Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference...

28
Distributions of Distributions of Mutations Associated Mutations Associated with Sensorineural with Sensorineural Hearing Loss Hearing Loss 2006 National EHDI Conference 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial Disorders Center for Craniofacial Disorders Children’s Hospital at Montefiore Children’s Hospital at Montefiore Bronx, New York Bronx, New York February 2, 2006 February 2, 2006

Transcript of Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference...

Page 1: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Distributions of Distributions of Mutations Associated Mutations Associated

with Sensorineural with Sensorineural Hearing LossHearing Loss

2006 National EHDI Conference2006 National EHDI ConferenceAlan Shanske, M.D., FAAP, FACMGAlan Shanske, M.D., FAAP, FACMGCenter for Craniofacial DisordersCenter for Craniofacial DisordersChildren’s Hospital at MontefioreChildren’s Hospital at Montefiore

Bronx, New YorkBronx, New YorkFebruary 2, 2006February 2, 2006

Page 2: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Faculty Disclosure Faculty Disclosure InformationInformation

• In the past 12 months, I have not had In the past 12 months, I have not had a significant financial interest or a significant financial interest or other relationship with the other relationship with the manufacturer(s) of the product(s) or manufacturer(s) of the product(s) or provider(s) of the service(s) that will provider(s) of the service(s) that will be discussed in my presentation.be discussed in my presentation.

• This presentation will not include This presentation will not include discussion of pharmaceuticals or discussion of pharmaceuticals or devices that have not been approved devices that have not been approved by the FDA or of “off-label” uses of by the FDA or of “off-label” uses of pharmaceuticals or devices.pharmaceuticals or devices.

Page 3: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Congenital Hearing LossCongenital Hearing Loss

EpidemiologyEpidemiology 1/1000 infants affected1/1000 infants affected

EtiologyEtiology 50% genetic50% genetic

70% non-syndromic sensorineural hearing loss 70% non-syndromic sensorineural hearing loss (SNHL)(SNHL)

77% autosomal recessive77% autosomal recessive 52 loci known; 34 identified52 loci known; 34 identified

22% autosomal dominant22% autosomal dominant Remainder are mitochondrial or X-linkedRemainder are mitochondrial or X-linked

Page 4: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Clinical evaluation of Clinical evaluation of hearing losshearing loss

HistoryHistory Prenatal Prenatal

Infections, medication exposureInfections, medication exposure Neonatal Neonatal

Prematurity, hyperbilirubinemia, infections, Prematurity, hyperbilirubinemia, infections, medicationsmedications

ChildhoodChildhood Ear infections, antibiotics, medical problemsEar infections, antibiotics, medical problems

Family historyFamily history

Page 5: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Clinical evaluation of Clinical evaluation of hearing losshearing loss

Physical examPhysical exam Dysmorphic featuresDysmorphic features Ear malformations or effusionsEar malformations or effusions Skin (NF2)Skin (NF2) Hair and eyes (Waardenburg)Hair and eyes (Waardenburg)

TestingTesting EKG (Jervell and Lange-Nielsen syndrome)EKG (Jervell and Lange-Nielsen syndrome) +/- urinalysis +/- urinalysis CT scan of temporal bonesCT scan of temporal bones Genetic testingGenetic testing

Page 6: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

GJB2GJB2

Encodes connexin 26 (Cx26)Encodes connexin 26 (Cx26) Gap junction protein in the cochleaGap junction protein in the cochlea Maps to 13q12Maps to 13q12 2263 nucleotides, 680 amino acids2263 nucleotides, 680 amino acids Two exons; one coding exonTwo exons; one coding exon CpG island near Exon 1CpG island near Exon 1

Page 7: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

GJB2GJB2

AR mutations account for 15 – AR mutations account for 15 – 40% of inherited SNHL in North 40% of inherited SNHL in North AmericaAmerica Carrier rate of 1:33 in EuropeansCarrier rate of 1:33 in Europeans Most common mutation in Most common mutation in

Caucasians: 35delGCaucasians: 35delG Mutation spectrum is known to Mutation spectrum is known to

differ by ethnic groupdiffer by ethnic group

Page 8: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Gap Junction ChannelsGap Junction Channels

From Rabionet From Rabionet et al et al in TRENDS in Molecular Medicine Vol.8 No.5 May 2002in TRENDS in Molecular Medicine Vol.8 No.5 May 2002

Page 9: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Expression of Cx26, Cx30 Expression of Cx26, Cx30 and Cx31 in the Cochleaand Cx31 in the Cochlea

From Rabionet From Rabionet et al et al in TRENDS in Molecular Medicine Vol.8 No.5 May 2002in TRENDS in Molecular Medicine Vol.8 No.5 May 2002

Page 10: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Preliminary StudyPreliminary Study

Chart review of 107 patientsChart review of 107 patients Referred to CHAM for genetic Referred to CHAM for genetic

evaluation of SNHLevaluation of SNHL Data collected:Data collected:

EthnicityEthnicity Cx26 mutation statusCx26 mutation status mtDNA DNA analysis (nt 1555, 7445, mtDNA DNA analysis (nt 1555, 7445,

3243, sequencing of 12s rRNA)3243, sequencing of 12s rRNA) CT scan of temporal bonesCT scan of temporal bones

Page 11: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Available SamplesAvailable Samples

107 Samples obtained from IRB 107 Samples obtained from IRB approved research project looking approved research project looking for mtDNA point mutations in SNHLfor mtDNA point mutations in SNHL

192 Controls provided by Dr. Robert 192 Controls provided by Dr. Robert Burk from HPV studyBurk from HPV study

Page 12: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

mtDNA and CT ResultsmtDNA and CT Results

one Puerto Rican patient: one Puerto Rican patient: A503G variant + mtDNA mutation at nt A503G variant + mtDNA mutation at nt

14651465 no patient had A1555G or T7445C no patient had A1555G or T7445C

associated with SNHLassociated with SNHL 31 patients had CT scan results:31 patients had CT scan results:

2 had EVA, one of which carries G79A2 had EVA, one of which carries G79A 1 had ? Mondini’s, 1 had prominence of 1 had ? Mondini’s, 1 had prominence of

cochlear aqueducts, 1 had diffuse cochlear aqueducts, 1 had diffuse atrophyatrophy

Page 13: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Project designProject design

1.1. Designing primers for PCRDesigning primers for PCR1.1. Overcoming the GC contentOvercoming the GC content

2.2. Primers for Exons 1&2, and CpG islandPrimers for Exons 1&2, and CpG island

2.2. Sequencing PCR productsSequencing PCR products

3.3. Identifying sequence variants with Identifying sequence variants with SequencherSequencher

4.4. Examine for known SNPsExamine for known SNPs

5.5. Screening controls with Screening controls with PyrosequencingPyrosequencing

Page 14: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

CpG Island PrimersCpG Island Primers CGCCAGGTTCCTGGCCGGGCAGTCCGGGGCCGGCGGGCTCACCTGCGTCGGGAGGAAGCGCGGCGGGGCCGGGGCGGGGGTCTCGGCGTTGGGGTCTCTGCGCTGGGGCTCCTGCGCTCCTAGGCGGGTCCTGGGCCGGGCGCCGCCGAGGGGCTCCGAGTCGGGGAGAGGAGCGCGCGGGCGCTGCGGGGCCGCAACACCTGTCTCCCGCCGTGGCGCCTTTTAACCGCACCCCACACCCCGCCTCTTCCCTCGGAGACTGGGAAAGTTACGGAGGGGGCGGCGCCGCGGGCGGAGCGCGCCCGGCCTCTGGGTCCTCAGAGCTTCCCGGGTCCGCGAACCCCCGACCGCCCCCGAAAGCCCCGAACCCCCCAAGTCCCCTTCGAGGTCCCGATCATCTCCTAGTTCCTTTGAGCCTCCTAGTTCCTTTGAGCC

Page 15: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Exon 1 PrimersExon 1 Primers

CCCAAGGACGTGTGTTGGTCCAGCCCCCCCAAGGACGTGTGTTGGTCCAGCCCCCCGGTTCCCCGAGACCCACGCGGCCGGGCAACCGCTCTGGGTCTCGCGGTCCCTCCCCGCGCCAGGTTCCTGGCCGGGCAGTCCGGGGCCGGCGGGCTCACCTGCGTCGGGAGGAAGAGCGCGGCGGGGCCGGGGCGGGGGTCTCGGCGTTGGGGCGCGGCGGGGCCGGGGCGGGGGTCTCGGCGTTGGGGTCTCTGCGCTGGGGCTCCTGCGCTCCTAGGCGGGTCTCTCTGCGCTGGGGCTCCTGCGCTCCTAGGCGGGTCCTGGGCCGGGCGCCGCCGAGGGGCTCCGCTGGGCCGGGCGCCGCCGAGGGGCTCCGAGTCGGGGAGTCGGGGAGAGGAGCGCGCGGGCGCTGCGGGGCCGCAACACCTAGAGGAGCGCGCGGGCGCTGCGGGGCCGCAACACCTGTCTCCCGCCGTGGCGCCTTTTAACCGCACCCCACAGTCTCCCGCCGTGGCGCCTTTTAACCGCACCCCACACCCCGCCCCGCCTCTTCCCTCGGAGACTGGGAAAGTTACGGCCTCTTCCCTCGGAGACTGGGAAAGTTACGGAA

Page 16: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

TTATTATAGAGATTATATTTTAATGTTTTAAATGTATTTGATACATTACAAAATTATTTTAGTTATTATAGAGATTATATTTTAATGTTTTAAATGTATTTGATACATTACAAAATTATTTTAGTTACATTACA

AGCATATCATTAAAGCTATTCTTTATTATTACAAAATGCTTTTACAATGCTATTCTTGACAAGCATATCATTAAAGCTATTCTTTATTATTACAAAATGCTTTTACAATGCTATTCTTGACAACAGGACAGG

AAAATACTTACCCTCACTGAAATATGTGGAGTACCATTTTTTGGAAACCATGTCAAGCATAAAATACTTACCCTCACTGAAATATGTGGAGTACCATTTTTTGGAAACCATGTCAAGCATAATGGCAATGGC

AATATTCAGGTTCAATCTTCCTATAGATCTGCTCAATATTTATCTAAACCTTAGCTTCTATAATATTCAGGTTCAATCTTCCTATAGATCTGCTCAATATTTATCTAAACCTTAGCTTCTATTCTTTTTCTTTT

CACATGTTATTAGCTATATTTTCACTTAAAAAATTGGAGGCTGAAGGGGTAAGCAAACAACACATGTTATTAGCTATATTTTCACTTAAAAAATTGGAGGCTGAAGGGGTAAGCAAACAAACTTTACTTT

TGAAGTAGACAAAGCTCATCTTTAATCAACAGACTTTAGAGTCCAGTCTTTCCAAATCTGTGAAGTAGACAAAGCTCATCTTTAATCAACAGACTTTAGAGTCCAGTCTTTCCAAATCTGTTTTTATTTTTA

ACGACAGAAACTTCTCCCTCCCCTGCCCCATTTTGTCCTCCCCATTAAATGGTACTGTGTACGACAGAAACTTCTCCCTCCCCTGCCCCATTTTGTCCTCCCCATTAAATGGTACTGTGTCAATAAACAATAAA

ATTCCCAAGCGACCTCTTTAAATCAGCGTTCTTTCCGATGCTGGCTACCACAGTCATGGAATTCCCAAGCGACCTCTTTAAATCAGCGTTCTTTCCGATGCTGGCTACCACAGTCATGGAAAAGGAAAGG

AGATGTGTTGGACAGGCCTGTCATTACAGGTAGTAGTTGGTGGTACATCCAGTCTGTATTAGATGTGTTGGACAGGCCTGTCATTACAGGTAGTAGTTGGTGGTACATCCAGTCTGTATTTCTTATCTTA

CACAAAATTACATCTAAATATTTGACATGAGGCCATTTGCTATCATAAGCCATCACTAGGCACAAAATTACATCTAAATATTTGACATGAGGCCATTTGCTATCATAAGCCATCACTAGGAACTTCAACTTC

TAGTCTGTCTCACTCGATTGAGGCTACAATGTTGTTAGGTGCTATGACCACAATGAATACTAGTCTGTCTCACTCGATTGAGGCTACAATGTTGTTAGGTGCTATGACCACAATGAATACAACAGAACAG

ACAGCCTCTCAGCTGTGCTGCAAAGTATTCATAACCAAAAGACCATATTTCAAATTAAATACAGCCTCTCAGCTGTGCTGCAAAGTATTCATAACCAAAAGACCATATTTCAAATTAAATCATAGTCATAGT

AGCGAATGACATACCATTTACATATTACAATCTGAGCCTCTGAAACAGGGGGAACATATAAGCGAATGACATACCATTTACATATTACAATCTGAGCCTCTGAAACAGGGGGAACATATAATGGTATGGT

ATCCAGAACATCTTTACATCAAAATAACCTATCATACTACAAAGTTTTCACTTCCAAAAAGATCCAGAACATCTTTACATCAAAATAACCTATCATACTACAAAGTTTTCACTTCCAAAAAGTGTAACTGTAAC

AGAGTTTAAGGCACTGGTAACTTTGTCCACTGTTAGAGATTAAAACTTCCAAAGCAAATGAGAGTTTAAGGCACTGGTAACTTTGTCCACTGTTAGAGATTAAAACTTCCAAAGCAAATGAAAGAAAAGA

ACCAATGTTCACCTTTAACGTGGGGAAAGTTGGCAAAAAGAACCCCAGGAGGACACCCAACCAATGTTCACCTTTAACGTGGGGAAAGTTGGCAAAAAGAACCCCAGGAGGACACCCAAACCTTAACCTT

CTCTGTGTCCTCTGTGGAACCTGGCTTTTTTCTCTTGTCCTCAGAGAAAGAAACAAATGCCTCTGTGTCCTCTGTGGAACCTGGCTTTTTTCTCTTGTCCTCAGAGAAAGAAACAAATGCCGATATCGATAT

CCTCTGTTTAAAATATGAAAGTACCTTACACCAATAACCCCTAACAGCCTGGGGTCTCAGCCTCTGTTTAAAATATGAAAGTACCTTACACCAATAACCCCTAACAGCCTGGGGTCTCAGTGGAACTGGAAC

TAACTTAAGTGAAAGAAAATTAAGACAGGCATAGAATTAGGCCTTTGTTTTGAGGCTTTATAACTTAAGTGAAAGAAAATTAAGACAGGCATAGAATTAGGCCTTTGTTTTGAGGCTTTAGGGGGGGG

AGCAGAGCTCCATTGTGGCATCTGGAGTTTCACCTGAGGCAGCAGAGCTCCATTGTGGCATCTGGAGTTTCACCTGAGGC

Exon 2 Coding Region Exon 2 Coding Region PrimersPrimers

____________________________________________________CTACAGGGGTTTCAAATGGTTGCCTACAGGGGTTTCAAATGGTTGCATTTAAGGTCAGAATCTTTGTGTTGGGAAATGCTAGCGACTGAGCCTTGACAGCTGAGCACGGGTTGCCTCATCCCTCTCATGCTGTCTATTTCTTAATCTAACAACTGGGCAATGCGTTAAATAAACTGGCTTTTTTGACTTCCCAGAACAATATCTAATTAGCAAATAACACAATTCAGTGCTGGCTTTTTTGACTTCCCAGAACAATATCTAATTAGCAAATAACACAATTCAGTGACATTCAGCAGGATGCAAATTCCAGACACTGCAATCATGAACACTGTGAAGACAGACATTCAGCAGGATGCAAATTCCAGACACTGCAATCATGAACACTGTGAAGACAGTCTTCTCCGTGGGCCGGGACACAAAGCAGTCCACAGTGTTGGGACAAGGCCAGGCTCTTCTCCGTGGGCCGGGACACAAAGCAGTCCACAGTGTTGGGACAAGGCCAGGCGTTGCACTTCACCAGCCGCTGCATGGAGAAGCCGTCGTACATGACATAGAAGACGGTTGCACTTCACCAGCCGCTGCATGGAGAAGCCGTCGTACATGACATAGAAGACGTACATGAAGGCGGCTTCGAAGATGACCCGGAAGAAGATGCTGCTTGTGTAGGTCCTACATGAAGGCGGCTTCGAAGATGACCCGGAAGAAGATGCTGCTTGTGTAGGTCCACCACAGGGAGCCTTCGATGCGGACCTTCTGGGTTTTGATCTCCTCGATGTCCTTACCACAGGGAGCCTTCGATGCGGACCTTCTGGGTTTTGATCTCCTCGATGTCCTTAAATTCACTCTTTATCTCCCCCTTGATGAACTTCCTCTTCTTCTCATGTCTCCGGTAAATTCACTCTTTATCTCCCCCTTGATGAACTTCCTCTTCTTCTCATGTCTCCGGTAGGCCACGTGCATGGCCACTAGGAGCGCTGGCGTGGACACGAAGATCAGCTGCAAGGCCACGTGCATGGCCACTAGGAGCGCTGGCGTGGACACGAAGATCAGCTGCAGGGCCCATAGCCGGATGTGGGAGATGGGGAAGTAGTGATCGTAGCACACGTTCTTGGGCCCATAGCCGGATGTGGGAGATGGGGAAGTAGTGATCGTAGCACACGTTCTTGCAGCCTGGCTGCAGGGTGTTGCAGACAAAGTCGGCCTGCTCATCTCCCCACACCGCAGCCTGGCTGCAGGGTGTTGCAGACAAAGTCGGCCTGCTCATCTCCCCACACCTCCTTTGCAGCCACAACGAGGATCATAATGCGAAAAATGAAGAGGACGGTGAGCCTCCTTTGCAGCCACAACGAGGATCATAATGCGAAAAATGAAGAGGACGGTGAGCCAGATCTTTCCAATGCTGGTGGAGTGTTTGTTCACACCCCCCAGGATCGTCTGCAGAGATCTTTCCAATGCTGGTGGAGTGTTTGTTCACACCCCCCAGGATCGTCTGCAGCGTGCCCCAATCCATCGTGCCCCAATCCATCTTCTACTCTGGGCGGTTTGCTCTGGAAAAGACGAATGCACACAACACAGGAATCACTAGCTAGGACAGAACAGGGAGACTTCTCTGAGTCTGGGTAAGCCTTCTCTGAGTCTGGGTAAGC

Page 17: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

35delG

167delT

C-34T variant

G79A polymorphism

Patient with a C-34T variant and a G79A polymorphism. Is there significance to these changes when they co-occur?

35delG and 167delT compound heterozygote of mixed Jewish, Italian and Irish decent. Deletion alters chromatogram alignment, which is corrected with the deletion on the opposite chromosome. Both 35delG and 167delT lead to frameshift mutations.

C-34T variant

Page 18: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Patient from consanguineous Dominican family with a G139T homozygous mutation, leading to substitution of Valine for Glutamine at amino acid 47, initiating a premature STOP.

35delG leads to a frameshift mutation, as seen on this chromatogram.

Start Codon

G139T homozygous

35delG

35delG common mutation in Caucasian population, found in two Puerto Rican patients and one of mixed Italian, Irish and Jewish decent.

Page 19: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

GJB2 Mutations by Ethnicity for 107 Patients

0

5

10

15

20

25

30

Black Black/PR PR DR/PR DR Mexico Guyana India Pakistan Other

Ethnicity

Nu

mb

er o

f P

atie

nts

T101C (M34T)(AD vs. Polym)

35delG (AR)

167delT (AR)

G139T (E47V)(AR)

C-15T (Polym)

G79A (V27I)(Polym)

G380A (R127H)(Polym)

A670C (K224Q)(Indeter)

A503G (K168R)(novel)

C684A (novel)

Negative

*

* Compound Heterozygote: 35delG + 167delTPR= Puerto RicoDR=Dominican Republic

Page 20: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Schematic of Connexin 26 domains with mutations and

polymorphisms included

Mutations, polymorphisms and variants exhibited in our study are circled

Mutations are shown in GreenGreen

Polymorphisms are shown in PurplePurple

Variants of unknown significance are shown in OrangeOrange

Also seen in our study were 9 patients with C-34T, in the 5’UTR, not previously described

We noted sequence variations at nucleotide 765, with 65/35 C/T

http://ent.md.shinshu-u.ac.jp/deafgene%25/nonsyndromic/ohtsuka.gif

K224Q

K168R

V27I

R127H

Extracellular Domain

Transmembrane Domain

Intracellular Domain

Page 21: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Control Data for 93 Hispanic Patients

0

2

4

6

8

10

12

G79A H

E

G109A

HE

G511A

HE

C682T

HE

T425C

HE

A503G

HE

35de

lG H

E

Nucleotide Change

Num

ber

of P

atie

nts

HE= Heterozygote

Page 22: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Control Data for 94 Black Patients

0

0.5

1

1.5

2

2.5

G79A H

E

G79A H

O

G341A

HO

T101C

HE

G478A

HE

G499A

HE

Nucleotide Change

Num

ber

of

Pati

ents

HE = Heterozygote

HO= Homozygote

Page 23: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

ResultsResults

• one Dominican patient was one Dominican patient was homozygous for a mutation in GJB2 homozygous for a mutation in GJB2 (G139T)(G139T)

• GJB2 mutations occur in 1/33 GJB2 mutations occur in 1/33 European controls (35delG in 2-4%)European controls (35delG in 2-4%)

• only one Hispanic 35delG carrier in our only one Hispanic 35delG carrier in our controls; all other nucleotide changes controls; all other nucleotide changes were polymorphisms or novel variantswere polymorphisms or novel variants

Page 24: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

ConclusionsConclusions

• GJB2 mutations occur less frequently in our GJB2 mutations occur less frequently in our minority populationminority population

• lower carrier frequencies may account for lower carrier frequencies may account for the lower rate of homozygous individuals in the lower rate of homozygous individuals in our populationour population

• possible synergistic interaction of possible synergistic interaction of heterozygous GJB2 mutations and a heterozygous GJB2 mutations and a mutation in another gene such as GJB6mutation in another gene such as GJB6

Page 25: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Future studiesFuture studies

Patient recruitmentPatient recruitment JMC NICU and nurseryJMC NICU and nursery JMC audiology clinicJMC audiology clinic CHAM Craniofacial CenterCHAM Craniofacial Center

ControlsControls Hope for:Hope for:

50 cases/year + 300 controls/year50 cases/year + 300 controls/year

Page 26: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Future DirectionsFuture Directions

Cx30Cx30 Adjacent to GJB2Adjacent to GJB2 Mutations are rareMutations are rare

May lead to AD late onset deafnessMay lead to AD late onset deafness Deletions Deletions

Homozygous → deafnessHomozygous → deafness Heterozygous in trans with GJB2 Heterozygous in trans with GJB2

mutation → deafnessmutation → deafness

Page 27: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Future DirectionsFuture Directions

SLC26A4SLC26A4 Encodes monovalent and divalent Encodes monovalent and divalent

anion transporter related proteins anion transporter related proteins (Pendrin)(Pendrin) Involved in fluid homeostasisInvolved in fluid homeostasis

Mutations cause Pendred syndrome Mutations cause Pendred syndrome (AR; defects of thyroid, kidney and (AR; defects of thyroid, kidney and inner ear)inner ear)

Often also see Enlarged Vestibular Often also see Enlarged Vestibular Aqueduct (EVA) or Mondini dysplasiaAqueduct (EVA) or Mondini dysplasia

Page 28: Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Reference ListReference ListFor more information on this topic, see the following For more information on this topic, see the following

publications:publications:Marazita ML, et al., (1993) Genetic epidemiologic studies of early-onset Marazita ML, et al., (1993) Genetic epidemiologic studies of early-onset

deafness in the U.S. school-age population. Am J Med Genet 46:486-deafness in the U.S. school-age population. Am J Med Genet 46:486-491).491).

Kelsell DP, et al., (1997) Connexin 26 mutations in hereditary non-Kelsell DP, et al., (1997) Connexin 26 mutations in hereditary non-syndromal sensoineural deafness. Nature 387(6628):80-83.syndromal sensoineural deafness. Nature 387(6628):80-83.

Morton, C (2002) Genetics, genomics and gene discovery in the auditory Morton, C (2002) Genetics, genomics and gene discovery in the auditory system. Human Molecular Genetics 11(10):1229-1240.system. Human Molecular Genetics 11(10):1229-1240.

Rabionet R, et al., (2002) Connexin mutations in hearing loss, Rabionet R, et al., (2002) Connexin mutations in hearing loss, dermatological and neurological disorders. Trends in Mol Med dermatological and neurological disorders. Trends in Mol Med 8(5):205-212).8(5):205-212).

Pandya, A, et al., (2003) Frequency and distribution of GJB2 (connexin Pandya, A, et al., (2003) Frequency and distribution of GJB2 (connexin 26) and GJB6 (connexin 30) mutations in a large North American 26) and GJB6 (connexin 30) mutations in a large North American repository of deaf probands. Genet Med 5(4):295-303.repository of deaf probands. Genet Med 5(4):295-303.

Additional information may be found at:Additional information may be found at:http://davinci.crg.es/deafness/http://davinci.crg.es/deafness/