DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached...
-
Upload
junior-gibbs -
Category
Documents
-
view
221 -
download
0
Transcript of DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached...
![Page 1: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/1.jpg)
DNA Chip Scanning
•DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA.
•Only those probe spots where target cDNA hybridized will fluoresce.
![Page 2: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/2.jpg)
![Page 3: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/3.jpg)
![Page 4: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/4.jpg)
GENE EXPRESSION CENTER
![Page 5: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/5.jpg)
Scanner - DNA chip goes in here
![Page 6: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/6.jpg)
Image on screen as chip is scanned
![Page 7: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/7.jpg)
Smoker vs. Former Smoker
Smoker vs. Non-Smoker
1 2 3
4 5 6
7 8 9
10 11
Probe DNA(each grid)
![Page 8: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/8.jpg)
DNA CHIP before hybridization with target DNA (after spotting Probe DNA)
Sometimes the SDS used in the wash solutions will fluoresce.
This is all background signal.
![Page 9: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/9.jpg)
A Real DNA Chip Each spot is a different gene
Example:Green Smoker Red Non-smokerYellow Both tissues express the gene
![Page 10: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/10.jpg)
Bioinformatics - It’s a BLAST
Sequences at each spot on the chip are provided on kit CD
BLAST: “Basic Local Alignment Search Tool”
![Page 11: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/11.jpg)
GENE 1 - CTCATCAGTAATGGTCAGAGCAT GENE 2 – GAACAGCTGTTCAGTCTGCAAGT GENE 3 – CTGGGGTTAGTGCTGGCGATCCTGENE 4 – CCAGGAGCCCCAGTTACCGGGAGGENE 5 – GGAGAAGGTAGATTTCAATACGTGENE 6 – CATGATAAGGCTCTTACCCCCTTGENE 7 – GTCATGGCGACTGTCCAGCTTTGGENE 8 – TTGTTTTTGAGACAGAACCTTGCGENE 9 – ATCCTCCAGGTGCACAAGCTCCAGENE 10 – ACCATGGATGATGATATCGCCGCGENE 11 – TGAACGCATTCATCGTGTGGTCT
Probe Gene Sequences - Cancer / Smoking Chip
![Page 12: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/12.jpg)
![Page 13: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/13.jpg)
![Page 14: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/14.jpg)
![Page 15: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/15.jpg)
![Page 16: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/16.jpg)
![Page 17: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/17.jpg)
![Page 18: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/18.jpg)
![Page 19: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/19.jpg)
![Page 20: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/20.jpg)
![Page 21: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/21.jpg)
![Page 22: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/22.jpg)
![Page 23: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/23.jpg)
![Page 24: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/24.jpg)
![Page 25: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/25.jpg)
Gene Ontology
Describes three features about a gene:
Where its protein product is located in the cell (cellular compartment)
What process its protein product is part of(cellular process)
The function of that protein product (molecular function)
![Page 26: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/26.jpg)
What do these Genes Do?
The genes on this chip are not intended to give a complete model of lung cancer, but they can be used to illustrateseveral important biological principles.
http://www.madison.k12.wi.us/west/science/biotech/at-genes.htm
![Page 27: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/27.jpg)
Gene Expression - Tumor suppressors; oncogenes Developmental stage-dependent genes
Biological Principles:
Genetic Polymorphism – Aldehyde dehydrogenase has several different versions (alleles) among human populations
Biochemical reaction catalysis – Aldehyde dehydrogenase, Glutathione Peroxidase, Cytochrome P450 metabolize a variety of substances
Evolutionary Conservation of Protein Structure – Actin and Slit homolog code for similar proteins in several other species
![Page 28: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/28.jpg)
Gene 1 - CYP1A1 cytochrome P450 superfamily of enzymes • involved in drug metabolism • located in the endoplasmic reticulum. • induced in the lung up to 100-fold because of tobacco smoking.
Gene 4 - ALDH3A1 - aldehyde dehydrogenase• detoxification • located in the cytosol. • 16 different alleles exists, one predisposes cancer
Gene 5 - GPX2 - Glutathione peroxidase• detoxification and antioxidant functions. • located in the cytoplasm. • highly expressed in squamous carcinomas of the lung
Smoking increases expression (Up-regulates) these genes:
![Page 29: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/29.jpg)
Gene 3 - SLIT2 (Slit Homologue)* Involved in cell adhesion * silenced in many cancers (including lung) * may be a tumor suppressor
Gene 7 TP53 - p53 tumor suppressor* guardian of the genome: central role in cell cycle * loss of p53 function allows pre-malignant cells to continue
proliferating* found in very low levels in normal cells* located in the mitochondrion and in the nucleolus
Quitting smoking is worth it! Off in smokers; On in non- and former smokers
![Page 30: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/30.jpg)
Gene 6 - CEACAM6 Human Carcinoembryonic Antigen• an oncogene • involved in adhesion between cells• extracellular matrix • Over-expression inhibits cell differentiation and disrupts how
cells are organized in lung tissue.
UP-Regulated (ON) in smokers and former smokers:
It’s better to NEVER START smoking!
DOWN - Regulated (OFF) in smokers and former smokers: Gene 9 - CX3CL1 - chemokine ligand
• tumor suppressor • involved in cell adhesion and in inflammation.• located on the cell surface, membrane & extracellular
compartment.
![Page 31: DNA Chip Scanning DNA Chips are scanned with a laser to excite the fluorescein dye that is attached to the target cDNA. Only those probe spots where target.](https://reader036.fdocuments.net/reader036/viewer/2022062313/56649d125503460f949e5b68/html5/thumbnails/31.jpg)
Gene 2 - GPC3 Glypican• controls cellular response to damage from external substances• may control cell growth and cell death (apoptosis)• Decreased expression may represent an early step in cigarette
smoke–associated lung carcinogenesis• located in the plasma membrane and extracellular matrix.
UP-Regulated (ON) in smokers and former smokers:
On in smokers and former smokers, OFF in non smokers
Gene 8 - CLDN10 – claudin• Involved in cell adhesion and inflammation• located in the plasma membrane