DNADNAAlso known as deoxyribonucleic acid

History of DNAHistory of DNA

• In the mid 1900’s scientists started asking the question:– “How do genes work?”– Like many scientific stories, the

discovery of DNA was an accident while a scientist was trying to find out something else

Frederick GriffithFrederick Griffith

• Griffith was working on what was causing the deadly disease pneumonia

• Griffith isolated two separate strains:– A disease causing strain– A harmless strain

Disease-causing bacteria (smooth

colonies)

Harmless bacteria (rough colonies)

Heat-killed, disease-causing bacteria (smooth colonies)

Control(no growth)

Heat-killed, disease-causing bacteria (smooth colonies)

Harmless bacteria (rough colonies)

Dies of pneumonia Lives Lives Live, disease-causingbacteria (smooth colonies)

Dies of pneumonia

Figure 12–2 Griffith’s ExperimentFigure 12–2 Griffith’s Experiment

Griffith’s ExperimentGriffith’s Experiment

• He found that mice injected with the disease-causing strain died of pneumonia

• However, if he heated the disease-causing strain and injected the mice with it they did not die at all

• This suggested that the disease wasn’t caused by a chemical toxin released by the bacteria

Griffith’s ExperimentGriffith’s Experiment

• When he injected mice with the heat killed disease-causing bacteria they did not die– When he added

the harmless bacteria to the heat killed bacteria they did develop pneumonia and die!

Griffith’s ExperimentGriffith’s Experiment

• Somehow the heat killed bacteria passed on their ability to cause disease to the harmless strain!!

• Griffith called this process transformation – one strain of bacteria changing into another

Griffith’s ExperimentGriffith’s Experiment

• Griffith hypothesized that some “factor” was transferred from the heat-killed bacteria to the live, harmless bacteria

• He hypothesized that this factor was a gene that the live bacteria obtained from the heat-killed bacteria

Oswald Avery’s ExperimentOswald Avery’s Experiment

• In 1944 Avery repeated Griffith’s experiment – He changed it by creating an extraction

of the “combined” bacteria and treating it with enzymes

– These enzymes destroyed all of the proteins, fats, carbs, and RNA

– Leaving only the DNA!!

Oswald Avery’s ExperimentOswald Avery’s Experiment

• After he destroyed most of the organic components, transformation still occurred!

• He performed it one more time:– This time he destroyed the DNA in the

mixture– As he had guessed, the mice lived – He concluded that it was the DNA that

was responsible for the disease

Oswald Avery’s ExperimentOswald Avery’s Experiment

• Avery’s Conclusion:– DNA is the nucleic acid that stores and

transmits genetic information from one generation of organism to the next

Hershey-Chase ExperimentHershey-Chase Experiment

• Alfred Hershey and Martha Chase wanted to explain Avery’s findings further– They worked with bacteriophages

• “bacteria eater”• They attach to the outside of a bacterium

and inject their DNA into the cell• The DNA instructs the cell to make copies

of itself until the cell bursts with more bacteriophages

Hershey-Chase ExperimentHershey-Chase Experiment

• They put radioactive markers on the outside of the bacteriophage as well as on the DNA inside

• These markers can be seen or followed during an experiment to determine which is left “inside” the bacterium to “infect” it

Bacteriophage with phosphorus-32 in DNA

Phage infectsbacterium

Radioactivity inside bacterium

Bacteriophage with sulfur-35 in protein coat

Phage infectsbacterium

No radioactivity inside bacterium

Hershey-Chase Experiment

Hershey-Chase ExperimentHershey-Chase Experiment

• Hershey and Chase concluded that the genetic material of the bacteriophage was DNA and not protein

The Structure of DNAThe Structure of DNA

• DNA is a long molecule made up of nucleotides

• Each nucleotide is made up of three parts:– A 5-carbon sugar

called deoxyribose– A phosphate group– And a nitrogenous

base

The Nitrogenous BasesThe Nitrogenous Bases

• There are 4 kinds of Nitrogenous Bases:– The Pyrimidines:

• Cytosine• Thymine

– The Purines:• Adenine• Guanine*the sugar phosphate forms the

“backbone” of the molecule

PurinesAdenine Guanine

Phosphate group

Pyrimidines

Cytosine Thymine

Deoxyribose 5-Carbon Sugar

The NucleotidesThe Nucleotides

Chargaff’s RulesChargaff’s Rules

• According to Erwin Chargaff:– Adenine always pairs with Thymine

– Cytosine always pairs with Guanine

The Double HelixThe Double Helix

• James Watson and Francis Crick– Using the X-ray taken by Rosalind

Franklin– And compiling data and research over

many years– Watson and Crick “unlocked” the secret

structure of DNA in 1953• The building blocks of ALL life

The Double HelixThe Double Helix

• base pairing- hydrogen bonds forming only between certain “base pairs”

Sugar-phosphate backbone

Hydrogen bonds

Nucleotide

Key

Adenine (A)

Thymine (T)

Cytosine(C)

Guanine (G)

Chromosomes and DNA Chromosomes and DNA ReplicationReplication

• DNA is the genetic material for the cell and the organism

• It is found in the nucleus of Eukaryotic cells– If Prokaryote cells don’t have a

nucleus, then where is the DNA stored?

Chromosomes and DNA Chromosomes and DNA ReplicationReplication

• This E. coli bacterium has DNA but, it is compacted into the cytoplasm of the cell

• Most bacteria have a single, circular DNA molecule– E. coli has 4,639,221 base pairs!!!

E. coli bacterium

Chromosome

Bases on the chromosome

Eukaryotic DNAEukaryotic DNA

• Eukaryotic DNA has as many as 1000 times more base pairs as Prokaryotic DNA– It exists in the nucleus of the cell in

the form of chromosomes– How many chromosomes make up a

diploid human cell?

Eukaryotic DNAEukaryotic DNA

• How does the nucleus of a cell contain more than 1 meter of DNA?

• Eukaryotic chromosomes contain DNA and protein in a substance called chromatin

Eukaryotic DNAEukaryotic DNA• Chromatin – DNA tightly coiled around

proteins called histones• Nucleosome – DNA and histones forming

a beadlike structure

DNA

double

helix

Histones

Coils

Nucleosome

Supercoils

Chromosome

DNA ReplicationDNA Replication

• The way that DNA is constructed allows for exact duplication

• When DNA is separated one side can be “copied” because of base pairing

DNA ReplicationDNA Replication

• If you had a strand of DNA, but only one half of the strand, how would you create a complimentary strand?

– Suppose you had the base pairs:• ATGCCCGTAATGTAACCGTTGAA

• What would be the complimentary strand?

DNA ReplicationDNA Replication

• Replication – process by which DNA duplicates or “copies” itself– during replication the strand of DNA

separates into two strands– While this is happening two new

strands are being formed simultaneously

– This occurs at the replication fork

DNA ReplicationDNA Replication• DNA is “unzipped” by a special enzyme

called DNA polymerase

– The polymerase adds new nucleotides to pair with the “old” strand

– It also proofreads it before it finishes to make sure there are no mistakes

DNA ReplicationDNA Replication

Replication fork

DNA polymerase

DNA polymerase

Replication fork

New strand

New strand

Nitrogenous

bases

Original strand

Original strand

Chapter 12 – 3 Chapter 12 – 3 RNA and Protein RNA and Protein

SynthesisSynthesis• At this point we all know that DNA

provides the genetic code for all life on the planet

• So, “how does it work?”

• The key is it’s relationship with RNA– Ribonucleic acid

RNA and Protein RNA and Protein SynthesisSynthesis

• DNA is like a “library” of information in every cell of an organism

• RNA would be the “person” reading the individual ‘books’ in the library– The manufacture of proteins is

ESSENTIAL for the life of the organism!

Structure of RNAStructure of RNA

• RNA is much like DNA in that it is a long chain of nucleotides

There are THREE main differences:> the sugar in RNA is ribose > RNA is single stranded> RNA has Uracil in place of Thymine

from to to make up

Three Types of RNAThree Types of RNA

also called which functions to also called also called which functions towhich functions to

can be

RNA

Messenger RNA

Ribosomal RNA

Transfer RNA

mRNA Carry instructions

rRNACombine

with proteins

tRNABring

amino acids to

ribosome

DNA Ribosome Ribosomes

TranscriptionTranscription• Transcription is the process of

“making” RNA molecules by creating a complimentary strand to a section of DNA

• The enzyme responsible for “reading” the DNA code is RNA polymerase

TranscriptionTranscription• During transcription, RNA

polymerase attaches to the DNA and separates the strands

• The RNA polymerase then uses one strand of DNA as a template to make complimentary nucleotides into a strand of mRNA

TranscriptionTranscriptionAdenine (DNA and RNA)Cystosine (DNA and RNA)Guanine(DNA and RNA)Thymine (DNA only)Uracil (RNA only)

RNA DNA

RNApolymerase

TranscriptionTranscription• Promoters – specific sites where the

RNA Polymerase binds to the strand of DNA to begin transcription

RNA EditingRNA Editing

• The “finished” mRNA strand has been edited before it goes to work

• The pieces that are kept are called exons

• The pieces that are “cut” are called introns

The Genetic CodeThe Genetic Code

• Proteins are assembled in polypeptides– These are long chains of amino

acids

– There are 20 different types of amino acids

– The properties of proteins are determined by which order these amino acids are joined

The Genetic CodeThe Genetic Code

• mRNA is the key to the genetic code and it provides for the manufacture of all proteins in the body

• A strand of mRNA is read three base pairs at a time– UCGAAGCUUACA would be …..– UCG-AAG-CUU-ACA

The Genetic CodeThe Genetic Code• Each of these amino acids that

mRNA “codes” for recognizes the three base pair sequence

• A codon consists of three consecutive nucleotides that specify a single amino acid

The Genetic CodeThe Genetic Code

• Along with the twenty amino acids there are “special” base pair sequences that “code for” start and stop codons

• Stop codons are like the “period at the end of a sentence”.– They signify the end of a

polypeptide

The Genetic CodeThe Genetic Code

TranslationTranslation• The decoding of a strand of mRNA

into a protein is known as translation

• At this point we have taken a strand of DNA and created a strand of mRNA by the process of transcription – DNA mRNA polypeptide chain– Polypeptide chain Protein

• The next step is to make proteins!!

Messenger RNA :

Messenger RNA is transcribed in the nucleus.

Transfer RNA

mRNA Start codon

Ribosome

MethioninePhenylalanine tRNA Lysine

Nucleus

Figure 12–Figure 12–18 Translation18 Translation

mRNA

TranslationTranslation• As a strand of DNA is read during

transcription a complimentary strand of RNA is made

–TACAAGTTT (DNA)TACAAGTTT (DNA)–AUGUUCAAA (RNA)AUGUUCAAA (RNA)

TranslationTranslation• That strand of RNA is known as mRNA

and leaves the cell nucleus where it attaches to a ribosome

• AUGUUCAAA (mRNA)AUGUUCAAA (mRNA)

Ribosome

mRNAStart codon

TranslationTranslation• Each strand of mRNA is separated

into three base pairs called codons

• AUG —- UUC --- AAA AUG —- UUC --- AAA (mRNA)(mRNA)

• This is where This is where transfer RNAtransfer RNA comes in comes in (tRNA)(tRNA)

TranslationTranslation• tRNA is responsible for getting the right

anticodon with each of the mRNA codons• An amino acid is attached to each

anticodon

tRNAtRNA

mRNA

Ribosome

LysineLysine

The Polypeptide “Assembly Line” The ribosome joins the two amino acids & breaks the bond between the tRNA & it’s amino acid

mRNARibosome

Translation direction

Lysine tRNA

tRNARibosome

Growing polypeptide chain

mRNA Completing the Polypeptide

The process continues until the ribosome reaches one of the three

stop codons. The result is a growing polypeptide chain.

Figure 12–Figure 12–18 Translation18 Translation

TranslationTranslation• The ribosome acts like an

assembly line worker and attaches each amino acid to the next one.

• The ribosome also detaches the amino acid from it’s tRNA

• This happens until a stop codon is reached and there is a long chain of amino acids (a polypeptide)

MutationsMutations• Mutations are

changes in the DNA sequence that affect genetic information

• Genetic mutations result from changes in a single gene

• Chromosomal mutations involve changes in whole chromosomes

MutationsMutations• Mutations that only affect one

nucleotide are called point mutations– Point mutations generally only affect one

amino acid in the sequenceTHE DOG BIT THE CAT

THE DOG BIT THE CAR

Normal: AUG-AAG-GGC-UAA

Protein: Met - Lys - Gly - StopNormal: AUG-AAG-AGC-UAA

Protein: Met - Lys - Ser - Stop

MutationsMutations• Frameshift mutations are much

more dangerous to the genetic code!

• They occur when a nucleotide is added (inserted) or deleted

• This “shifts” the reading frame of the geneTHE DOG BIT THE CAT

** What happens if you remove the “G” in DOG

THE DOB ITT HEC AT**The same would happen if you added a

letter

SubstitutionInsertion

Deletion

Gene Mutations:Gene Mutations:Substitution, Insertion, Substitution, Insertion,

and Deletionand Deletion

Mutations can be very dangerousMutations can be very dangerous

and and VERY SCARY!!VERY SCARY!!

MutationsMutations• Chromosomal mutations involves

the change in the number or structure of chromosomes

• There are Four Types:– Deletion – the loss of all or part of a

chromosome– Duplication – when a segment of a

chromosome is repeated– Inversion – When part of a chromosome

becomes oriented in the reverse direction– Translocation – when part of a

chromosome breaks off and attaches to another

Chromosomal Chromosomal MutationsMutations

Deletion

Duplication

Inversion

Translocation

THE ENDTHE END