

    oligonucleotide form hybrids with itself or another

    oligonucleotide (except its complement), nor

    another oligonucleotide's Watson-Crick

    complement

  • 7/29/2019 Dna Final Report

    26/36

    Error control is achieved mainly through logical operations, such as

    running all DNA samples showing positive results a second time to reduce

    false positives. Some molecular proposals, such as using DNA with a

    peptide backbone for stability, have also been recommended.

  • 7/29/2019 Dna Final Report

    27/36

    Sequence of DNA Representation

  • 7/29/2019 Dna Final Report

    28/36

    Image of DNA representation

    Bit Representation Using DNA

  • 7/29/2019 Dna Final Report

    29/36

  • 7/29/2019 Dna Final Report

    30/36

    6. Comparison of DNA & Silicon

    DNA, with its unique data structure and ability to perform many

    parallel operations, allows you to look at a computational problem from a

    different point of view. Transistor-based computers typically handle

    operations in a sequential manner. Of course there are multi-processor

    computers, and modern CPUs incorporate some parallel processing, but in

    general, in the basic von Neumann architecture computer, instructions are

    handled sequentially. A von Neumann machine, which is what all modernCPUs are, basically repeats the same "fetch and execute cycle" over and

    over again; it fetches an instruction and the appropriate data from main

    memory, and it executes the instruction. It does these many, many times in a

    row, really, really fast. The great Richard Feynman, in his Lectures on

    Computation, summed up von Neumann computers by saying, "the inside of

    a computer is as dumb as hell, but it goes like mad!" DNA computers,

    however, are non-von Neuman, stochastic machines that approach

    computation in a different way from ordinary computers for the purpose of

    solving a different class of problems.

    Typically, increasing performance of silicon computing means faster

    clock cycles (and larger data paths), where the emphasis is on the speed of

    the CPU and not on the size of the memory. For example, will doubling theclock speed or doubling your RAM give you better performance? For DNA

    computing, though, the power comes from the memory capacity and parallel

    processing. If forced to behave sequentially, DNA loses its appeal. For

    example, let's look at the read and write rate of DNA. In bacteria, DNA can

  • 7/29/2019 Dna Final Report

    31/36

    be replicated at a rate of about 500 base pairs a second. Biologically this is

    quite fast (10 times faster than human cells) and considering the low error

    rates, an impressive achievement. But this is only 1000 bits/sec, which is a

    snail's pace when compared to the data throughput of an average hard drive.But look what happens if you allow many copies of the replication enzymes

    to work on DNA in parallel. First of all, the replication enzymes can start on

    the second replicated strand of DNA even before they're finished copying

    the first one. So already the data rate jumps to 2000 bits/sec. But look what

    happens after each replication is finished - the number of DNA strands

    increases exponentially (2^n after n iterations). With each additional strand,

    the data rate increases by 1000 bits/sec. So after 10 iterations, the DNA is

    being replicated at a rate of about 1Mbit/sec; after 30 iterations it increases

    to 1000 Gbits/sec. This is beyond the sustained data rates of the fastest hard

    drives.

    Now let's consider how you would solve a nontrivial example of the

    traveling salesman problem (# of cities > 10) with silicon vs. DNA. With avon Neumann computer, one naive method would be to set up a search tree,

    measure each complete branch sequentially, and keep the shortest one.

    Improvements could be made with better search algorithms, such as pruning

    the search tree when one of the branches you are measuring is already longer

    than the best candidate. A method you certainly would not use would be to

    first generate all possible paths and then search the entire list. Why? Well,

    consider that the entire list of routes for a 20 city problem could theoretically

    take 45 million GBytes of memory (18! routes with 7 byte words)! Also for

    a 100 MIPS computer, it would take two years just to generate all paths

    (assuming one instruction cycle to generate each city in every path).

  • 7/29/2019 Dna Final Report

    32/36

    However, using DNA computing, this method becomes feasible! 10^15 is

    just a nanomole of material, a relatively small number for biochemistry.

    Also, routes no longer have to be searched through sequentially. Operations

    can be done all in parallel.

  • 7/29/2019 Dna Final Report

    33/36

    7. Conclusion

    A Successor to Silicon

    Silicon microprocessors have been the heart of the computing world

    for more than 40 years. In that time, manufacturers have crammed more and

    more electronic devices onto their microprocessors. In accordance with

    Moore's Law , the number of electronic devices put on a microprocessor has

    doubled every 18 months. Moore's Law is named after Intel founder Gordon

    Moore, who predicted in 1965 that microprocessors would double incomplexity every two years. Many have predicted that Moore's Law will

    soon reach its end, because of the physical speed and miniaturization

    limitations of silicon microprocessors.

    DNA computers have the potential to take computing to new levels,

    picking up where Moore's Law leaves off. There are several advantages to

    using DNA instead of silicon:

    As long as there are cellular organisms, there will always

    be a supply of DNA.

    The large supply of DNA makes it a cheap resource.

    Unlike the toxic materials used to make traditional

    microprocessors, DNA biochips can be made cleanly .

    DNA computers are many times smaller than today's

    computers.

    DNA's key advantage is that it will make computers smaller than any

    computer that has come before them, while at the same time holding more

  • 7/29/2019 Dna Final Report

    34/36

    data. One pound of DNA has the capacity to store more information than all

    the electronic computers ever built; and the computing power of a teardrop-

    sized DNA computer, using the DNA logic gates, will be more powerful

    than the world's most powerful supercomputer. More than 10 trillion DNAmolecules can fit into an area no larger than 1 cubic centimeter (0.06 cubic

    inches). With this small amount of DNA, a computer would be able to hold

    10 terabytes of data, and perform 10 trillion calculations at a time. By

    adding more DNA, more calculations could be performed.

    Unlike conventional computers, DNA computers perform calculations

    parallel to other calculations. Conventional computers operate linearly,

    taking on tasks one at a time. It is parallel computing that allows DNA to

    solve complex mathematical problems in hours, whereas it might take

    electrical computers hundreds of years to complete them.

    The first DNA computers are unlikely to feature word processing,

    e-mailing and solitaire programs. Instead, their powerful computing power

    will be used by national governments for cracking secret codes, or by

    airlines wanting to map more efficient routes. Studying DNA computers

    may also lead us to a better understanding of a more complex computer --

    the human brain.

  • 7/29/2019 Dna Final Report

    35/36

    8. Bibliography

    Books

    1. Adleman, L. 1994. Molecular computation of solutions to

    combinatorial problems. Science 266:1021-1024.

    2. Lipton, R. J. Speeding up computations via molecular biology.

    (unpublished manuscript)

    3. Boneh, D., Lipton, R. J. Making DNA computers error

    resistant. (unpublished manuscript )

    4. Kari, L. 1997. DNA computing: the arrival of biological

    mathematics. (Unpublished manuscript).

    5. Adleman, L. 1995. On constructing a molecular computer.

    (unpublished manuscript )

    Web Sites

    1. www.usc.edu/dept/molecular-science/fm-papers.htm

    2. www.arstechnica.com/reviews/2q00/dna

    3. www.brooklynuniv.molacular.edu/dna_computer.html

    4. www.hypography.com/article.cfm/32402.html

    5. www.howstuffworks.com/computer/future

    6. www.bioplanet.com/chat/discuss/messages/1095.htm

    7. www.4tpgi.com.au/users/aoaug/dna_comp.html

    http://www.usc.edu/dept/molecular-science/fm-papers.htmhttp://www.arstechnica.com/reviews/2q00/dnahttp://www.brooklynuniv.molacular.edu/dna_computer.htmlhttp://www.hypography.com/article.cfm/32402.htmlhttp://www.howstuffworks.com/computer/futurehttp://www.bioplanet.com/chat/discuss/messages/1095.htmhttp://www.4tpgi.com.au/users/aoaug/dna_comp.htmlhttp://www.usc.edu/dept/molecular-science/fm-papers.htmhttp://www.arstechnica.com/reviews/2q00/dnahttp://www.brooklynuniv.molacular.edu/dna_computer.htmlhttp://www.hypography.com/article.cfm/32402.htmlhttp://www.howstuffworks.com/computer/futurehttp://www.bioplanet.com/chat/discuss/messages/1095.htmhttp://www.4tpgi.com.au/users/aoaug/dna_comp.html
  • 7/29/2019 Dna Final Report

    36/36