DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the...
-
Upload
matthew-malone -
Category
Documents
-
view
218 -
download
0
Transcript of DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the...
![Page 1: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/1.jpg)
DNA and Protein SynthesisDNA and Protein Synthesis
A Brief TutorialA Brief Tutorial
![Page 2: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/2.jpg)
![Page 3: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/3.jpg)
BackgroundBackground
DNA is the genetic material.DNA is the genetic material.
Sometimes called “the blueprint of life.”Sometimes called “the blueprint of life.”
Used to help build everything the organism Used to help build everything the organism needs to function.needs to function.
Must remain in the nucleus.Must remain in the nucleus.
![Page 4: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/4.jpg)
Structure of DNA Structure of DNA
NucleotideNucleotide 5 carbon sugar + phosphate group + nitrogenous base5 carbon sugar + phosphate group + nitrogenous base
DNA sugar = deoxyriboseDNA sugar = deoxyribose
Nitrogenous Bases = adenine, thymine, cytosine, guanineNitrogenous Bases = adenine, thymine, cytosine, guanine
Nucleotides are linked together into shape of Nucleotides are linked together into shape of double-helix.double-helix.
Twisted Ladder AnalogyTwisted Ladder Analogy
![Page 5: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/5.jpg)
![Page 6: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/6.jpg)
Science Aid: DNA Structure and Replicationscienceaid.co.uk/biology/genetics2/dna.html
DNA is really a pattern of repeating nucleotides.
LADDER ANALOGY
A DNA Sequence
![Page 7: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/7.jpg)
Latest from the Labs: Cells and DNA
info.cancerresearchuk.org/.../cellsanddna/
The DNA molecule needs to coil and fold-up so that it can fit into the small nucleus.
The Ladder The Double Helix
![Page 8: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/8.jpg)
Complementary Base-PairingComplementary Base-Pairing
DNA molecule is double-stranded and DNA molecule is double-stranded and “complementary”“complementary”
Adenine always pairs with Thymine (A=T)Adenine always pairs with Thymine (A=T)
Cytosine always pairs with Guanine Cytosine always pairs with Guanine (G =C)(G =C)
Backbone/rails = alternating Backbone/rails = alternating sugar/phosphate moleculessugar/phosphate molecules
![Page 9: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/9.jpg)
Practice DNA StrandsPractice DNA Strands
ATCCGTGCTATCCGTGCT
GCGTAGCTGACCGCGATGACAGCGTAGCTGACCGCGATGACA
![Page 10: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/10.jpg)
DNA ReplicationDNA Replication
How DNA makes a copy of itselfHow DNA makes a copy of itself
Semi-conservative ReplicationSemi-conservative Replication
2 New DNA molecules each with 1 old strand and 2 New DNA molecules each with 1 old strand and 1 new strand1 new strand
DNA Ladder unzips, enzymes come in and add DNA Ladder unzips, enzymes come in and add new base pairs…. 2 new molecules!new base pairs…. 2 new molecules!
ANIMATION! ANIMATION!
![Page 11: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/11.jpg)
DNA, RNA, and ProteinDNA, RNA, and Protein
Main IdeaMain Idea: DNA codes for RNA, : DNA codes for RNA, which helps build proteins.which helps build proteins.
![Page 12: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/12.jpg)
Central DogmaCentral Dogma How does the information stored in DNA get How does the information stored in DNA get
expressed in genes?expressed in genes?
DNA DNA RNARNA ProteinProtein
RNA is able to take the information RNA is able to take the information stored in DNA out of the nucleus and stored in DNA out of the nucleus and go to the ribosome to help build go to the ribosome to help build proteins!proteins!
![Page 13: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/13.jpg)
RNARNA
5 carbon sugar = 5 carbon sugar = riboseriboseNitrogenous bases = adenine, Nitrogenous bases = adenine, uracil,uracil,
cytosine, and guaninecytosine, and guanineSingle (not double) strandedSingle (not double) stranded
3 different forms3 different forms::mRNA – messenger RNAmRNA – messenger RNA tRNA- transfer RNAtRNA- transfer RNA rRNA- ribosomal RNArRNA- ribosomal RNA
![Page 14: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/14.jpg)
TranscriptionTranscription
DNA DNA mRNA mRNA
Information in DNA gets transcribed (or Information in DNA gets transcribed (or rewritten) into RNA language.rewritten) into RNA language.
C pairs with GC pairs with GA pairs with UA pairs with U
Sample Transcription: AGCGTGAACGTSample Transcription: AGCGTGAACGT
Next, mRNA shuttles its message to the Next, mRNA shuttles its message to the ribosomeribosome
![Page 15: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/15.jpg)
TranslationTranslation
mRNA mRNA Protein Protein
At the ribosome, information stored in At the ribosome, information stored in mRNA molecule gets translated into a mRNA molecule gets translated into a chain of amino acids (protein) with the chain of amino acids (protein) with the help of tRNA.help of tRNA.
![Page 16: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/16.jpg)
StepsSteps
Break mRNA molecule into 3 bases = Break mRNA molecule into 3 bases = codoncodon
Use the codon chart to determine what Use the codon chart to determine what amino acid the tRNA molecule would bring amino acid the tRNA molecule would bring to the ribosome to help build the protein.to the ribosome to help build the protein.
![Page 17: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/17.jpg)
![Page 18: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/18.jpg)
Protein SynthesisProtein Synthesis
DNA Strand: AGTACCGCGTCATTDNA Strand: AGTACCGCGTCATT
Transcription Product:Transcription Product:
Translation Product:Translation Product:
ANIMATE!ANIMATE!
![Page 19: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/19.jpg)
MutationsMutations
A permanent change in the DNA of a cellA permanent change in the DNA of a cell
Missense mutationMissense mutation:: change in DNA change in DNA results in wrong amino acid placed in results in wrong amino acid placed in protein. (Might still be ok….)protein. (Might still be ok….)
Nonsense mutationNonsense mutation: change in DNA : change in DNA causes translation to stop early. (VERY causes translation to stop early. (VERY BAD)BAD)
![Page 20: DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.](https://reader030.fdocuments.net/reader030/viewer/2022032414/56649ee45503460f94bf30e2/html5/thumbnails/20.jpg)
Point mutationPoint mutation base substitution (C base substitution (C instead of G)instead of G)
Addition/DeletionAddition/Deletion “Frame shifts”… “Frame shifts”… cause change the multiple of three codonscause change the multiple of three codons
Tandem RepeatsTandem Repeats excessive repeating excessive repeating of sequences.of sequences.
Multiple Choice (Scantron) AnalogyMultiple Choice (Scantron) Analogy