By: Dr. Liu J., Dr. D. Barker

Distinguishing Between Four Distinguishing Between Four Perennial Ryegrass Cultivars in Perennial Ryegrass Cultivars in

Monoculture and in Mixture Using Monoculture and in Mixture Using SSRSSR

Introduction Introduction Plant biodiversity and production

Species diversity• Darwin (1859) first proposed a connection between biodiversity and

ecosystem functioning. This topic resurfaced recently (since 1982, over 100 studies on it).

• Existing experiments indicate that biodiversity enhances production, though exceptions exist. (Tilman, et al, 1997)

• But biodiversity should also include within-species diversity

Cultivar diversity (within species)• Greater and more stable yield of blends than the components pure

line have been found in many other crop species (Smithson, 1996). • Mixtures of perennial ryegrass cultivars were found to give higher

yield than monoculture at some harvests (Thomson, 1969)

Introduction cont’Introduction cont’

Species diversity mechanisms:

More complete utilization of resources “Niche complementality” (Tillman, 2001)

Stability in face of environmental fluctuations “Buffering effect” (Helland, 2001 )

Cultivar diversity mechanisms :

?

Perennial ryegrass (Lolium perenne  L.)

- Family: Poaceae; genus: Lolium- Forage & turf - Bunch type, easy to clone - Self-incompatible, usually synthetic variety

- BG34 is a blend of 4 ryegrass cultivars

Cultivar Description % in BG34

Country of origin

Barlet Diploid. Bred from very diverse genetic base

40 Netherlands

Barmaco Diploid. Late heading variety. Very winter-hardy and persistent

25 Netherlands

Barnhem Diploid. Forms an extremely dense sward

25 Netherlands

Mara Diploid. Most winter hardy 10 Romania

Why SSR?Why SSR?

Widely dispersed and genetically well defined, ideal for diversity measurement

Highly polymorphic and this polymorphism is easily assayed by PCR, useful for distinguishing among closely related varieties

SSR locus is co-dominant, and very genetically informative

Amplify repeat region by polymerase chain reaction (PCR)

Analyze PCR products by agrose gel electrophoresis

Number of repeats is highly variable among individuals

= Repeat (e.g., ag)Unique flanking regions Structure

Design primers ( ) complementary to flanking regions

Simple Sequence Repeats Simple Sequence Repeats (SSR)(SSR)

Short stretches of tandomly repeated nucleotide (2, 3 or 4) motifsSSR polymorphism is the variation in number of repeatsThe length polymorphism can be monitored with PCR primers that

flank the SSR

ISSR: Inter-simple Sequence Repeats, a ISSR: Inter-simple Sequence Repeats, a modification of SSRmodification of SSR

Single primer targets the repeat per se. No flanking genomic sequence info required Highly reproducible

Reproducibility evaluation

Two leaf blades of one plant were sampled for DNA extraction and following PCR amplification to evaluate the reproducibility and accuracy of panel assay

1000

500

Sample gel bands results ---Primer (AG)10C

Barnhem 1 -5 Barmaco 1 - 5

B1 - B5 Mark C1 - C5 D1 - D5 Mark E1 - E5

Polymorphic bands were scored for presence(1) or absence (0)

Discriminant analysis (of SAS) was used to calculate similarity distance

A 1 A 2 …Barnhem 1 1 1 …Barnhem 2 0 0 …… … … …Barmaco 1 1 0 …Barmaco 2 0 1 …… … … …Barlet 1 1 0 …Barlet 2 1 1 …… … … …Mara 1 1 1 …Mara 2 1 1 …… … … …

1000

500

Barlet 1 - 5 Mara1 - 5

Cult. Barlet Barmaco Barnhem Mara

Line 1 2 1 2 1 2 1 2

# screened 50 50 50 50 50 50 50 50

Farm Noyes Gessell Kozak

# sampled 100 100 100

Primer # of alleles  Sequence Ref.

M2 7 GGTCTGGTAGACATGCCTCTACCAGCACAGGCAGCAGC

Kubic (1999)

10C 9 (AG)10C Ghariani (2003)

10T 10 (AG)10T Ghariani (2003) 

SSR primer proven to be useful (out of many published data for ryegrass):

•Reference population:

•Unknown populations are from three dairy farms (Holmes/Wayne Co, OH) sampled Sep 2004:

% of each cult has been correctly classified

 Loci used Barnhem Barmaco Barlet Mara

10C 66.7 40.0 61.5 56.4

10T 49.4 63.2 60.6 78.0

M2 50.5 46.4 67.0 28.9

10C+10T 72.0 71.4 75.6 78.3

10C+10T+M2 84.0 81.1 86.7 80.9

Accuracy of assignment improved as number of loci increased.

For Mara and Barlet, in-lines were more similar

For Barnhem and Barmaco, in-lines were different

Analysis of panel population

Analysis of field samples

Barnhem Barmaco Barlet Mara

25 25 40 10

Estimated number of plants of each cultivar

Barnhem Barmaco Barlet Mara % of confidence

Noyes 37 39 10 14 75.2%

Gessell 32 22 39 7 70.3%

Kozak 13 37 31 19 78.7%

1) By estimation, farms have different cultivar structure

2) % of confidence is based on the average of largest discriminant scores

All these farms were planted with BG34, composed of %:

AcknowledgementAcknowledgementWe thank:• Dr J.C. Jang for providing his lab and all

facilities needed for SSR work.

• Dr Mark Sulc and Dr Guo-liang Wang for technical advice and support

• Barenbrug seed Co. for providing seed of BG34 cultivars and lines