Journal of Microbiological Methods 100 (2014) 42–45

Contents lists available at ScienceDirect

Journal of Microbiological Methods

j ourna l homepage: www.e lsev ie r .com/ locate / jmicmeth

Note

Differentiation of Klebsiella pneumoniae carbapenemase (KPC) variantsby pyrosequencing

Jussimara Monteiro a,b, Raymond H. Widen a, Antonio C.C. Pignatari b, Carly Kubasek a, Suzane Silbert a,⁎a Esoteric Testing Laboratory, Pathology Department, Tampa General Hospital, Tampa, United Statesb Laboratório Especial de Microbiologia Clínica, Universidade Federal de São Paulo, São Paulo, Brazil

⁎ Corresponding author at: Esoteric Testing LaboraTampa General Hospital, 1 Tampa General Circle, TaStates. Tel.: +1 813 844 4261.

E-mail address: ssilbert@tgh.org (S. Silbert).

http://dx.doi.org/10.1016/j.mimet.2014.02.0130167-7012/© 2014 Elsevier B.V. All rights reserved.

a b s t r a c t

a r t i c l e i n f o

Article history:Received 13 February 2014Received in revised form 26 February 2014Accepted 26 February 2014Available online 11 March 2014

Keywords:PyrosequencingReal-time PCRKlebsiella pneumoniae carbapenemaseKPC

A fast and reliable protocol using the pyrosequencing technique was developed to identify 11 different types ofthe KPC enzyme. A total of 65 blaKPC positive bacterial isolates were tested and characterized. In the end, thepyrosequencing proved to be a powerful tool for epidemiological studies of KPC producer isolates.

© 2014 Elsevier B.V. All rights reserved.

Klebsiella pneumoniae carbapenemase (KPC) are plasmid-encodedβ-lactamase enzymes capable of hydrolyzing a broad spectrum ofbeta-lactam antibiotics, including carbapenems and monobactams.The emergence and extensive spread of Gram-negative KPC producersworldwide are an important source of concern, as these pathogens areresistant tomost of the antimicrobials currently available for treatment,and just a few new antimicrobial agents are expected to be accessible inthe near future. At this time, KPCs are the most prevalent and clinicallyrelevant β-lactamases of the Ambler Class-A carbapenemase (Chenet al., 2012; Patel and Bonomo, 2013;Queenan andBush, 2007). This ge-notype of resistance has been extensively reported in Enterobacteriaceaeand in some non-fermentative Gram-negative bacilli as Pseudomonasspp. and Acinetobacter spp. (Akpaka et al., 2009; Poirel et al., 2010;Robledo et al., 2010; Villegas et al., 2007). To date, 14 alleles of the blaKPCstructural gene have been described (KPC-2 to 15) on the Lahey Clinicwebsite (http://www.lahey.org/studies/). Still, identification of thesemutations in a clinical laboratory is labor intensive, time-consumingand not appropriate for large-scale epidemiological studies. As a result,the different types of KPC have not been routinely identified in clinicalstrains harboring the blaKPC gene.

Pyrosequencing is a technique that combines standard PCR andsequencing-by-synthesis to rapidly determine the sequence of an

tory, Pathology Department,mpa, FL 33606-3571, United

intended target. This methodology has previously been applied for thedetection and allelic discrimination of some bacterial resistance geneslike GES, TEM, SHV and CTX-M-type extended-spectrum β-lactamases(ESβLs) (Haanperä et al., 2008; Jones et al., 2009; Naas et al., 2007;Poirel et al., 2006). The aim of this study was to develop a fast andcost-effective protocol using pyrosequencing analysis to identify 11 dif-ferent types of the KPC enzyme (KPC-2 to KPC-12).

A total of 57 blaKPC positive Enterobacteriaceaewere tested. Eighteenof them were isolated from patients attending the Tampa GeneralHospital (Tampa, USA) and 39 were isolated from patients attendingtwo different hospitals located in São Paulo (Brazil). In addition, eightKPC producer strains previously characterized by Sanger sequencing(KPC-2 to 8 and KPC-11) were used as positive controls. Bacterial DNAwas extracted using the easyMag platform (bioMerieux, France), ac-cording to the manufacturer's recommendations and the extractedDNA was recovered in 60 μL of the elution buffer. Primers used forPCR (Table 1)were designed to target two different regions of the blaKPCgene. Primer pair F1bio/R1 amplified a fragment of 267 bp (Tm 90 °C)and primer pair F2bio/R2 amplified a fragment of 416 bp (Tm91.5 °C); F1bio and F2bio primers were biotin labeled at their 5′ ends.Real-time PCR (qPCR) was performed using the Rotor-Gene 6000 in-strument (Corbett Life Science, Australia) in a reaction volume of50 μL containing: 25 μL of Platinum SYBR Green qPCR SuperMix(Invitrogen, CA), 2 μL of 10 μM primer solution, 5 μL (2 ng/μL) of DNAtemplate and 18 μL of sterile water. A negative control (RNase-freewater) and a positive controlwere added in each run. Cycling conditionswere as follow: 95 °C for 5min, 45 cycles of 95 °C for 15 s, 54 °C for 30 s,and 72 °C for 15 s and amelt curve step from68 °C to 95 °C. Themelting

Table 1Primers and nucleotide dispensation orders used in the study.

Primer name Sequence (5′ to 3′) Comment Dispensation order

KPC-F1bio CATTCGCTAAACTCGAACAGG Forward amplification primer, biotinylatedKPC-R1 GCTCCGCCACCGTCAT Reverse amplification primerS1 CGCCTGAGCCGGTAT Sequencing primer TCTATCGCGTACACACGATS2 CCGAGATGGGTGACCA Sequencing primer ACAGACAGCGCATGCGKPC-F2bio CCTTCATGCGCTCTATCG Forward amplification primer, biotinylatedKPC-R2 TCCCTCGAGCGCGAGTCTA Reverse amplification primerS3 TGGGATGGCGGAGTT Sequencing primer TCATGCTCAGCTCAGCGTS4 CATTTGCCGTGCCAT Sequencing primer TACAGCTCGCAGTCGTAS5 CGATGACGGCCTCGC Sequencing primer CTGTGACTGTCATCTGTAG

43J. Monteiro et al. / Journal of Microbiological Methods 100 (2014) 42–45

curves resulting from the qPCR were analyzed and the high intensityPCR products amplified were submitted to pyrosequencing.

The pyrosequencingwas performed using a PSQ 96 sample prepara-tion kit and a PSQ 96MA analyzer (AB Biotage, Sweden). Overall, the ex-periment was based on a detailed protocol from the PyrosequencingInc. website, using five sequencing primers (Table 1) designed in ourlaboratory. The amplified biotinylated DNA was converted to puresingle-stranded DNA templates using streptavidin-sepharose beads.Strand elution and subsequent washingwere performed by vacuum fil-tration using the vacuum prep tool (AB Biotage), according to themanufacturer's instructions. The treated samples were inoculated in aplate containing 29.1 μL of annealing buffer and 0.9 μL of 10 μM se-quencing primers. The amplified KPC-F1bio/R1 primer products werepreparedwith S1 and S2 primers and the amplified KPC-F2bio/R2 prod-ucts were prepared with S3, S4 and S5 primers. The nucleotides weresequentially dispensed according to each primer dispensation order(Table 1) and light was produced whenever a dispensed nucleotideformed a base pair with the next available complementary base in theDNA template strand. Light signals were detected on PSQ 96MA systemsoftware version 2.01 (AB Biotage). The pyrogramswere analyzed and aKPC variant was concluded based on the minor nucleotide changes(Table 2). The duration of the whole procedure, from DNA extractionto pyrosequencing analysis was approximately 4 h.

All amplifications performed by qPCR were successfully amplifiedand resulted in consistent qPCR products. The new pyrosequencingprotocol was able to distinguish eight variants of the KPC gene (KPC-2,KPC-3, KPC-4, KPC-5, KPC-6, KPC-7, KPC-8, and KPC-11) used as positivecontrols, as well as to assign a KPC variant to all clinical samples tested.Examples of three KPC variant pyrograms are illustrated in Fig. 1.Among 57 clinical isolates, pyrosequencing results revealed thepresence of 46 K. pneumoniae harboring KPC-2, nine K. pneumoniae har-boring KPC-3 and two Enterobacter cloacae harboring KPC-4. All 39Brazilian samples tested were identified as KPC-2. Samples harboringKPC-3 and KPC-4 variants were isolated from patients attendingTampa General Hospital. To our knowledge, this was the first report ofKPC-4 variants in the State of Florida (USA).

Table 2Nucleotide and amino acid variations among KPC enzymes. In bold are the mutations identifie

GenBank accession number KPC variant Nucleotide (amino acid

147 (49)

AY034847 KPC-2 G (Met)AF395881 KPC-3 G (Met)AY700571 KPC-4 G (Met)EU400222 KPC-5 G (Met)EU555534 KPC-6 G (Met)EU729727 KPC-7 A (Ile)FJ234412 KPC-8 G (Met)FJ624872 KPC-9 G (Met)GQ140348 KPC-10 G (Met)HM066995 KPC-11 G (Met)HQ641421 KPC-12 G (Met)

a Nucleotide (amino acid) positions in comparison to GenBank accession number AY034847

Sequencing based technologies, such as pyrosequencing, havesufficient discrimination potential to be used to identify and differ-entiate antimicrobial resistance genes (Haanperä et al., 2008; Joneset al., 2009; Naas et al., 2007; Poirel et al., 2006). The protocol de-scribed in this study was able to characterize all samples tested, in-cluding the positive controls previously identified by Sangersequencing. The pyrosequencing method, however, bypassed thehigh cost and time-consuming approach of Sanger sequencing anal-ysis. Even though the identification of specific KPC variants might notmodify specific treatment options, such approach could benefit in-fection control measures and clinical research, including diagnosticmicrobiology and epidemiological investigations. In conclusion, thepyrosequencing technique proved to be a rapid tool for the identifi-cation of KPC variants. We have shown in this study the power ofthis technique in identifying the distribution of KPC types in threelarge health care institutions, located in two different countries. Fur-ther studies intending to characterize more samples can use this fastand reliable protocol described in this study to expand the under-standing of KPC variants distribution in a bigger scenario aroundthe world.

This study was performed at the Esoteric Testing Laboratoryfrom Tampa General Hospital. (This study was presented in partat the 52nd Annual Interscience Conference on AntimicrobialAgents and Chemotherapy, San Francisco, CA, 2012 [Poster sectionD-1446].)

Acknowledgments

We would like to thank Dr. Ana C. Gales (UNIFESP, São Paulo, SP,Brazil), Dr. Robert Bonomo, Dr. Andrea Endimiani (VA Hospital,Cleveland, OH, USA) and Dr. Christine Lascols (IHMA, Schaumburg, IL,USA) for providing some of the control strains used in this study. Addi-tionally, we would like to thank the Coordenação de Aperfeiçoamentode Pessoal de Nível Superior (CAPES) that conceded a Post-Doc fellowgrant to J.M. (protocol 1152/10-6).

d in each different KPC-type.

) at positiona

308 (103) 502 (168) 716 (239) 814 (272)

C (Pro) C (Leu) T (Val) C (His)C (Pro) C (Leu) T (Val) T (Tyr)G (Arg) C (Leu) G (Gly) C (His)G (Arg) C (Leu) T (Val) C (His)C (Pro) C (Leu) G (Gly) C (His)C (Pro) C (Leu) T (Val) T (Tyr)C (Pro) C (Leu) G (Gly) T (Tyr)C (Pro) C (Leu) C (Ala) T (Tyr)G (Arg) C (Leu) T (Val) T (Tyr)T (Leu) C (Leu) T (Val) C (His)C (Pro) A (Met) T (Val) C (His)

.

a

b

c

d

e

a

b

c

d

e

a

b

c

d

e

(I) KPC - 2 (II) KPC - 4 (III) KPC - 7

Fig. 1.Amplified products by KPC-F1bio/R1 primers preparedwith S1 (a) and S2 (b) sequencing primers and amplified products by KPC-F2bio/R2 primers preparedwith S3 (c), S4 (d) andS5 (e) sequencing primers. The pyrograms (I a)–(III a) and (I e)–(III e) represent Met49Ile and His272Tyr substitution of KPC-2 to KPC-7. The pyrograms (I b)–(II b) and (I d)–(II d)represent Pro103Arg and Val239Gly substitution of KPC-2 to KPC-4.

44 J. Monteiro et al. / Journal of Microbiological Methods 100 (2014) 42–45

References

Akpaka, P.E., Swanston, W.H., Ihemere, H.N., Correa, A., Torres, J.A., Tafur, J.D.,Montealegre, M.C., Quinn, J.P., Villegas, M.V., 2009. Emergence of KPC-producingPseudomonas aeruginosa in Trinidad and Tobago. J. Clin. Microbiol. 47, 2670–2671.

Chen, L.F., Anderson, D.J., Paterson, D.L., 2012. Overview of the epidemiology and thethreat of Klebsiella pneumoniae carbapenemases (KPC) resistance. Infect. Drug Resist.5, 133–141.

Haanperä, M., Forssten, S.D., Huovinen, P., Jalava, J., 2008. Typing of SHV extended-spectrum beta-lactamases by pyrosequencing in Klebsiella pneumoniae strainswith chromosomal SHV beta-lactamase. Antimicrob. Agents Chemother. 52,2632–2635.

Jones, C.H., Ruzin, A., Tuckman, M., Visalli, M.A., Petersen, P.J., Bradford, P.A., 2009. Pyrose-quencing using the single-nucleotide polymorphism protocol for rapid determinationof TEM- and SHV-type extended-spectrum beta-lactamases in clinical isolates andidentification of the novel beta-lactamase genes blaSHV-48, blaSHV-105, andblaTEM-155. Antimicrob. Agents Chemother. 53, 977–986.

Naas, T., Oxacelay, C., Nordmann, P., 2007. Identification of CTX-M-type extended-spectrum-beta-lactamase genes using real-time PCR and pyrosequencing.Antimicrob. Agents Chemother. 51, 223–230.

Patel, G., Bonomo, R.A., 2013. “Stormy waters ahead”: global emergence ofcarbapenemases. Front. Microbiol. 4, 1–13.

Poirel, L., Naas, T., Nordmann, P., 2006. Pyrosequencing as a rapid tool for identification ofGES-type extended-spectrum beta-lactamases. J. Clin. Microbiol. 44, 3008–3011.

45J. Monteiro et al. / Journal of Microbiological Methods 100 (2014) 42–45

Poirel, L., Nordmann, P., Lagrutta, E., Cleary, T., Munoz-Price, L.S., 2010. Emergence of KPC-producing Pseudomonas aeruginosa in the United States. Antimicrob. AgentsChemother. 54, 3072.

Queenan, A.M., Bush, K., 2007. Carbapenemases: the versatile beta-lactamases. Clin.Microbiol. Rev. 20, 440–458.

Robledo, I.E., Aquino, E.E., Santé, M.I., Santana, J.L., Otero, D.M., León, C.F., Vázquez, G.J.,2010. Detection of KPC in Acinetobacter spp. in Puerto Rico. Antimicrob. AgentsChemother. 54, 1354–1357.

Villegas, M.V., Lolans, K., Correa, A., Kattan, J.N., Lopez, J.A., Quinn, J.P., Colombian Nosoco-mial Resistance Study Group, 2007. First identification of Pseudomonas aeruginosaisolates producing a KPC-type carbapenem-hydrolyzing beta-lactamase. Antimicrob.Agents Chemother. 51, 1553–1555.