DNA elements responsive to auxin

e Review articles

DNA elements responsive to auxin Steffen Abel, Nurit Ballas, Lu-Min Wong and Athanasios Theologis

Summary

Genes induced by the plant hormone auxin are probably involved in the execution of vital cellular functions and developmental processes. Experimental approaches designed to elucidate the molecular mechanisms of auxin action have focused on auxin perception, genetic dissection of the signaling apparatus and specific gene activation. Auxin-responsive promoter elements of early genes provide molecular tools for probing auxin signaling in reverse. Functional analysis of several auxin-specific promoters of unrelated early genes suggests combinatorial utilization of both conserved and variable elements. These elements are arranged into autonomous domains and the combination of such modules generates uniquely composed promoters. Modular promoters allow for auxin-mediated transcriptional responses to be revealed in a tissue- and Accepted development-specific manner.

Introduction The phytohormone indole-3-acetic acid (IAA or auxin) is an indispensable regulator of plant growth and development. It has been implicated in regulating a large number of developmental and cellular processes by altering basic patterns of gene expre~sion(l-~). For example, auxin-mediated cell elongation, one of the fastest hormonal responses in plant^(^,^), depends on gene expression(7) and is accompa- nied by the activation of a select set of early gened8-10). The signal transduction cascades leading to auxin-mediated gene activation, however, are still unknown. The lack of functionally defined auxin receptors, and of a simple pheno- typic trait that is specifically linked to auxin action, have hin- dered the elucidation of the auxin signaling apparatus using biochemical and genetic strategies. In contrast recent excit- ing progress has been made in understanding the ethylene signaling apparatus, which is largely based on a simple ethylene-specific morphological trait, the triple response. This phenotype has been exploited to identify genetically many of the components involved in ethylene signal transduction(’ ).

Alternatively, auxin-responsive promoter elements of primary genes, i.e. genes that are among the first to be tran- scriptionally activated by auxin, provide specific probes for access and exploration of the auxin signaling apparatus in reverse (Fig. 1 ). This strategy has been successfully applied to trace back the short path by which interferon signals are transmitted from the plasma membrane to the cell nucleus. The discovery of the Jak-STAT pathway was achieved by using well-defined interferon-stimulated promoter response

3 May 1996

elements and by employing biochemical and reverse genetic approaches, which led to congruent results(I2). Over the past decade, several classes of early auxin- inducible genes have been isolated and structurally characterized(13-15). More recently, putative auxin-responsive promoter elements have been functionally identified for at least one representative member of those gene families(16-22). These DNA elements are now being used as molecular probes to bridge the gap between auxin-mediated gene activation and auxin perception.

Primary genes activated by auxin By definition, induction of primary response genes by cognate ligands is independent of de novo protein synthesis(23).

Auxin Perception

0

(AU:RE>

x x x x

(AUXRE)

Reporter Gene

Biochemistry Reverse Genetics

Fig. 1. Strategies for probing the auxin signaling apparatus.

BioEssays Vol. 18 no. 8 647 0 ICSU Press 1996 pp. 647-654 810954

Review articles

Table 1. Primary auxin-responsive genes Rapidity of

Gene response’ Specificityt

Aux/lAA Family 5 minutes Cycloheximide

SAUR Family 3 minutes Cycloheximide GH3-li ke 5 minutes -

ACS 20 minutes Cycloheximide GH2/4like 15 minutes Cycloheximide,

others

Function Reference

Transcription 15

Unknown 13 Unknown 13 ACC-synthase 32, 62 Glutathione 13, 14

factors

S-transferase

*As detected by in vitro nuclear runoff transcription or by changes of

hducers other than auxin. steady-state mRNA levels.

This implies that their transcriptional activation is mediated by preexisting components that relay the extracellular stimulus to the cell nucleus by posttranslational events. Protein synthesis inhibitors, such as cycloheximide or anisomycin, have therefore traditionally been used to characterize early gene expression(23~24). Interestingly, apart from its use to classify genes, inhibition of protein synthesis alone often induces primary genes and thereby unmasks regulatory mechanisms of gene activation. For example, a common characteristic of many mammalian oncogenes is their inducibility by cycloheximide alone. This has been attributed to the depletion of a short-lived protein(s) involved in negative transcriptional and/or posttranscriptional regulation of primary gene~( ’~9~~) . In various early inducible systems, including early auxin-responsive genes, the concomitant presence of cycloheximide and the cognate ligand result in superinduction of the mRNAs.

Five major classes of early auxin-responsive genes have been characterized as primary genes (Table 1). Most of those respond to cycloheximide alone, except for GH3from soybean, whose auxin inducibility is insensitive to protein synthesis i nh ib i t o r~ (~~1~~) . All families except the GH2/4-like genes are specifically activated by auxin. GHa4-related mRNAs are often additionally induced by a wide variety of agents and environmental stimuli(” ,22,27). Comparison of promoter sequences of primary auxin genes has identified various conserved regions that have been proposed as candidates for auxin-responsive element^(^^^^^^^). In this review only promoter elements that have been experimentally identified will be discussed.

Auxin-responsive promoter elements and domains The term ‘auxin responsive element’ (AuxRE) defines a single binding site of a factor that is involved in auxin-mediated transcriptional activation. It is unlikely that such hormone response elements function by themselves(30) and, therefore, we have defined the ‘auxin responsive domain’ (AuxRD) as an autonomous complex of elements involved in transcriptional regulation by auxin(17). This term is used synonymously with the terms ‘hormone response unit’(30)

and ‘hormone response complex’(31). Functional promoter analyses of the auxin-specific genes, PS-IAA4/5, GH3 and SAUR 75A, suggest the existence of a limited set of sequence elements that are utilized in a combinatorial manner to confer high levels of auxin inducibility. These elements are conserved among other members of the gene families, and in the auxin-regulated promoters of the ACS g e n e ~ ( ~ ~ , ~ * ) (Fig. 2).

PS-IAA4/5 The most thoroughly analyzed member of the large Aux/lAA gene family is PS-IAAN5 from pea(16,17,29,33-38). Deletion analysis of the PS-IAA4/5 promoter in a homologous tran- sient expression system and in transgenic tobacco plants reveals the presence of two distinct functional regions: sequences upstream of position -31 8 are responsible for low level constitutive expression, whereas sequences downstream of position -31 8 confer 40-fold auxin inducibility. The 164-bp region between positions -31 8 and -1 54 is necessary and sufficient for auxin-inducible reporter gene expression in pea p r o t ~ p l a s t d ~ ~ ~ ~ ~ ) . Further loss-of-function analysis by linker-scanning mutagenesis divides this region into two AuxRDs, the 48-bp domain A and 44-bp domain B (see Fig. 2). Both domains act cooperatively to stimulate transcription when fused to the PS-IAA4/5 or CaMV 35s core promoters. However, tetramerization of domain A or domain B compensates for the loss of B or A function, respectively. Domain A functions as the major auxin- responsive switch whose activity is orientation- and position-dependent. Domain B has characteristic features of an enhancer element since its activity is orientation- and position-independent; furthermore, it can function over a long distance(17). In addition, domain B may also contain a less efficient AuxRE, whose activity is amplified by multimerization(17). A 17-bp sequence of domain B is conserved in promoters of Aux/lAA genes and in ACS4, and domain A contains three sequence motifs that are well conserved in the promoters of Aux/lAA, SAUR and auxin-inducible ACS genes(29,32) (Fig. 2). The minimal AuxREs of domain A and domain B remain to be determined.

Both AuxRDs of the PS-/AA4/5 promoter interact with specific transcription factor^('^^'^). DNase I footprinting experiments show binding of nuclear proteins from pea to the core motif of domain B and to two sequence elements of domain A, one of which coincides with the central TGTCAC motif and the other partially overlaps with 5‘ nucleotides of the TGTCCCAT sequence(I6). In vivo competition assays with icosamers of domain A or domain B demonstrate functional DNA-protein interactions between the two domains and their specific factors(I7). These experiments indicate the presence of low abundance, positive transcription factors that bind to the two domains with different affinities; domain A competes for its cognate factor(s) more efficiently than domain B. Furthermore, cross-competition experi-

648 Vol. 18 no. 8 BioEssays

e Review articles

I I I I I -401 -301 -201 -1 01 -1

B A

PS-/AA4/5 TGTCCCATtctTGTCaCccctATAAG

GH3 [ CCTCGTGTCTC I c t c AATAAG [ CACGCAATc c t t TGTCTCAATAAG 1 D1 D4

NDE

SAUR 15A TGTCTCtcaattgGTCCCAT

A CS4

ocs I GH2/4

TGATGTAAGAGATTACGTAA ments suggest protein-protein interactions between the factors that bind to domains A and B, respectively(").

GH3 Functional analysis of the 592-bp soybean GH3 promoter in carrot protoplasts and transgenic tobacco plants has identified three independently acting AuxRDs. These domains contribute incrementally to auxin inducibility of the GH3 promoter (10- to 20-fold)(18). The major response to the hormone is mediated by the 76-bp region between positions -1 83 and -1 08. However, sequences between positions 249 and -203, AuxRD E l , are also sufficient and required for maximal levels of auxin inducibility. The 76-bp region contains two independent AuxRDs, the 25-bp fragment D1 and the 32-bp fragment D4. Both domains contain the core sequence TGTCTC(nnn)AATAAG that is also conserved in the promoters of PS-/AA4/5and ACS4 (Fig. 2) . More refined deletion and linker-scanning analyses indicate that the upstream motif, TGTCTC, is necessary though not sufficient for auxin inducibility of the D1 and D4 domains(Ig). Additional nucleotides upstream of the TGTCTC motif are also required for auxin inducibility. Interestingly, in the presence of a mutated or deleted TGTCTC motif, the sequences upstream of that element confer constitutive activity that is higher than the basal activity of the wild-type configuration(lg). The constitutive element of domain D1, CCTCGTGT, overlaps with the 5' half of the TGTCTC motif, whereas the constitutive element of domain D4, CACG- CAAT, is positioned four nucleotides upstream of the TGTCTC sequence (Fig. 2).

Gel mobility shift assays with domains D1 and D4, respectively, demonstrate specific binding of soybean

Fig. 2. Modular composition of auxin-responsive promoters. Promoter regions that are necessary and sufficient to confer high levels of auxin inducibility (AuxRDs) are boxed and shaded (gray). Within such AuxRDs, the positions of core sequences that are conserved in other promoters are indicated by colored boxes; the actual sequences are given above and below in the same color. Sequences in domains D1 and D4 of GH3 that have been identified by high resolution analysis to be sufficient for auxin inducibility are given in brackets. The constitutive elements of these minimal AuxRDs are underlined.

nuclear proteins to the constitutive sequence elements(lg). Interestingly, the sequence of the constitutive element in D1, CCTCGTGT, has similarity with a G-box binding site and binds to a recombinant bZlP protein from soybean with G-box specificity. However, there is no evidence yet for sequence-specific binding of nuclear proteins to the TGTCTC motif(lg).

SAUR 15A The conserved promoter sequences of the soybean

SAUR gene family, known as the DUE/NDE element, were proposed to be responsible for auxin inducibility(39). Deletion analysis of the SAUR 15A promoter (tenfold auxin inducibility), indicates the presence of at least one major auxin-responsive domain in the 1 IO-bp fragment between positions -213 and -103. This fragment contains the DUE/NDE element and is sufficient for conferring auxin inducibility to a minimal CaMV35S promoter and its activity is greatly enhanced upon multimerization(20). Internal deletions show that the NDE portion of the DUE/NDE element is necessary for conferring high levels of auxin inducibility to the SAUR 15A promoter(20). The NDE element contains two adjacent sequences, TGTCTC and GGTCC- CAT, which have been identified as putative AuxREs in GH3 and PS-/AA4/5, respectively (Fig. 2). Similar sequences are also conserved in the SAUR-AC1 gene from Arab id~ps id~~) . Gel mobility shift assays demonstrate specific binding of soybean nuclear proteins to the DU E/N DE fragment(20).

G H2/4 A representative of a fifth major class of early auxin-

BioEssavs Vol. 18 no. 8 649

Review articles

inducible genes, GH2/4 from soybean (see Table I ) , is activated by auxin via an ocs-like element(21). This element belongs to a family of related sequences (as-1 , nos-1 , ocs), which regulate transcription of several viral and agrobacter- ial genes(27). The ocs-like elements contain two strictly spaced binding sites (ACGT core sequence) for plant bZlP proteins(41). Occupation of both sites is required for func- ti or^(^^). GH2/4 was the first plant promoter to be identified that contains a functional ocs-like element, TGATGTAAGA- GATTACGTAA. Similar sequence elements were found by database searches in GH2/4-related genes(27). The ocs-like element is not only activated by auxin, but also by other plant hormones, inactive auxin analogs and stress-inducing agents. This is consistent with the induction profile of GHH4-like genes that encode glutathione S-trans- f e r a ~ e s ( ~ ~ , ~ ~ ) . It has been argued that ocs-like elements are the target of a common stress-related signal transduction pathway that is different from the auxin-specific signaling cascades(27). This proposition is strongly supported by the absence of functional ocs-like elements in the promoters of auxin-specific primary genes. Furthermore, the auxin inducibility of a GH2/4-like tomato gene is not inhibited in the auxin-insensitive dgt mutant of tomato. This mutant, however, inhibits expression of Aux/lAA, SAUR and ACS genes(44) (K. Kawakita and A. Theologis, unpublished data), indicating operation of at least two different auxin-response pathways.

Modular composition of auxin-responsive promoters Each of the minimal AuxRDs of the GH3 promoter, D1 and D4, is composed of two cooperating elements. One conserved element, TGTCTC, confers auxin inducibility, and a variable element confers constitutive expression(1g). The composite nature of these AuxRDs is elegantly demon-

GH3

synthetic Auxin

Arny3b

synthetic Gibberellic Acid

Abscisic Acid 2 0 H VAZZ

Ethylene PR- 1

Jasmonic Acid 2 6 vsps

Fig. 3. Composite structure of piant hormone response compiexes. For various horrnonally inducible promoters and synthetic hormone response complexes, the hormone-inducible element (blue) and the coupling element (gray) are boxed and the length of the spacer is given. GAL4, GAL4 DNA binding site; 0 2 5 Opaque-2 DNA binding site; GARE, gibberellic acid response element; ABRE, abscisic acid response element; CE1, coupling element; ERE, ethylene response element. Sources of the sequences are: GH3(’9), An1y3Zb(~~). HVA22(47,59), PR-7(6O), Vspi3@’).

strated by replacing the constitutive element with the GAL4 DNA binding site. Transcriptional activation by a GAL4-c- Re1 fusion protein is greatly enhanced in the presence of auxin. However, the transactivation by the fusion protein is constitutive with a mutated TGTCTC element(lg). These data suggest that different elements, when positioned proxi- mal to the TGTCTC element, have the potential to generate a variety of AuxRDs with different properties and activities. The composite structure of GH3 AuxRDs, assembled from two juxtaposed or overlapping motifs, is reminiscent of the composite arrangement of animal hormone response units that are simultaneously recognized by API protein complexes and nuclear hormone receptor^(^^,^^). A multitude of both positive and negative cell-specific and promoter con- text-dependent interactions between nuclear hormone receptors and AP1 factors have been demonstrated. Inter- estingly, the balance of APl components determines cell- specificity, magnitude and direction of the hormonal r e s p o n ~ e ( ~ ~ 9 ~ ~ ) . In plants, G-box binding bZlP proteins have been proposed to function as general regulators of transcription, in response to a variety of different environmental and physiological signals that are perceived by proteins bound to adjacent sited4”). Accordingly, the ‘coupling model’ of plant hormone response complexes proposes the functional interaction of a hormone-inducible element with a coupling element that confers spatio-temporal specificity of e x p r e s ~ i o n ( ~ l ! ~ ~ ) (Fig. 3). Both elements are necessary for hormonal gene activation and may facilitate cooperative binding of cognate factors and/or synergistic recruitment of additional proteins required for transcriptional activation. Interaction of both elements appears to be limited by tight positional and spatial constraints, as shown for the gibberellic acid response complex (GARC)(31). However, the sequences of the coupling element of the ‘plant hormone response complexes’ may vary considerably for a given hormone. Coupling elements, which are frequently binding sites for G-box binding bZlP proteins, are interchangeable in at least two instances (Fig. 3). The composite nature of the ‘hormone response complexes’ allows the communica- tion between and within classes of transcription factors via heterotypic intra- and interfamily protein-protein interactions to specify hormonally regulated gene activation(30). For example, the 02s coupling element of the GARC partially overlaps with the ‘endosperm-box’ that limits GA-regulated expression of the Amy32b promoter to cells in the grain endo~perm(~*). Likewise, a tetramer of the minimal 11-bp AuxRD D1 (see Fig. 2) still confers highly confined tissue- specific expression of a reporter gene in transgenic tobacco plants, similar to that observed with the authentic GH3 pro- m0ter(~9149).

A structural and possibly functional relationship between the TGTCTC motif in AuxRDs D1 and D4 of the GH3 promoter and the T/GGTCCCAT element of fS-/AA4/5 AuxRD A and SAUR 15A NDE has been pointed This is further suggested by the observation that mutation of the


e Review articles

internal TC dinucleotide of the TGTCTC element of GH3 domain D1 eliminates auxin ind~cibility(’~). In fact, 12 tandemly repeated copies of the PS-/AA4/5 TGTCCCAT element confer high levels of auxin inducibility to a minimal heterologous promoter in transfected pea pro top last^('^). This indicates that the TGTCCCAT element is inherently auxin-inducible, but requires an additional element(s) of the autonomous AuxRD A to couple the auxin effect to the basic transcriptional machinery. Candidates for such an element are the related downstream TGTCAC motif, which may provide a tandem site for cooperative binding of TGTCCTTC- related binding factor(s), and/or variable sequences at both boundaries of the AuxRD A (see Fig. 2). It should be pointed out that these flanking sequences are required for auxin inducibility of AuxRD A, as shown by deletion and linker- scanning mutagenesis analysis. These sequences are either protected or hypersensitive in a DNase I footprint assay(16ri7). It is of great interest that a G-box sequence, TCCACGTGTC, overlaps with a single copy TGTCAC core motif in the putative AuxRD A domain of a homologous auxin-responsive gene, GmAux28, from soybead2*). Pro- tein factors interacting with this G-box sequence have been cloned and may represent such a coupling factor(50). They may be similar to the G-box binding proteins that recognize the constitutive element within AuxRD D1 of the GH3 promoter(’9). A tandem configuration of TGTCCTTC-related elements similar to that in AuxRD A of PS-IAA45 is present in the NDE domain of the SAUR 75A promoter(20) (Fig. 2). Again, both elements may promote cooperativity and/or require additional, unidentified coupling elements to confer maximal auxin inducibility. A composite nature of AuxRD A

PS-lAA4/5

B n A

i i

of PS-IAA4/5 and NDE of SAUR 15A is corroborated by their ability to direct tissue-specific expression in transgenic plants(20) (Y. Oono and A. Theologis, unpublished data).

The current data indicate that promoters of three unrelated auxin-specific genes utilize a limited set of cis- elements in a combinatorial manner to mediate transcriptional activation in response to auxin. Auxin-regulated ACS genes may constitute a fourth class, which use the same set of element^(^^,^^) (Fig. 2). Combinatorial arrangements of AuxREs and coupling elements into autonomous AuxRDs, and the combination of such modules, appear to be the basic design of auxin-responsive promoters. Modularity is a hallmark of promoters, and the constellation of elements allows for autonomous, additive and cooperative regulation of transcription in a manner specified by the stimulus, tissue type and developmental stage(30).

Models of auxin-specific gene activation Transcriptional activation of Aux//AA, GH3 and SAUR genes by auxin is a rapid event (see Table l ) , which occurs by unknown mechanisms. The simplest view is that the IAA molecule enters the cell by an active transport mechanism and subsequently diffuses into the nucleus, where it is sensed by a protein that either directly or indirectly interacts with an AuxRD and the basic transcriptional machinery(34). Alternatively, auxin may be perceived by a receptor located in the plasma membrane(51). This interaction could activate an intracellular signal transduction pathway, e.g. a protein kinase cascade, or may generate second messengers, such as Ca2+ or inositol triphosphate, which in turn activate

GH3

D1 or D4

0 0 0 Fig. 4. Models for transcriptional activation of PS-IAA4/5 and

GH3 by auxin. Experimentally identified AuxRDs are essentially depicted as in Fig. 2. A and 8, transcriptional factors that bind to AuxRD A and AuxRD B. resDectivelv. of PS-/AA4/5; R, steric repressor: Const., constitutive element of AuxRD D1 or AuxRD D4 of GH3; X, mutated or deleted TGTCTC motif. Hypothetical surfaces of transcription factors, which are proposed to interact (interaction indicated by two dots) with the basic transcriptional machinery (not indicated) are white.

BioEssavs Vol. 18 no. 8 651

Review articles

Gibberellic Abscisic Hormone Auxin Ethylene Acid Acid

Receptor ? ETR ? ?

Primary Gene

Fia. 5. Hierarchical reoulation of aene exDression bv Dlant - - - hormones AuxRE, auxin-responsive element, ETR, ethylene receptor(’’), EREBP, ethylene response element binding protein(57),

Secondary Gene GARC, gibberellic acid response ABRC, abscisic acid response

transcription factors involved in auxin-regulated gene expression(34). The current experimental evidence is not sufficient to favor any of these models, all of which must accomodate transcriptional enhancement by protein synthesis inhibitors (Table 1).

PS-IAA415-like and SAUR genes Induction of PS-/AA4/5 by protein synthesis inhibitors is accomplished by both transcriptional activation and mRNA stabilization(34). This is probably the case for most of the PS- /AA4/5-like genes, since the majority of the IAA gene family members of Arabidopsis are induced by cycl~heximide(~~). A similar dual effect of cycloheximide has been found with the Arabidosis SAUR-AC1 gene(40j53). The data with the soybean SAUR 15A gene, however, appear to discount the effect of cycloheximide on transcriptional a~ t i va t i on (~~1~~) . Transcriptional activation by inhibition of protein synthesis has been interpreted to suggest that the PS-/AA4/5 gene is under negative control of a short-lived repressor polypeptide, or of a regulatory pathway that contains a short-lived ~ o m p o n e n t ( l ~ ~ ~ ~ ~ ~ ~ ) . Such eukaryotic transcriptional repressors have been described and can act on processes as early as nuclear localization of transcriptional activators or as late as promoter clearance by RNA polymerase IW). The putative PS-/AA4/5 repressor does not directly bind to the auxin-inducible region of the promoter, since neither linker-scanning mutagenesis analysis nor in vivo competition experiments with promoter fragments derepresses the PS-/AA4/5 promoter in the absence of auxin(I7). The follow- ing models of transcriptional activation by auxin and cycloheximide are plausible. On the first, the putative repressor acts by steric hindrance, and this short-lived protein is proposed to interact with the positive factors A and B, inhibiting their transactivating p ~ t e n t i a I ( ’ ~ ~ ~ ~ ~ ~ ~ ) . This is typical of pas- sive transcriptional rep re~s ion (~~1~~) . Auxin may mediate transcriptional activation by alleviating the interaction of the repressor with the activator(s) (Fig. 4). In order to achieve repressor dissociation, auxin can change the conformation of the positive factor(s) or of the repressing polypeptide, either by direct binding or by inducing covalent modification of either component(34). If the proposed repressor is stable, however, an auxin-induced cascade reaction has to be

evoked for modifying the repressor (or the activator). This pathway contains a short-lived component, e.g. a protein kinase. In the second model, the putative repressor is a pathway that inhibits the activity of the positive factor(s) by covalent modification (e.g. via phosphorylation). In this case, a short-lived protein is part of that modification cascade, and auxin signals could either eliminate the activity of that protein or activate the opposing modification reaction (i.e. dephosphorylation).

GH3 - a variation on a common theme? Inducibility of the soybean GH3 gene by protein synthesis inhibitors has not been studied in detai1(25126). The experimental evidence suggests that, unlike PS-/AA4/5 and SAUR genes, the transcription of GH3 is not induced by inhibiting protein s y n t h e s i ~ ( ~ ~ , ~ ~ ) . This suggests that the activation of GH3does not involve short-lived repressor protein(s). Although the TGTCTC motif of AuxRDs D1 and D4 is insufficient as an AuxRE, multiple copies of this sequence with appropriate spacing confer strong auxin inducibility to a minimal heterologous promoter(lg). Similar results have been obtained with the TGTCCCAT sequence of PS- IAA4/5(l7). These observations suggest that the TGTCTC binding factor is inherently auxin-inducible and requires cooperative protein-protein interactions for DNA binding. Such cooperative recruitment can be facilitated by the factor(s) occupying the constitutive element in the D1 or D4 domain. In the uninduced state, the activity of the constitutive transcription factor is inhibited by the TGTCTC binding protein. Auxin action can change the conformation of the TGTCTC binding factor, resulting in the relief of the interfer- ence and synergistic activation of trans~ription(’~). It is con- ceivable that the repressing activity of the TGTCTC element on the adjacent constitutive or other coupling elements is indirectly achieved by recruiting a stable repressor polypeptide, which may be functionally analogous to the repressor of PS-/AA4/5gene activation (Fig. 4). The different nature of the putative GH3 repressor may support a view of greater diversity among auxin-regulated promoters. It also indicates that the basic design and logistics of auxin-responsive promoter modules are probably conserved among various auxin-specific genes.


m Review articles

Conclusions Converging experimental evidence suggests that the TGTCCTTC-related sequences and their binding factors are the prominent targets of the auxin-signaling apparatus for activating various primary genes. The manifestation of the auxin effect demands promoter competence and synergism among coupling factors, repressors, enhancers and archi- tectural proteins. The possibility exists that these factors are encoded by multigene families, such as G-box binding bZlP proteins, which often function as coupling f a ~ t o r s ( ~ ~ 9 ~ ~ ) . The strength and duration of gene activity in response to auxin may be determined by: (1) the expression of specific family members; (2) the regulation of their function by posttranslational mechanisms; and (3) the formation of an elaborate fabric of stereospecific DNA-protein and protein-protein interactions. Nuclear proteins have been shown to bind to conserved regions of the auxin-responsive promoters and some of them have been cloned. However, their functional- ity remains to be determined(19g50). None of the critical AuxRE-binding proteins have been identified to date. As for the other plant hormones, such as ethylene and gibberellic acid, hormone-responsive promoter elements have successfully been used to identify their cognate DNA binding proteins (Fig. 5). In such cases, the hormone response elements have been derived from secondary genes whose hormonal activation requires de novo protein synthesis. Consequently, the identified transcription factors are encoded by genes that are horm~ne- induc ib le (~~~~~) . These genes are analogous to primary auxin-responsive genes, in particular to the Aud/AA class, which encodes putative transcription factors(36). With the functional identification of AuxREs and AuxRDs in primary auxin genes, the stage is set to isolate binding protein factors and to identify early steps in auxin signaling by biochemical and reverse genetic approaches, respectively (Fig. 1).

Acknowledgements This work was supported by grants from the National Insti- tutes of Health (GM-35447) and US Department of Agricul- ture (5835-21 430-003-00D) to A.T., and by postdoctoral fel- lowships from Boehringer lngelheim Fonds, Germany and the US Department of Agriculture (5335-21 430-002-00D) to S.A. and N.B. We thank Drs Yutaka Oono, for critical reading, and Ron Wells, for editing, the manuscript.

References 1 Went, F.W. and Thimann, K.V. (1937). Phyfohormones. Macmillan, New York. 2 Estelle, M. (1 992). The plant hormone auxin: insight in sight. BioEssays 14,439- 444. 3 Klee, H.J. and Romano, C.P. (1994). The roles of phytohormones in development as studied in transgenic plants. CRC Crit. Rev. Plant Sci. 13, 31 1- 324. 4 Hobbie, L. and Estelle, M. (1994). Genetic approaches to auxin action. Plant Cell Physiol. 17, 525-540. 5 Evans, M. and Ray, P.M. (1969). Timing of the auxin response in coleoptiles and its implications regarding auxin action. J. Gen. PhysioL 53, 1-20.

6 Brummell, D.A. and Hall, J.L. (1987). Rapid cellular responses to auxin and the regulation of growth. Plant Cellhviron. 10, 523-543. 7 Edelmann, H. and Schopfer, P. (1989). Role of protein and RNA synthesis in the initiation of auxin-mediated growth in coleoptiles of Zea mays L. Planta 179, 475-485. 8 Guilfoyle, T.J. (1 986). Auxin-regulated gene expression in higher plants. CRC Crit. Rev. Plant Sci. 4,247-276. 9 Key, J.L. (1989) Modulation of gene expression by auxin. BioEssaysll, 52-58. 10 Theologis, A. (1986). Rapid gene regulation by auxin. Annu. Rev. Plant. Physiol. 37, 407-438. 11 Ecker, J.R. (1995). The ethylene signal transduction pathway in plants. Science 268,667-675. 12 Darnell Jr., J.E., Kerr, I.M. and Stark, G.R. (1994). Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science264, 1415-1421. 13 Guilfoyle, T.J. et a/. (1993). Auxin-regulated transcription. Aust. J. Plant Physiol. 20,489-502. 14 Takahashi, Y., Ishida, S. and Nagata, T. (1 995). Auxin-regulated genes. Plant Cell Physiol. 36, 383-390. 15 Abel, S. and Theologis, A. (1996). Early genes and auxin action. Plant Physiol. 11 1, 9-1 7. 16 Ballas, N., Wong, L.M. and Theologis, A. (1993). Identification of the auxin- responsive element, AuxRE, in the primary indoleacetic acid-inducible gene, PS- lAA4/5, of pea (Pisum sativum). J. Mol. Eiol. 233, 580-596. 17 Ballas, N., Wong, L.M., Ke, M. and Theologis, A. (1995). Two auxin- responsive domains interact positively to induce expression of the early indoleacetic acid-inducible gene, PS-/AA4/5. Proc. Natl Acad. Sci USA 92, 3483- 3487. 18 Liu, Z.B., Ulmasov, T., Shi, X., Hagen, G. and Guilfoyle, T.J. (1994). Soybean GH3 promoter contains multiple auxin-inducible elements. Plant Cell 6,

19 Ulmasov, T., Liu, Z.B., Hagen, G. and Guilfoyle, T.J. (1995). Composite structure of auxin response elements. Plant Cell7, 161 1.1623. 20 Li, Y., Liu, Z.B., Shi, X., Hagen, G. and Guilfoyle, T.J. (1994). An auxin- inducible element in soybean SAUR promoters. Plant Physiol. 106,37-43. 21 Ulmasov, T., Hagen, G. and Guilfoyle, T.J. (1994). The ocs element in the soybean GH2/4 promoter is activated by both active and inactive auxin and salicylic acid analogues. Plant Mot. Biol. 26,1055-1064. 22 Droog, F. eta/. (1995). Promoter analysis of the auxin-regulated tobacco glutathione S-transferase genes Ntf03-7 and Nt103-35. Plant Mol. Biol. 29, 413- 429. 23 Herschman, H.R. (1991). Primary response genes induced by growth factors and tumor promoters. Annu. Rev. Biochem. 60,281-319. 24 Hill, C.S. and Treisman, R. (1995). Transcriptional regulation by extracellular signals: mechanisms and specificity. Cell80, 199-21 1. 25 Hagen, G. and Guilfoyle, T.J. (1985). Rapid induction of selective transcription by auxins. Mol. Cell. Biol. 5, 11 97-1203. 26 Franco, A.R., Gee, M.A. and Guilfoyle, T.J. (1990). Induction and superinduction of auxin-responsive mRNAs with auxin and protein synthesis inhibitors. J. Biol. Chem. 265, 15845-15849 27 Ellis, J.G. eta/. (1993). Does the ocs-element occur as a functional component of the promoters of plant genes? Plant J. 4,433-443. 28 Nagao R.T., Goekjian, V.H., Hong, J.C. and Key J.L. (1993). Identification of protein-binding DNA sequences in an auxin-regulated gene of soybean. Plant Mol.

29Oeller, P.W., Keller, J.A., Parks, J.E., Silbert, J.E. andTheologis,A. (1993). Structural characterization of the early indoleacetic acid-inducible genes, PS- lAA4/5and PS-lAA6, of pea (Pisum sativum L.). J. Mot. Eiol. 233, 789-798. 30 Lucas, P.C. and Granner, D.K. (1992). Hormone response domains in gene transcription. Annu. Rev. Biochem. 61, 1131 -1 173. 31 Rogers, J.C. and Rogers, S.W. (1992). Definition and functional implications of gibberellin and abscisic acid cis-acting hormone response complexes. Plant Cel/4,1443-1451. 32 Abel, S., Nguyen, D., Chow, W. and Theologis, A. (1995). ACS4, a primary auxin-responsive gene encoding 1 -aminocyclopropane-1 -carboxylate synthase in Arabidopsis thaliana. J. Biol. Chern. 270, 19093-1 9099. 33 Theologis, A., Huynh, T.V. and Davis, R.W. (1985). Rapid induction of specific rnRNAs by auxin in pea epicotyl tissue. J. Mot. Biol. 183, 53-68. 34 Koshiba, T., Ballas, N., Wong, L.M. and Theologis, A. (1995) Transcriptional regulation of PS-/AA4/5 and PS-lAA6 early gene expression by indoleacetic acid and protein synthesis inhibitors in pea (Pisum sativurn). J. Mol. Biol. 253,396-413. 35 Oeller, P.W. and Theologis, A. (1995). Induction kinetics of the nuclear proteins encoded by the early indoleacetic acid-inducible genes, PS-/AA4/5 and PS-lAA6 in pea (Pisurn sativurn L.). Plant J. 7,37-48. 36 Abel, S., Oeller, P.W. and Theologis A. (1994). Early auxin-induced genes encode short-lived nuclear proteins. Proc. Natl Acad. Sci. USA 91,326-330 37 Abel, S. and Theologis, A. (1995). A polymorphic bipartite motif signals

645-657.

BiOl.21, 1147-1162.

BioEssays Vol. 18 no. 8 653

Review articles

nuclear targeting of early auxin-inducible proteins related to PS-IAA4 from pea (Pisum sativum). Plant J. 8,87-96. 38 Wong, L.M., Abel, S., Shen, N., de la Foata, M., Mall, Y. and Theologis, A. (1996). Differential activation of the primary auxin response genes, PS-/AA4/5and PS-lAA6, during early plant development. Plant J. 9, 587-599. 39 McClure, B.A., Hagen, G., Brown, C.S., Gee, M.A. and Guilfoyle, T.J. (1989). Transcription, organization, and sequence of an auxin-regulated gene cluster in soybean. Plant Ceii l , 229-239. 40 Gil, P., Liu, Y., Orbovic, V., Verkamp, E., Poff, K.L. and Green, P.J. (1994). Characterization of the auxin-inducible SAUR-AC1 gene for use as a genetic tool in Arabidopsis. Plant Physiol. 104,777-784. 41 Izawa, T., Foster, R. and Chua, N.-H. (1993). Plant bZlP protein DNA binding specificity. J. Mol. Biol. 230, 1131-1 144. 42 Takahashi, Y. and Nagata, T. (1992). parB: An auxin-regulated gene encoding glutathione S-transferase. Proc. NatlAcad. Sci. USA 89, 56-59. 43 Droog, F.N.J., Hookaas, P.J.J., Libbenga, K.R. and Van der Zaal, E.J. (1993). Proteins encoded by an auxin-regulated gene family of tobacco share limited but significant homology with glutathione S-tranferase and one member indeed shows in vitro GST activity. Plant. Mol. Biol. 21, 965-972. 44 Mito, N. and Bennett, A.B. (1 995). The diageofropica mutation and synthetic auxins differentially affect the expression of auxin-regulated genes in tomato. Plant Physiol. 109,293-297. 45 Clark, A.R and Docherty, K. (1993). Negative regulation of transcription in eukaryotes. Biochem. J. 296,521-541. 46 Menkens, A.E., Schindler, U. and Cashmore A.R. (1995). The G-box: a ubiquitous regulatory DNA element in plants bound by the GBF family of bZlP proteins. Trends Biochem. 20, 506-510. 47 Shen, Q. and Ho, T.-H. D. (1995). Functional dissection of an abscisic acid (ABA)-inducible gene reveals two independent ABA-responsive complexes each containing a G-Box and a novel cis-acting element. Plant Cel/7,295-307. 48 Lanahan, M.B., Ho, T.-H. D., Rogers, S.W. and Rogers, J.C. (1992). A gibberellin response complex in cereal a-amylase gene promoters. Plant Cell 4, 203-21 1. 49 Gee, M.A., Hagen, G., Guilfoyle, T.J. (1991). Tissue-specific and organ- specific expression of soybean auxin-responsive transcripts GH3 and SAURs. PlantCel/3,419-430. 50 Hong, J.C., Cheong, Y.H., Nagao R.T., Bahk, J.D., Key J.L. and Cho M.J. (1 995). Isolation of two soybean G-box binding factors which interact with a G-box sequence of an auxin-responsive gene. Plant J. 8,199-21 1.

51 Napier, R.M. and Venis, M.A. (1 995). Auxin action and auxin-binding proteins. New Phytol. 129,167-201. 52 Abel, S., Nguyen, D. and Theologis, A. (1995). The PS-/AA4/5like family of early auxin-inducible mRNAs in Arabidopsis thaliana. J. Mol. Biol. 251,533-549. 53 Gil, P. and Green, P.J. (1996). Multiple regions of the Arabidopsis SAUR-ACI gene control transcript abundance: The 3' untranslated region functions as an mRNA instability domain. EM60 J. 15, 1678-1686. 54 Li, Y., Strabala, T.J., Hagen, G. and Guilfoyle, T.J. (1994). The soybean SAUR open reading frame contains a CIS element responsible for cycloheximide- induced mRNA accumulation. Plant Mol. Biol. 24, 715-723. 55 Herschbach, B.M. and Johnson, A.D. (1 993). Transcriptional repression in eukaryotes. Annu. Rev. CellBiol. 9, 479-509. 56 Cowell, I.G. (1994). Repression versus activation in the control of gene transcription. Trends Biochem. 19,38-42. 57 Ohrne-Takagi, M. and Shinshi, H. (1995). Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element. Plant Cell7, 173-182. 58 Gubler, F., Kalla, R., Roberts, J.K. and Jacobsen, J.V. (1995). Gibberellin- regulated expression of a myb gene in barley aleurone cells: evidence for Myb transactivation of a high-pl a-amylase gene promoter. Plant Cell7, 1879-1891. 59 Shen Q., Uknes, S.J. and Ho, T.-H.D. (1 993). Hormone response complex in a novel abscisic acid and cycloheximide-inducible barley gene. J. Biol. Chem. 268,

60 Meller, Y., Sessa, G., Eyal, Y. and Fluhr, R. (1993). DNA-protein interactions on a cis-DNA element essential for ethylene regulation. Plant Mol. Biol. 23, 453- 463. 61 Mason, H.S., DeWald, D.B. and Mullet, J.E. (1993). Identification of a methyl jasmonate-responsive domain in the soybean vsp5 promoter. Plant Cell 5, 241 - 251. 62 Zarernbinski, T.I. and Theologis, A. (1995). Ethylene biosynthesis and action: a case of conservation. Plant Mol. Biol. 26.1579-1 597.

23652-23660.

Steffen Abel, Nurit Ballas, Lu-Min Wong and Athanasios Theologis* are at the Plant Gene Expression Center, 800 Buchanan Street, Albany, CA 94710, USA. 'Author for correspondence ; E-mail: Theo@ mendel.berkeley.edu


DNA elements responsive to auxin

Documents

Transcript of DNA elements responsive to auxin