RESEARCH ARTICLE

Differential regulation of meristem size, morphology andorganization by the ERECTA, CLAVATA and class III HD-ZIPpathwaysTali Mandel1,*, Hector Candela2,*, Udi Landau1, Lior Asis1, Einat Zelinger1, Cristel C. Carles3,4,5,6 andLeor Eshed Williams1,‡

ABSTRACTThe shoot apical meristem (SAM) of angiosperm plants is a small,highly organized structure that gives rise to all above-ground organs.The SAM is divided into three functional domains: the centralzone (CZ) at the SAM tip harbors the self-renewing pluripotentstem cells and the organizing center, providing daughter cells thatare continuously displaced into the interior rib zone (RZ) or thesurrounding peripheral zone (PZ), from which organ primordia areinitiated. Despite the constant flow of cells from the CZ into the RZ orPZ, and cell recruitment for primordium formation, a stable balance ismaintained between the distinct cell populations in the SAM. Here wecombined an in-depth phenotypic analysis with a comparative RNA-Seq approach to characterize meristems from selected combinationsof clavata3 (clv3), jabba-1D ( jba-1D) and erecta (er) mutants ofArabidopsis thaliana. We demonstrate that CLV3 restricts meristemexpansion along the apical-basal axis, whereas class III HD-ZIP andER pathways restrict meristem expansion laterally, but in distinct andpossibly perpendicular orientations. Our k-means analysis revealsthat clv3, jba-1D/+ and er lead to meristem enlargement by affectingdifferent aspects of meristem function; for example, clv3 displaysan increase in the stem cell population, whereas jba-1D/+ er exhibitsan increase in mitotic activity and in the meristematic cell population.Our analyses demonstrate that a combined genetic and mRNA-Seqcomparative approach provides a precise and sensitive method toidentify cell type-specific transcriptomes in a small structure, such asthe SAM.

KEY WORDS: MIR166, Organizing center, Phyllotaxis, Stem cells,WUSCHEL

INTRODUCTIONIn plants, all above-ground organs develop post-embryonically froma small group of pluripotent stem cells that reside at the shoot tips ina highly organized structure called the shoot apical meristem(SAM). The SAM can be divided into three functional zones. The

central zone (CZ) harbors the self-renewing stem cells that arecharacterized by low mitotic activity, and their descendants arecontinuously displaced downward into the interior rib zone (RZ)to further contribute to vascular tissue and stem structures, ortoward the surrounding peripheral zone (PZ) (Schoof et al., 2000;Steeves and Sussex, 1989). Cells at the PZ divide at a faster rateand provide the founder cells for leaf or flower primordiathat initiate at the flank of the SAM in a precise positioningtermed phyllotaxis (Traas, 2013). To ensure proper stabledevelopment despite the constant flow of cells from the CZ intothe RZ and PZ and their subsequent differentiation andrecruitment for primordium initiation, the relative ratio of cells ineach functional domain must be maintained. Consequently, thehomeostasis between cell proliferation and differentiation isbalanced by a complex genetic network that involves hormones,receptor kinase pathways, transcription factors (TFs), small RNAsand chromatin regulators (Sablowski, 2009; Sun and Ito, 2015;Williams and Fletcher, 2005).

At the core of this network is theWUSCHEL (WUS) gene, which isexpressed in the organizing center (OC) at the lower part of the CZ,just below the stem cell reservoir, and encodes a TF that specifies stemcell fate in the overlying cells (Gross-Hardt and Laux, 2003; Lauxet al., 1996; Mayer et al., 1998).WUS expression is partly restricted bya spatial negative-feedback loop, in which WUS activates thetranscription of the CLAVATA3 (CLV3) ligand-encoding gene in thestem cells, and CLV3 in turn restricts WUS expression to the OC(Brand et al., 2000; Schoof et al., 2000). Cells that cross the boundarydefined by CLV function establish the founder cells for primordiainitiation (Schoof et al., 2000). Accordingly, the CZ in clv3mutants isdramatically increased in size, leading to enlarged meristems thatproduce an excess of organ primordia along their periphery (Clarket al., 1995; Fletcher et al., 1999; Szczesny et al., 2009).

Members of the class III homeodomain-leucine zipper (HD-ZIPIII) TFs also affect SAM homeostasis (Green et al., 2005; Priggeet al., 2005). In jabba-1D ( jba-1D) plants, overexpression ofMIR166g causes a decrease in the transcript levels of three HD-ZIPIII genes: PHABULOSA (PHB), PHAVOLUTA (PHV) and CORONA(CNA), which leads to expansion of the WUS expression domain,resulting in an enlarged SAM (Williams et al., 2005). We previouslyshowed that reduction in ERECTA (ER) kinase receptor-like functionenhances the jba-1D meristem phenotype, so that the double mutantexhibits extremely enlarged meristems with altered phyllotaxis(Mandel et al., 2014). We hypothesized that the increased surfaceof jba-1D/+ er-20 meristems provides adequate distance to allowseveral auxin maxima, and therefore several organ primordia, todevelop simultaneously (Mandel et al., 2014).

Here we combined an in-depth phenotypic analysis with acomparative RNA-Seq approach to characterize and compareReceived 18 August 2015; Accepted 3 March 2016

1The Robert H. Smith Faculty of Agriculture, Food and Environment, The HebrewUniversity of Jerusalem, POB 12, Rehovot 76100, Israel. 2Instituto de Bioingenierıa,UniversidadMiguel Hernandez, Campus de Elche, Elche 03202, Spain. 3UniversiteGrenoble Alpes, Laboratoire de Physiologie Cellulaire et Vegetale (LPCV),Grenoble F-38054, France. 4CNRS, LPCV, UMR 5168, Grenoble F-38054, France.5CEA, Direction des Sciences du Vivant, BIG, LPCV, Grenoble F-38054, France.6INRA, LPCV, Grenoble F-38054, France.*These authors contributed equally to this work

‡Author for correspondence (leor.williams@mail.huji.ac.il)

This is an Open Access article distributed under the terms of the Creative Commons AttributionLicense (http://creativecommons.org/licenses/by/3.0), which permits unrestricted use,distribution and reproduction in any medium provided that the original work is properly attributed.

1612

© 2016. Published by The Company of Biologists Ltd | Development (2016) 143, 1612-1622 doi:10.1242/dev.129973

DEVELO

PM

ENT

meristems from selected single, double and triple mutantcombinations of clv3, jba-1D/+ and er, which display a gradientof vegetative SAM enlargement. We demonstrate that meristem sizedetermines phyllotaxis pattern. We show that clv3, jba-1D/+ and erlead to meristem enlargement by affecting different aspects ofmeristem function and that the three pathways restrict meristemexpansion in distinct directions. Moreover, our bioinformaticsanalyses demonstrate that the strategy of using different geneticbackgrounds and an mRNA-Seq comparative approach facilitatesthe very sensitive identification of cell-specific gene expression in asmall and embedded structure such as the shoot apex.

RESULTSMeristem size regulates phyllotaxisWe previously reported that the CLV, HD-ZIP III and ER pathwaysregulate the WUS-dependent inflorescence and floral meristemactivities in parallel (Landau et al., 2015; Mandel et al., 2014).Interactions between CLV and ER in regulating shoot and floralmeristem, and between CLV and HD-ZIP III in regulating WUS-independent meristem activity, were also reported by others(Durbak and Tax, 2011; Lee and Clark, 2015). To test how thesepathways interact to control the vegetative SAM activities, weanalyzed seedlings of wild-type Col-0, clv3-2 and jba-1D/+ singlemutants, a jba-1D/+ er-20 double mutant, and a clv3-2 jba-1D/+ er-20 triple mutant. Seedlings of these genotypes grown for 16 daysunder long-day conditions exhibited a gradual alteration in theirphyllotactic pattern. In all genotypes, the first pair of true leavesemerges opposite to each other. However, the expected transition toa spiral phyllotaxis pattern seen in Col-0 (Fig. 1A) is altered in theclv3-2mutant to a decussate pattern, in which the two primordia thatinitiate opposite each other at the same level are perpendicular to thesuccessive pair of primordia (Bartlett and Thompson, 2014)(Fig. 1B). The jba-1D/+ mutant shows less obvious decussatephyllotaxis (Fig. 1C), although this is difficult to determine due tothe curled-leaf phenotype. However, 59 out of 100 of the jba-1D/+er-20 seedlings and 64 out of 100 of the clv3-2 jba-1D/+ er-20triple mutant exhibit whorled phyllotaxis, in which four leaves areof similar size, suggesting that they developed simultaneously at thesame level (Fig. 1D,E). Growing the plants for 45 days undershort-day conditions, we observed enhancement of the alteredphyllotaxis phenotypes (Fig. 1G-J). Whereas Col-0 plants stillexhibited a perfect spiral pattern, the number of leaves emergingsimultaneously increased in all mutant genotypes, mostdramatically in the triple mutant. The CLV3, HD-ZIP III and ERpathways have all been shown to regulate meristem size (Chen et al.,2013; Clark et al., 1995; Fletcher et al., 1999; Prigge et al., 2005;

Uchida et al., 2013), and hence the distinct alteration in phyllotaxisbetween genotypes and between time points might result from agradual increase in meristem size that can provide sufficient space toallow the concurrent initiation of multiple leaf primordia.

To examine further the effect of meristem size on phyllotaxis, weperformed scanning electron microscopy (SEM) analyses of 8- and15-day-old seedlings of the different genotypes (Fig. 2). The imagesshown are of typical meristems chosen from among five meristemsanalyzed per genotype and time point. The SEM images clearlydemonstrate the gradient in meristem size from single throughdouble to triple mutants, indicating that the CLV3, HD-ZIP III andER pathways act in parallel to regulate vegetative meristem size. Inaddition, the SEM images confirm the initiation of primordia at thesame level and therefore confirm the designated phyllotaxis. Theincrease in meristem size correlates with the alterations inphyllotaxis, which are enhanced after 15 days in all genotypesexcept for jba-1D/+. For example, in clv3-2, two leaf primordiaemerge in a decussate phyllotaxis in 8-day-old seedlings (Fig. 2B,G),but at 15 days the meristem produces three and sometimes fourprimordia simultaneously (Fig. 2L).

Distinct effects of CLV3, HD-ZIP III and ER on meristemshape and sizeLongitudinal sections of 8-day-old seedlings further demonstratethe gradual increase in meristem size between the differentgenotypes, which correlates with the changes in phyllotaxis, suchthat the triple mutant exhibits the largest meristem (Fig. 3A-E). Astriking finding was the distinct nature of the meristem enlargement.Whereas the clv3-2 meristem expands preferentially in the apical-basal direction (i.e. it is more convex) (Fig. 3B), the jba-1D/+ andjba-1D/+ er-20meristems expanded along the central-to-peripheralaxis (radially or laterally) (Fig. 3C,D), and the triple-mutantmeristem expanded in both the apical-basal direction and laterally.This suggests that the CLV3 pathway affects meristem shape andorganization in a fundamentally different manner than the HD-ZIPIII and ER pathways.

To assess the possibility of a temporal increase inmeristem size, weused X-ray micro-computed tomography (micro-CT) of 15-day-oldseedling meristem from Col-0, jba-1D/+ er-20 and clv3-2 jba-1D/+er-20 mutants (Fig. 3F-K). This technique enabled us to examineboth longitudinal (Fig. 3F-H) and transverse (Fig. 3I-K) sections fromindividual intact meristems, and to generate three-dimensional (3D)reconstructed images (Fig. S1) and movies. In Col-0, the meristemsizes of 8- and 15-day-old seedlings appear to be similar (Fig. 3A,F),indicating that meristem homeostasis is maintained during theadditional 7 days of growth. This concurs with the temporally

Fig. 1. Genotypes exhibiting increasing meristem size showaltered phyllotactic patterns. Sixteen-day-old A. thalianaseedlings grown under long days (A-E) and 45-day-old plantsgrown under short days (F-J) of Col-0 (A,F), clv3-2 (B,G), jba-1D/+(C,H), jba-1D/+ er-20 (D,I), clv3-2 jba-1D/+ er-20 (E,J). Col-0exhibits a typical spiral phyllotactic pattern, whereas clv3-2 jba-1D/+er-20 exhibits a whorled phyllotactic pattern. Scale bars: 1 mm inA-E; 2 mm in F-J.

1613

RESEARCH ARTICLE Development (2016) 143, 1612-1622 doi:10.1242/dev.129973

DEVELO

PM

ENT

unaffected spiral phyllotaxis in Col-0 (Fig. 1F, Fig. 3I). However, aminor increase in size of the jba-1D/+ er-20 double-mutant meristemand a dramatic enlargement of the triple-mutant meristem (Fig. 3B,D,G,H) indicate that once the homeostasis is impaired, the imbalanceenhances over time. The 15-day-old clv3-2 jba-1D/+ er-20 seedlingexhibits a much wider and taller meristem than jba-1D/+ er-20 andCol-0. Moreover, a 3D view of Col-0 and the triple mutant (Movies 1and 2) strongly emphasizes the dramatic increase in the triple-mutantmeristem in all three dimensions (x, y and z axes), and shows that themeristem acquires a cylindrical shape. Movies of reconstructed seriallongitudinal sections (RCSs) (Movies 3-5) reveal that the typical

dome-shaped meristem morphology observed in Col-0 and the jba-1D/+ er-20mutant shifts toward a rectangular-like shape in the triplemutant, in which the basal and top meristem widths are similar(Fig. 3H, red dashed lines). However, transverse sections and RCSmovies (Fig. 3I-K,Movies 6-8), which provide a top view, reveal thatthe 15-day-old clv3-2 jba-1D/+ er-20meristem is circular, indicatingthat at 15 days the triple-mutant SAM expands radially, equally in allcentral-to-peripheral axes, forming an isodiametric rather thanelongated meristem (fasciated). These sections also highlight themassive increase in meristem size that occurs when all three pathwaysare reduced.

Fig. 2. Mutants with increased meristem size exhibit altered phyllotactic patterns. SEM images of 8-day-old seedlings showing top (A-E) and side (F-J)view and of 15-day-old seedlings (K-O) of five genotypes with increased meristem size. Typical meristems are shown from among five analyzed per genotype.The meristem sizes of the jba-1D/+ single mutant, jba-1D/+ er-20 double mutant and clv3-2 jba-1D/+ er-20 triple mutant gradually increase as the plantgrows, with 15-day-old seedlings having much larger meristems than wild type. (A,F,K) Meristem and leaf primordia are false-colored red and green, respectively.Scale bars: 50 μm.

Fig. 3. Mutants with disturbedmeristemhomeostasis displaya gradual increasein meristem size. (A-E) Longitudinalsections of 8-day-old seedlings and (F-K)X-ray micro-CT sections of 15-day-oldseedlings showing (F-H) longitudinal and(I-K) transverse sections. There is acorrelation between increased meristemsize and the number of leaf primordia. Thedashed red lines highlight the shift to arectangular meristem morphology in thetriple mutant. Reconstructed serialsections for 15-day-old seedlings arepresented as Movies 1-8. Scale bars:50 μm.

1614

RESEARCH ARTICLE Development (2016) 143, 1612-1622 doi:10.1242/dev.129973

DEVELO

PM

ENT

To quantify the changes in meristem width and height, wemeasured sections of ten meristems from each genotype at 9 and15 days (Fig. 4, Figs S2 and S3). Genotypeswith a clv3-2 backgroundexhibit significantly taller meristems than other genotypes in both 9-and 15-day-old seedlings (Fig. 4B,D). A gradual increase in meristemwidth was observed, in which the triple mutant exhibits the widestmeristem (Fig. 4E,C). The jba-1D/+ and jba-1D/+ er-20 meristemsexpand laterally (Fig. 3C,D), yet in the SEM images (n=5) the jba-1D/+ meristem is elongated whereas the jba-1D/+ er-20 meristemsappear to be more circular (Fig. 2C,D). Longitudinal sections providetwo-dimensional (2D) information. Therefore, to be more precisewe sectioned these genotypes in two orientations: parallel (Pl) orperpendicular (Pr) to the cotyledons as described in Fig. 4A. Asexpected, the widths of jba-1D/+ and jba-1D/+ er-20 meristemsdiffer depending on the orientation of sectioning. However, whereasjba-1D/+ shows a difference between average meristem widths with

70 µm for Pr and 103 µm for Pl at 15 days, the difference in jba-1D/+er-20 isminor with 109 µm for Pr and 122 µm for Pl (Fig. 4E, Fig. S3,Table S1). This provides evidence for the elongated meristem in jba-1D/+, inwhich themeristem is narrow in one direction andwide in theother, and suggests that the jba-1D/+ er-20meristem is more circular.Adding er-20 to jba-1D/+ leads to meristem enlargement, but moststriking is the result obtained when analyzing the widths of themeristems separately for each orientation: the increase in width in thePr orientation is much greater (70 µm for jba-1D/+ to 109 µm for jba-1D/+ er-20) than in the Pl orientation (103 µm to 122 µm) (Fig. 4E,Table S1). Altogether, this suggests that in jba-1D/+ the meristemexpands laterally in one direction and that the addition of er-20 leadsto expansion in the perpendicular direction. It also indicates that thedirection of meristem expansion is associated with the position of thecotyledons, a phenomenon that will provide an exciting challenge forfuture investigation.

SEM analysis of inflorescence meristems (IMs) at 24 days afterbolting further highlights the fundamental differences in the regulationof meristemmorphology by each of the pathways (Fig. 5). Images areshown for typical meristems chosen from among five meristemsanalyzed per genotype. In the IM, the perfect spiral phyllotaxis ofCol-0 (Fig. 5A,B) is altered in clv3-2, inwhich five to six primordia initiateat the same level (Fig. 5D). The clv3-2 IMs also exhibit a dramaticincrease in height (Fig. 5C, Fig. S4B,C); however, width and lengthmeasurements of top viewSEMimagesof IMs (n=8) sampled 14 daysafter bolting (in the caseof circularmeristem it is thediameter), reveal aminor increase in clv3-2 diameter compared with Col-0 meristems(Fig. 5A, Fig. S5). This phenotype demonstrates that in clv3-2 the IMalso expands preferentially in the apical-basal direction. Although theclv3-2 IM ismuch taller, flower primordia are formed only at the flankof the meristem base, with no organ initiating on the upper part of thedome. In line with previous reports proposing that loss-of-functionmutations in CLV3 result in a dramatic increase in the stem cellpopulation (Fletcher et al., 1999; Laufs et al., 1998; Schoof et al.,2000),we suggest thatmost of theupperdomesection is the result of anincrease in the stem cell population, which retains a pluripotent fate,and in CZ size, thus preventing cell differentiation and primordiuminitiation.

By contrast, the jba-1D/+ vegetative meristem expands laterally(Fig. 2C,M) and the IM is extremely fasciated (Fig. 5E, Fig. S4). Thejba-1D/+ IM exhibits the largest ratio between length and width ofthe IM (17.38, Fig. S5C). This indicates that the HD-ZIP III genes donot affect meristem growth equally in all directions but rather restrictexpansion to a specific lateral orientation. Adding er to jba-1D/+further increases SAM size but the meristem expands along the axisperpendicular to that of the elongated jba-1D/+meristem, shifting thevegetative meristem toward a more symmetrical dome (Fig. 2D,I,N)and the IM to a less elongated but wider form than that of jba-1D/+.Although, as was previously reported in some jba-1D/+ er-20 plants(Mandel et al., 2014), and in the triple mutant the IMs split into smallunits (Fig. 5), the lateral organs form only at the periphery of the entireIM structure, and therefore we refer to it as one meristem. The widerIM phenotype supports the hypothesis of the existence of x and y axesin the presumably symmetrical dome-shaped meristem, and suggeststhat the HD-ZIP III and ER pathways restrict meristem enlargementlaterally in distinct and possibly perpendicular orientations.

Within genotypes the IMs appear to be very similar and showlittle variability, except for jba-1D/+ er-20, where IMs vary inshape and size (Figs S4 and S5). Thus, we aimed to explore ERregulation outside of the jba-1D/+ background. ER loss-of-function does not lead to obvious defects in meristem regulation,possibly owing to redundancy (Uchida et al., 2013). To further

Fig. 4. Vegetative SAM width and height in wild-type and mutantseedlings. Measurements of meristem width and height were made onmedian longitudinal section through 9- and 15-day-old seedlings. (A) For twogenotypes, namely jba-1D/+ and jba-1D/+ er-20, longitudinal sections wereprepared in two orientations: parallel to the cotyledons (red line, Pl) orperpendicular to the cotyledons (blue line, Pr). An example for bothorientations in 8- and 15-day-old seedlings is shown for jba-1D/+ (meristemsize appears to be indistinguishable between the two orientations in othergenotypes). Meristem width and height were measured in ImageJ as shown bythe yellow lines. Scale bars: 100 µm. (B-E) Box plot representations of dataderived by image analysis of meristem height (B,D) and width (C,E) of 9- and15-day-old seedlings. Black center lines show the median; box limits indicatethe 25th and 75th percentiles; whiskers extend to 5th and 95th percentiles,outliers are marked by dots; for all measurements n=10 (the data are given inTable S1). Representative meristem sections for the two time points for allgenotypes are shown in Figs S2 and S3. Significant differences (P<0.05, non-parametric multi-comparison Steel-Dwass test) are indicated by differentlowercase letters above the box. In C and E the analysis was performedseparately for parallel (blue letters) and for perpendicular (brown letters)sections.

1615

RESEARCH ARTICLE Development (2016) 143, 1612-1622 doi:10.1242/dev.129973

DEVELO

PM

ENT

investigate the involvement of ER in the regulation of lateralexpansion of the meristem, we analyzed the effect of er on theclv3-2 IM (Fig. 5F, Fig. S4F). Amazingly, er transforms the tall,radially symmetrical dome-shaped meristem of clv3-2 into anextremely narrow, elongated meristem with numerous flowerprimordia emerging simultaneously, indicating that ER restrictsmeristem lateral expansion.Further support for the differential directions of expansion is

provided by the shape of the triple-mutant meristem. The jba-1D/+and clv3-2 er-20 IMs are both fasciated (Fig. 5E,F). Since the threepathways act in parallel, one would expect that in a cross betweenthe two mutants jba-1D/+ and clv3-2 er-20 they would actadditively or synergistically and the result will be an extremelyelongated/fasciated IMmeristem. However, the clv3-2 jba-1D/+ er-20 triple-mutant IM exhibits an enormously enlarged meristem ofremarkably isodiametric shape (Fig. 5H, Fig. S4). The ratio of 1.07between maximal length and maximal width further demonstratesthe circular shape of the IM. Simultaneous growth in two directionsperpendicular to each other might lead to a radial shape. Therefore,the radial symmetry of the triple-mutant meristem reinforces theidea of the HD-ZIP III and ER pathways restricting meristemoutgrowth in perpendicular lateral directions. Testing thishypothetical scenario constitutes a future challenge.

Genome-wide analysis of gene expression in the vegetativemeristemSAM enlargement can be due to enlargement of the CZ, the PZ, orboth, as a result of an increase in the number of cells that acquirestem cell identity or an increase in the mitotic activity at the PZ, adecrease in cell transition from CZ to PZ, or a decrease in the

incorporation of cells into primordia (Pautler et al., 2015; Schoofet al., 2000). Our phenotypic analyses led us to hypothesize thatclv3, jba-1D/+ and er lead to meristem enlargement by affectingdifferent aspects of meristem function. To test this, we performedmRNA-Seq analysis on pools of meristem-enriched tissues from 45seedlings that included leaf primordia, similar to those shown inFig. 2, collected from each of the genotypes as described in Fig. S6at 8 and 15 days of growth.

The experiment was performed with one replicate owing to thelaborious work involved in the collection of meristems. Validation ofthe results was achieved by examining the expression levels ofpreviously reported genes and by reverse transcription quantitativereal-time PCR (RT-qPCR). On average, 40 M reads were mapped tothe genome (Table S2) and the expression levels of all annotatedgenes (TAIR10, https://www.arabidopsis.org/) in each sample,expressed as reads per kilobase of transcript per million sequencedreads (RPKM), was calculated (see GEO accession numberGSE79839). To validate our transcriptomic analysis, we firstexamined the expression of the MIR166g (AT5G63715) precursorpreviously shown to be upregulated in jba-1D/+ and the expression ofthree of its HD-ZIP III targets, namely PHB, PHV and CNA,previously shown to be downregulated in jba-1D/+ (Williams et al.,2005). At both time points,MIR166g transcripts were undetectable inCol-0 and clv3-2meristems (RPKM of 0), but reached RPKM valuesbetween 106 and 236 in the meristems of all mutant combinations inthe jba-1D/+ background (Fig. 6A). This pattern was specific to theMIR166g precursor and was not observed in any of the other eightMIR165 orMIR166 genes. The three HD-ZIP III members, as well asLITTLE ZIPPER 1 (ZPR1), which requires HD-ZIP III function forexpression (Wenkel et al., 2007), were all downregulated in mutants

Fig. 5. Reductions in CLV3, HD-ZIP IIIand ER functions differentially affectmeristem morphology. SEM images ofinflorescence meristems (IMs) 24 daysafter bolting reveal different sizes andshapes in the different genotypes.(A,B) Col-0 IM displaying a spiralphyllotactic pattern. (C,D) clv3-2 IM (inCol-0 background) displaying a tallerstructure and altered phyllotaxis.(E) jba-1D/+ fasciated IM. (F) clv3-2 er-20IM exhibiting a long and narrow meristem.(G,H) clv3-2 jba-1D/+ er-20 IM displayingenlargement in all directions. (I) Addinger-20 to jba-1D/+ causes the meristem tobecome wider and to split. (A,C,G) Sideview; (B,D-F,H,I) top view. The images areof typical meristems from among fivemeristems analyzed per genotype. Scalebars: 100 µm in A,C-I; 50 µm in B.

1616

RESEARCH ARTICLE Development (2016) 143, 1612-1622 doi:10.1242/dev.129973

DEVELO

PM

ENT

with a jba-1D/+ background, as compared with Col-0 and clv3-2 inboth 8- and 15-day-old meristems. The mRNA-Seq data were alsovalidated by RT-qPCR performed on these genes and others (seebelow), using RNA obtained in an independent experiment, all ofwhich showed similar results to those of the mRNA-Seq (Fig. S7).Differential expression of CLV3 further validated our analysis.

The CLV3 gene is a well-established marker for stem cells at the tipof the SAM (Aggarwal et al., 2010; Schoof et al., 2000), and CLV3

is expressed in clv3-2 meristems as the clv3-2 allele is known tocarry a breakpoint in the third exon that does not prevent itstranscription (Fletcher et al., 1999; Hobe et al., 2003). We andothers (Fletcher et al., 1999; Laufs et al., 1998; Schoof et al., 2000)have proposed that meristem enlargement in clv3 mutants is theresult of an increase in the stem cell population. Therefore, shiftingthe ratio between cell populations in the SAM towards more stemcells, we expected to see a high level of CLV3 transcripts in

Fig. 6. Expression profiles of selected genes in themeristem of wild-type and mutants validate themRNA-Seq analysis. (A) RPKM values of MIR166g,its HD-ZIP III targets and ZPR1, showing a high levelofMIR166g and a low level of its targets in genotypeswith the jba-1D/+ background, validating the mRNA-Seq analysis. (B) Correlation matrix for the expressionof genes in cluster 687. The correlation coefficients forpairs of genes were subjected to two-way hierarchicalclustering using Cluster Gene. The white squaremarks the subset that includes CLV3, which isdiscussed in the text. (C) Heat map of selected genesco-expressed with CLV3 from cluster 687 (GEOaccession GSE79839). Genes shown to beexpressed exclusively in the CZ are underlined in red(Yadav et al., 2009). The heat map was produced byclustering the normalized values using thehierarchical clustering algorithm implemented inGeneCluster (for details see the supplementary Materialsand Methods).

1617

RESEARCH ARTICLE Development (2016) 143, 1612-1622 doi:10.1242/dev.129973

DEVELO

PM

ENT

mutants with the clv3-2 background. Indeed, the RPKM valueswere 49 and 47 in clv3-2, and 47 and 124 in clv3-2 jba-1D/+ er-20,for 8- and 15-day-old meristems, respectively, whereas all othersamples showed values in the range of 1.3 to 3.2 (GEO accessionGSE79839). Furthermore, to correlate gene expression patternswith phenotypes and meristem functions, a k-means (k=1000)clustering algorithm was used to assign genes to expressionclusters. Out of the 76 genes that were highly correlated inexpression with that of CLV3 and assigned to the same cluster(cluster 687; GEO accession GSE79839), seven were previouslyshown by in situ hybridization to be expressed exclusively in theCZ (Yadav et al., 2009). These seven genes validated ourclustering analysis and suggest that our mRNA-Seq analysisidentified many candidate stem cell-specific genes for futurevalidation. To identify a more reliable core set of genes related tostem cell function, we further calculated the correlationcoefficients for all possible gene pairs in cluster 687 andclustered the genes based on the Euclidean distance of theircorrelation coefficients using a hierarchical clustering algorithm.The result, represented as a heat map (Fig. 6B), allowed us to selecta group of 23 genes that were most highly correlated with theCLV3pattern of expression. The relative expression of 18 out of these 23genes (five were omitted owing to their low RPKM values) in thefive genotypes at two time points is illustrated as a heat map(Fig. 6C). The high relative expression levels of these genes in clv3and clv3-2 jba-1D/+ er-20 provides further evidence for a highproportion of stem cells in clv3 meristems, indicating that clv3leads to meristem enlargement by increasing the number of cellsspecified as stem cells. Furthermore, whereas in clv3 these 18genes showed similar expression values in 8- and 15-day-oldmeristems, in the triple mutant the expression value was muchhigher in 15-day-old versus 8-day-old meristems (intense yellowin the heat map in Fig. 6C), consistent with the phenotypicenhancement (Fig. 1E,J, Fig. 2E,O, Fig. 3E,H). This stronglysupports the idea of a gradual increase in the imbalance ofhomeostasis when the three pathways regulating meristemfunction are impaired.

ER regulates mitotic activity in the PZThe relatively low expression level of CLV3 and its co-expressedgenes in jba-1D/+ and jba-1D/+ er-20 (Fig. 6C, Fig. S7; GEOaccession GSE79839) suggests that in both mutants the increase inmeristem size is either proportional for all zones, such that the CLV3expression level is similar to that seen in Col-0, or results from anincrease in the meristematic cell population outside of the CZ thatdoes not express CLV3. Another possibility is an increase in thenumber of leaf primordia, leading to dilution of CLV3 mRNA.The cell division rate in the CZ is lower than at the meristem

periphery (Cockcroft et al., 2000; Geier et al., 2008; Grandjean et al.,2004; Laufs et al., 1998). To gain insight into the proliferation rate inthe meristem of the different genotypes, we analyzed the expressionpatterns of mitotic activity marker genes. Histones are the primaryprotein components of chromatin and their transcription is tightlycoupled to DNA replication during S phase of the cell cycle(Takayama and Toda, 2010); as such, they serve as a marker for celldivision activity (Geier et al., 2008; Meshi et al., 2000). The k-meansanalysis, presented as a heat map (Fig. 7A), reveals that out of the 42histone genes that showed expression in this mRNA-Seq analysis, 11genes corresponding to the four core histones were assigned to cluster628 (Table S3; GEO accession GSE79839), which is also enrichedwith many genes involved in cell division. To categorize thefunctions of the 52 genes assigned to cluster 628, we searched for

significantly enriched gene ontology (GO) terms using singularenrichment analysis, as implemented in agriGO (see the Materialsand Methods). Some GO terms representative of those enriched incluster 628 were ‘DNA-dependent DNA replication’ (GO:0006261;P=1.37×10–7), ‘cell cycle process’ (GO:0022402; P=6.87×10–8),‘chromosome organization’ (GO:0051276; P=8.28×10–14) and ‘cellproliferation’ (GO:0008283; P=2.08×10–7). This suggests that thek-means analysis precisely identified a set of genes that are co-expressed specifically in a group of cells exhibiting high mitoticactivity.

Three distinct patterns were evident in the heat map (Fig. 7A).First, the differential expression patterns of all histones between thetwo time points. Second, a group of seven histones at the lowest partof the heat map exhibits an expression pattern opposite to that of theother histones. Accordingly, their relative expression level is low inthe 8-day-old meristems and high in the 15-day-old meristems.Interestingly, the three genes encoding histone H1, which linksnucleosomes into higher order structures, appear in this group.Third, the remarkable differential expression between genotypes inthe 15-day-old meristems. The highest relative expression level isobserved in jba-1D/+ er-20 meristems, indicating high mitoticactivity, and implying that jba-1D/+ er-20 meristems have anenlarged PZ with high cell proliferation rates. Alternatively, achange in the ratio between meristem and leaf primordium numbers,where a high rate of cell division takes place, could also explain thishigh mitotic activity. However, the SEM images of 8-day-oldseedlings reveal, for example, that jba-1D/+ er-20 has fourprimordia (Fig. 2D) and that clv3-2 at 15 days has three youngprimordia surrounding a small meristem (Fig. 2L), suggesting ahigh ratio of primordia cells to meristem cells. Yet, both jba-1D/+er-20 at 8 days and clv3-2 at 15 days exhibit relatively lowexpression of histones and cell cycle genes. The high ratio of leafprimordia to meristem in clv3-2 at 15 days as compared with jba-1D/+ er-20 is also clearly demonstrated in all the sections(Fig. S3B,E,F). Therefore, we believe that the relatively highexpression of histones and cell cycle genes observed in jba-1D/+er-20 is due to an increase in the number of meristematic cells andnot to an increase in the ratio of primordia to meristem. Theexpression pattern of cell cycle genes provides additional supportfor the low mitotic activity in Col-0, clv3 and jba-1D/+, and for themoderate and high mitotic activity in clv3-2 jba-1D/+ er-20 andjba-1D/+ er-20 meristems, respectively (Fig. 7B, Table S4). Theseanalyses demonstrate that adding er to jba-1D/+ leads to an increasein mitotic activity at the meristem. Furthermore, our analysis revealsthat Col-0 and jba-1D/+ exhibit similar expression patterns of stemcell genes (Fig. 6C) and mitotic marker genes (Fig. 7B) in both8- and 15-day-old meristems, suggesting that the increase inmeristemsize in jba-1D/+ is proportional for all zones.

Another interesting pattern of meristem-related gene expressionwas that of the TYPE-A RESPONSE REGULATOR genes ARR5,ARR6, ARR7 and ARR15 (Fig. 7C), which are negative regulators ofcytokinin signaling and meristem size, and are directly repressed byWUS (Leibfried et al., 2005). The triple-mutant meristems showedthe lowest level of expression at both time points (GEO accessionGSE79839) and the general expression pattern of the ARR genesresembled that of the three HD-ZIP III and ZPR1 genes (Fig. 6A),with lowest expression in mutants of the jba-1D/+ background. Inthe k-means analysis, ARR5 and ARR6 were assigned to cluster 788together with ZPR1 and ZPR4 (GEO accession GSE79839),suggesting a link between HD-ZIP III, ZPR and ARR genes.

The SHOOT MERISTEMLESS (STM) TF functions in themeristem to prevent the premature incorporation of cells into

1618

RESEARCH ARTICLE Development (2016) 143, 1612-1622 doi:10.1242/dev.129973

DEVELO

PM

ENT

differentiation pathways. Accordingly, it is expressed in both the CZand PZ of the meristem and repressed in organ primordia (Galloiset al., 2002; Long et al., 1996). To further investigate the ratiobetween domains in the meristem, we looked at the ratio ofexpression levels of the meristematic cell marker STM (Geier et al.,2008) and the stem cell marker CLV3 (Fig. 7D). When dividing theSTM RPKM value by that of CLV3, genotypes with the clv3-2background show the lowest ratio at both time points, implying thatthese meristems harbor a higher proportion of stem cells than wild-type meristem, whereas jba-1D/+ er-20 exhibits the highest ratio,

implying that its meristem harbors a high proportion of meristematiccells. Similar results were obtained in RT-qPCR validationexperiments (Fig. S7), consistent with a previous report that jba-1D/+ er-20 exhibits higher STM expression levels than jba-1D/+(Mandel et al., 2014). This demonstrates the effect of er on jba-1D/+,i.e. that of promoting an increase in the meristematic cell population,which exhibits increased mitotic activity. It also suggests that therelatively high expression of histones and cell cycle genes in jba-1D/+ er-20 is the result of an increase in the meristematic cellpopulation and not of leaf primordia. Altogether, the ratios between

Fig. 7. The differential characteristics of meristems from CLV3, HD-ZIP III and ER pathway mutants. (A-C) Heat maps of expression levels of (A) histones(Table S3), (B) cell cycle genes (Table S4) and (C)ARR genes inmeristems of the five genotypes from 8-day-old and 15-day-old seedlings (all color-coding as in C).(D) RPKM values of STM (blue) and CLV3 (red) genes. The RPKM value of STM divided by that of CLV3 is indicated above each bar. (E) Model for differentialregulation of meristemstructure by the CLV3, HD-ZIP III and ERpathways.We propose thatCLV3 restrictsmeristem expansion along the apical-basal axis, whereastheHD-ZIP III andERpathways restrict meristemexpansion laterally, but in distinct and possibly perpendicular orientations.Mutants with a reduction in one, two orallthree pathways exhibit meristem expansion accordingly.

1619

RESEARCH ARTICLE Development (2016) 143, 1612-1622 doi:10.1242/dev.129973

DEVELO

PM

ENT

STM and CLV3 expression values support our conclusions from thephenotypic andmRNA-Seq analyses regardingmeristem organization.

DISCUSSIONDuring plant development, the stem cells in the SAM proliferateindeterminately to continuously produce organs, yet the SAM isrestricted to a very small and stable dome-shaped structure. In thisstudy, we show that CLV3, HD-ZIP III and ER restrict meristemexpansion in distinct directions and affect different aspects ofmeristem function, thereby regulating meristem size, organizationandmorphology. Removing all three pathways enhances the gradualtemporal shift in meristem homeostasis seen with the removal ofonly one or two pathways. We also explicitly demonstrate thatmeristem size and organization determine the phyllotaxis pattern.It is well established that auxin maxima determine primordium

initiation sites at the SAM periphery, and that new auxin maximacan be formed only at a certain minimal distance from existingprimordia (Lohmann et al., 2010; Reinhardt et al., 2003; Sassi andVernoux, 2013). Moreover, it was shown that the L1 layer of theSAM serves as a conduit for auxin transport and that the phyllotacticpatterns form on the surface of the SAM (Kierzkowski et al., 2013;Smith et al., 2006). Our results support this idea. For example, clv38-day-old SAM exhibits a similar width to Col-0 SAM but is tallerand more convex, resulting in an increased SAM surface. Thisallows two leaf primordia to develop simultaneously opposite toeach other at the two farthest sites, resulting in a decussatephyllotaxis. Our mRNA-Seq analysis reveals that the ratio betweenzones in clv3 meristems is altered toward increased CZ due to anincrease in the stem cell population. This is consistent with acomputer simulation demonstrating that a shift to a decussate patternrequires a decrease in the peripheral width and an increase in the CZ(Smith et al., 2006).Loss of all ER family genes leads to a flattened meristem with

lateral expansion of theWUS expression domain (Chen et al., 2013;Uchida et al., 2013). Longitudinal sections of GUS analysis in jba-1D/+ seedlings also show lateral expansion of the WUS domain(Williams et al., 2005), indicating that the ER and HD-ZIP IIIpathways restrict the expression of WUS in cells flanking the OC.However, by analyzing the expression pattern in 2D sections, wecannot determine whether the WUS domain expands laterally orradially. Nevertheless, our two-orientation sectioning analysis ofjba-1D/+ indicates that in one orientation the meristem is narrowcompared with the perpendicular orientation, suggesting that theWUS domain expands laterally. The phenotypic analysisdemonstrates that both ER and HD-ZIP III restrict meristemexpansion laterally, and therefore a reduction in their function leadsto elongated meristems. However, when jba-1D/+ and er-20 arecombined, both in the jba-1D/+ er-20 double mutant and the clv3-2jba-1D/+ er-20 triple mutant, the meristems are much larger andisodiametric, suggesting expansion in two perpendicular lateraldirections. When clv3 is added to the jba-1D/+ er-20 mutant,further expansion in the apical-basal axis makes the meristem morecylindrical, indicating expansion in all directions (Fig. 7E).If members of the HD-ZIP III restrict meristem expansion in a

specific lateral direction that differs from the direction of restrictionby ER, how are these directions determined and established in thedome-shaped meristem? In Arabidopsis, after germination the SAMis a flattened bilaterally symmetric structure, which changes afterday 7 to a radially symmetrical dome (Bowman, 1994; Medfordet al., 1992). We hypothesize that the lateral directional restrictionsby HD-ZIP III and ER are determined during embryo developmentat the onset of bilateral symmetry formation, simultaneously with

cotyledon formation. Once the axes of regulation are establishedthey are stable, regardless of the formation of the radiallysymmetrical dome-shaped meristem. Although our differentialsectioning analysis associates the expansion direction with thecotyledon growth direction, further research is required to test thishypothesis.

The SAM is a small, complex structure composed of many celltypes, each expressing a specific set of genes. Revealing thespatiotemporal gene expression patterns at the SAM can provide abetter understanding of cell fate specification and of cellularprocesses at the level of particular cell types. Several methods havebeen applied to identify cell type-specific gene expression in theSAM, including laser microdissection (Brooks et al., 2009; Ohtsuet al., 2007), fluorescence-activated cell sorting (Yadav et al., 2009)and isolation of nuclei tagged in specific cell types (Deal andHenikoff, 2010). Our mRNA-Seq and k-means analyses ofmeristem-enriched tissue assigned many groups of genes that areknown to be co-expressed to the same clusters. Thus, the strategy ofusing different genetic backgrounds combined with a comparativeanalysis of mRNA-Seq data provides a sensitive approach for theidentification of co-regulated genes expressed at low level in anembedded small structure such as the shoot apex. Our datawill serveas a useful resource to dissect spatial regulatory pathways and for theidentification of genes acting in the same process or complex, aswell as for the construction of gene networks acting in the SAM.

MATERIALS AND METHODSGrowth conditions and plant materialsThe plant materials used in this study were Arabidopsis thaliana Columbia(Col-0), jabba-1D ( jba-1D) (Williams et al., 2005), clavata3-2 (clv3-2)(Clark et al., 1995) and erecta-20 (er-20) (Mandel et al., 2014). Plants weregrown under long-day (16 h light/8 h dark) or short-day (8 h light/16 h dark)conditions at 18-22°C in soil or on Murashige and Skoog (MS) plates.

Microscopy and histologyWhole-plant images were captured using an Olympus SZX7stereomicroscope. Images of transverse sections were captured using anOlympus IX8 Cell-R inverted microscope. SEM was performed by fixingtissue in methanol as described previously (Talbot and White, 2013) forexamination in a JEOL 5410 LV scanning electron microscope. Forhistological analyses, seedlings were fixed in 4% formaldehyde fixativewith 50% ethanol and 5% glacial acetic acid, vacuum infiltration,dehydrated, embedded in paraffin wax, sectioned at 8 μm thickness andstained with Toluidine Blue. SAM images were measured using ImageJsoftware (NIH). Statistical analysis of all measurements was performedusing the non-parametric multi-comparison Steel-Dwass test due to unequalvariance between the different genotypes using JMP 12 software (SAS).

Micro-CT analysisSeedlings were fixed by formaldehyde-acetic acid vacuum infiltration anddehydrated using an ethanol series. Seedlings in 100% ethanol were thensoaked in 2% potassium iodide (IKI) and were scanned using the MicroXCT 400 system (XRadia). Movies of reconstructed serial longitudinalsections (RCS) were made manually.

Differential expression analysis by mRNA-SeqSAM-enriched tissues from 8- and 15-day-old seedlings were collected asdescribed in Fig. S6 (each sample comprised 45-50 meristems), and wereimmediately frozen in liquid nitrogen. Total RNA was isolated using theRNeasy Mini Kit (Qiagen) and used to prepare ten libraries using theTruSeq-RNA Kit (Illumina). Single-end sequencing was performed bymultiplexing the libraries in an Illumina HiSeq 2500 system at the TechnionGenome Center (Israel). The reads (an average of 40 M per sample at 51nucleotides long) were quality filtered and trimmed using Trimmomatic0.32 (see the supplementary Materials and Methods) and then aligned to the

1620

RESEARCH ARTICLE Development (2016) 143, 1612-1622 doi:10.1242/dev.129973

DEVELO

PM

ENT

TAIR10 version (https://www.arabidopsis.org/) using TopHat v.2.0.12 andBowtie2 v.2.1.0 (supplementary Materials and Methods). The resultingalignments (Table S2) were quantified with Cuffdiff v.2.2.1 (supplementaryMaterials and Methods). The gene expression levels (RPKM) weresubjected to k-means clustering using Gene Cluster 3.0 (de Hoon et al.,2004), with k=1000, and ‘correlation (centered)’ as the similarity metric.Heat maps of selected genes were visualized using Java Treeview 3.0 asdescribed in the supplementary Materials and Methods.

Gene ontology analysisSelected genes were subjected to gene ontology (GO) analysis using theagriGO online tool available at http://bioinfo.cau.edu.cn/agriGO/index.php,selecting the Arabidopsis thaliana TAIR10 genome annotation as thebackground reference, hypergeometric statistical tests with Bonferronicorrection, and P≤0.05 (Du et al., 2010).

AcknowledgementsWe thank Vlad Brumfeld (Weizmann Institute of Science) for analyzing the micro-CTsamples, and Marilou Legeay and Hugo Basquin (Universite Grenoble Alpes) fortechnical assistance.

Competing interestsThe authors declare no competing or financial interests.

Author contributionsL.E.W. developed the concepts; T.M., H.C., U.L., L.A., E.Z. and C.C.C. performedexperiments and data analysis; L.E.W. wrote the manuscript with the help of H.C.;C.C.C. and H.C. commented on the manuscript.

FundingThis work was supported by the Israel Science Foundation [1351/10 to T.M.];Vaadia–BARD [IS-4336-10R to L.A.]; the MARIE CURIE funded by the EuropeanCommission [IRG 249270 to U.L.]; Spain’s Ministry of Economy andCompetitiveness and the European Regional Development Fund (ERDF) (‘Unamanera de hacer Europa’) [BFU2012-31719 to H.C.]; the University Grenoble-Alpes(UGA-UJF) and the Centre National de la Recherche Scientifique [CNRS-HigherEducation Chair, position 0428-64; IUA Chair to C.C.C.]. Deposited in PMC forimmediate release.

Data availabilityThemRNA-Seq datasets discussed in this publication have been deposited at GeneExpression Omnibus with accession number GSE79839. Movies are available atFigshare: Movie 1, http://dx.doi.org/10.6084/m9.figshare.3084610; Movie 2, http://dx.doi.org/10.6084/m9.figshare.3084613; Movie 3, http://dx.doi.org/10.6084/m9.figshare.3084583; Movie 4, http://dx.doi.org/10.6084/m9.figshare.3084586; Movie5, http://dx.doi.org/10.6084/m9.figshare.3084592; Movie 6, http://dx.doi.org/10.6084/m9.figshare.3084595; Movie 7, http://dx.doi.org/10.6084/m9.figshare.3084604; Movie 8, http://dx.doi.org/10.6084/m9.figshare.3084607.

Supplementary informationSupplementary information available online athttp://dev.biologists.org/lookup/suppl/doi:10.1242/dev.129973/-/DC1

ReferencesAggarwal, P., Yadav, R. K. and Reddy, G. V. (2010). Identification of novelmarkers for stem-cell niche of Arabidopsis shoot apex. Gene Expr. Patterns 10,259-264.

Bartlett, M. E. and Thompson, B. (2014). Meristem identity and phyllotaxis ininflorescence development. Front. Plant Sci. 5, 508.

Bowman, J. L. (ed.) (1994). Arabidopsis: an Atlas of Morphology and Development.New York: Springer.

Brand, U., Fletcher, J. C., Hobe, M., Meyerowitz, E. M. and Simon, R. (2000).Dependence of stem cell fate in Arabidopsis on a feedback loop regulated byCLV3 activity. Science 289, 617-619.

Brooks, L., III, Strable, J., Zhang, X., Ohtsu, K., Zhou, R., Sarkar, A.,Hargreaves, S., Elshire, R. J., Eudy, D., Pawlowska, T. et al. (2009).Microdissection of shoot meristem functional domains.PLoSGenet. 5, e1000476.

Chen, M.-K., Wilson, R. L., Palme, K., Ditengou, F. A. and Shpak, E. D. (2013).ERECTA family genes regulate auxin transport in the shoot apical meristem andforming leaf primordia. Plant Physiol. 162, 1978-1991.

Clark, S. E., Running, M. P. and Meyerowitz, E. M. (1995). CLAVATA3 is a specificregulator of shoot and floral meristem development affecting the same processesas CLAVATA1. Development 121, 2057-2067.

Cockcroft, C. E., den Boer, B. G., Healy, J. M. and Murray, J. A. (2000). Cyclin Dcontrol of growth rate in plants. Nature 405, 575-579.

de Hoon, M. J. L., Imoto, S., Nolan, J. and Miyano, S. (2004). Open sourceclustering software. Bioinformatics 20, 1453-1454.

Deal, R. B. and Henikoff, S. (2010). A simple method for gene expression andchromatin profiling of individual cell types within a tissue.Dev. Cell 18, 1030-1040.

Du, Z., Zhou, X., Ling, Y., Zhang, Z. and Su, Z. (2010). agriGO: a GO analysistoolkit for the agricultural community. Nucleic Acids Res. 38, W64-W70.

Durbak, A. R. and Tax, F. E. (2011). CLAVATA signaling pathway receptors ofArabidopsis regulate cell proliferation in fruit organ formation as well as inmeristems. Genetics 189, 177-194.

Fletcher, J. C., Brand, U., Running, M. P., Simon, R. and Meyerowitz, E. M.(1999). Signaling of cell fate decisions by CLAVATA3 in Arabidopsis shootmeristems. Science 283, 1911-1914.

Gallois, J. L., Woodward, C., Reddy, G. V. and Sablowski, R. (2002). CombinedSHOOT MERISTEMLESS and WUSCHEL trigger ectopic organogenesis inArabidopsis. Development 129, 3207-3217.

Geier, F., Lohmann, J. U., Gerstung, M., Maier, A. T., Timmer, J. and Fleck, C.(2008). A quantitative and dynamic model for plant stem cell regulation. PLoSONE 3, e3553.

Grandjean, O., Vernoux, T., Laufs, P., Belcram, K., Mizukami, Y. and Traas, J.(2004). In vivo analysis of cell division, cell growth, and differentiation at the shootapical meristem in Arabidopsis. Plant Cell 16, 74-87.

Green, K. A., Prigge, M. J., Katzman, R. B. and Clark, S. E. (2005). CORONA, amember of the class III homeodomain leucine zipper gene family in Arabidopsis,regulates stem cell specification and organogenesis. Plant Cell 17, 691-704.

Gross-Hardt, R. and Laux, T. (2003). Stem cell regulation in the shoot meristem.J. Cell Sci. 116, 1659-1666.

Hobe, M., Muller, R., Grunewald, M., Brand, U. and Simon, R. (2003). Loss ofCLE40, a protein functionally equivalent to the stem cell restricting signal CLV3,enhances root waving in Arabidopsis. Dev. Genes Evol. 213, 371-381.

Kierzkowski, D., Lenhard, M., Smith, R. and Kuhlemeier, C. (2013). Interactionbetween meristem tissue layers controls phyllotaxis. Dev. Cell 26, 616-628.

Landau, U., Asis, L. and Eshed Williams, L. (2015). The ERECTA, CLAVATA andclass III HD-ZIP pathways display synergistic interactions in regulating floralmeristem activities. PLoS ONE 10, e0125408.

Laufs, P., Grandjean, O., Jonak, C., Kiêu, K. and Traas, J. (1998). Cellularparameters of the shoot apical meristem in Arabidopsis.Plant Cell 10, 1375-1390.

Laux, T., Mayer, K. F., Berger, J. and Jurgens, G. (1996). The WUSCHEL gene isrequired for shoot and floral meristem integrity in Arabidopsis. Development 122,87-96.

Lee, C. and Clark, S. E. (2015). AWUSCHEL-independent stem cell specificationpathway is repressed by PHB, PHV and CNA in arabidopsis. PLoS ONE 10,e0126006.

Leibfried, A., To, J. P. P., Busch, W., Stehling, S., Kehle, A., Demar, M., Kieber,J. J. and Lohmann, J. U. (2005). WUSCHEL controls meristem function by directregulation of cytokinin-inducible response regulators. Nature 438, 1172-1175.

Lohmann, D., Stacey, N., Breuninger, H., Jikumaru, Y., Muller, D., Sicard, A.,Leyser, O., Yamaguchi, S. and Lenhard, M. (2010). SLOWMOTION is requiredfor within-plant auxin homeostasis and normal timing of lateral organ initiation atthe shoot meristem in Arabidopsis. Plant Cell 22, 335-348.

Long, J. A., Moan, E. I., Medford, J. I. and Barton, M. K. (1996). A member of theKNOTTED class of homeodomain proteins encoded by the STM gene ofArabidopsis. Nature 379, 66-69.

Mandel, T., Moreau, F., Kutsher, Y., Fletcher, J. C., Carles, C. C. and EshedWilliams, L. (2014). The ERECTA receptor kinase regulates Arabidopsis shootapical meristem size, phyllotaxy and floral meristem identity. Development 141,830-841.

Mayer, K. F. X., Schoof, H., Haecker, A., Lenhard, M., Jurgens, G. and Laux, T.(1998). Role of WUSCHEL in regulating stem cell fate in the Arabidopsis shootmeristem. Cell 95, 805-815.

Medford, J. I., Behringer, F. J., Callos, J. D. and Feldmann, K. A. (1992). Normaland abnormal development in the arabidopsis vegetative shoot apex. Plant Cell 4,631-643.

Meshi, T., Taoka, K.-i. and Iwabuchi, M. (2000). Regulation of histone geneexpression during the cell cycle. Plant Mol. Biol. 43, 643-657.

Ohtsu, K., Smith, M. B., Emrich, S. J., Borsuk, L. A., Zhou, R., Chen, T., Zhang,X., Timmermans, M. C. P., Beck, J., Buckner, B. et al. (2007). Global geneexpression analysis of the shoot apical meristem of maize (Zea mays L.). Plant J.52, 391-404.

Pautler, M., Eveland, A. L., LaRue, T., Yang, F., Weeks, R., Lunde, C., Je, B. I.,Meeley, R., Komatsu, M., Vollbrecht, E. et al. (2015). FASCIATED EAR4encodes a bZIP transcription factor that regulates shoot meristem size in maize.Plant Cell 27, 104-120.

Prigge, M. J., Otsuga, D., Alonso, J. M., Ecker, J. R., Drews, G. N. and Clark,S. E. (2005). Class III homeodomain-leucine zipper gene family members haveoverlapping, antagonistic, and distinct roles in Arabidopsis development. PlantCell 17, 61-76.

1621

RESEARCH ARTICLE Development (2016) 143, 1612-1622 doi:10.1242/dev.129973

DEVELO

PM

ENT

Reinhardt, D., Pesce, E.-R., Stieger, P., Mandel, T., Baltensperger, K., Bennett,M., Traas, J., Friml, J. and Kuhlemeier, C. (2003). Regulation of phyllotaxis bypolar auxin transport. Nature 426, 255-260.

Sablowski, R. (2009). Cytokinin and WUSCHEL tie the knot around plant stemcells. Proc. Natl. Acad. Sci. USA 106, 16016-16017.

Sassi, M. and Vernoux, T. (2013). Auxin and self-organization at the shoot apicalmeristem. J. Exp. Bot. 64, 2579-2592.

Schoof, H., Lenhard, M., Haecker, A., Mayer, K. F. X., Jurgens, G. and Laux, T.(2000). The stem cell population of Arabidopsis shoot meristems is maintained bya regulatory loop between the CLAVATA and WUSCHEL genes. Cell 100,635-644.

Smith, R. S., Guyomarc’h, S., Mandel, T., Reinhardt, D., Kuhlemeier, C. andPrusinkiewicz, P. (2006). A plausible model of phyllotaxis. Proc. Natl. Acad. Sci.USA 103, 1301-1306.

Steeves, T. A. and Sussex, I. M. (1989). Patterns in Plant Development.Cambridge: Cambridge University Press.

Sun, B. and Ito, T. (2015). Regulation of floral stem cell termination in Arabidopsis.Front. Plant Sci. 6, 17.

Szczesny, T., Routier-Kierzkowska, A.-L. and Kwiatkowska, D. (2009). Influenceof clavata3-2 mutation on early flower development in Arabidopsis thaliana:quantitative analysis of changing geometry. J. Exp. Bot. 60, 679-695.

Takayama, Y. and Toda, T. (2010). Coupling histone homeostasis to centromereintegrity via the ubiquitin-proteasome system. Cell Div. 5, 18.

Talbot, M. J. andWhite, R. G. (2013). Methanol fixation of plant tissue for scanningelectron microscopy improves preservation of tissuemorphology and dimensions.Plant Methods 9, 36.

Traas, J. (2013). Phyllotaxis. Development 140, 249-253.Uchida, N., Shimada, M. and Tasaka, M. (2013). ERECTA-family receptor kinases

regulate stem cell homeostasis via buffering its cytokinin responsiveness in theshoot apical meristem. Plant Cell Physiol. 54, 343-351.

Wenkel, S., Emery, J., Hou, B.-H., Evans, M. M. S. and Barton, M. K. (2007). Afeedback regulatory module formed by LITTLE ZIPPER and HD-ZIPIII genes.Plant Cell 19, 3379-3390.

Williams, L. and Fletcher, J. C. (2005). Stem cell regulation in the Arabidopsisshoot apical meristem. Curr. Opin. Plant Biol. 8, 582-586.

Williams, L., Grigg, S. P., Xie, M., Christensen, S. and Fletcher, J. C. (2005).Regulation of Arabidopsis shoot apical meristem and lateral organ formation bymicroRNA miR166g and its AtHD-ZIP target genes. Development 132,3657-3668.

Yadav, R. K., Girke, T., Pasala, S., Xie, M. and Reddy, G. V. (2009). Geneexpression map of the Arabidopsis shoot apical meristem stem cell niche. Proc.Natl. Acad. Sci. USA 106, 4941-4946.

1622

RESEARCH ARTICLE Development (2016) 143, 1612-1622 doi:10.1242/dev.129973

DEVELO

PM

ENT

Development 143: doi:10.1242/dev.129973: Supplementary information

Figure S1: Micro-CT 3D reconstruction of meristems from 15-day-old seedlings of Col-0, jba-

1D er-20 and clv3-2 jba1D/+ er-20. In blue, manual segmentation of the shoot apical meristem.

Scale bars: 100 µm.

Dev

elo

pmen

t • S

uppl

emen

tary

info

rmat

ion

Development 143: doi:10.1242/dev.129973: Supplementary information

Dev

elo

pmen

t • S

uppl

emen

tary

info

rmat

ion

Development 143: doi:10.1242/dev.129973: Supplementary information

Figures S2 and S3: Mutants with disturbed meristem homeostasis display a gradual

increase in meristem size. Typical median longitudinal sections through 9-day (S2) and 15-day

(S3) old Arabidopsis seedlings show major differences in meristem size. For jba 1D/+ and jba

1D/+ er-20 which exhibits significant differences in meristem size, depending on the orientation

of sectioning, a different set of sections were done for each orientation: parallel to cotyledons

(Pl) and perpendicular to cotyledons (Pr). Genotypes are indicated. Scale bars = 100 The

analysis of measurements of 10 meristems width and height using the ImageJ software is

presented in Fig. 4.

Dev

elo

pmen

t • S

uppl

emen

tary

info

rmat

ion

Development 143: doi:10.1242/dev.129973: Supplementary information

Figure S4. Reduction in CLV3, HD-ZIPIII and ER function affects meristem morphology in a

different manner. Top view of Scanning electron microscopy (SEM) images of inflorescence

meristems (IM) of different genotypes reveal different sizes and shapes. All meristems were

analyzed 35 days after germination at about 14 days after bolting. Typical meristems are shown

(A) All the Col-0 IM look similar, displaying a spiral phyllotactic pattern and a circular

meristems. (B and C) clv3-2 IM (in Col-0 background) displaying a round (top view) and tall

Dev

elo

pmen

t • S

uppl

emen

tary

info

rmat

ion

Development 143: doi:10.1242/dev.129973: Supplementary information

structure (side view) with altered phyllotaxis. All meristems analyzed exhibited similar shape

(D) jba-1D/+ fasciated IM (E) Addition of er to jba-1D/+ causes the meristem to become wider

and at later stages (24 days after bolting - right low corner) to split. This genotype shows the

highest variability in size and shapes (F) clv3-2 er IM exhibiting elongated meristems but later,

in mature plants all meristems are long and narrow as shown in Fig 5 (G) clv3-2 jba-1D/+ er-20

IM displaying enlargement in all directions. Top views show round meristems (I). Scale bars: (A

- F) 50 μm, (G) 500 μm.

Dev

elo

pmen

t • S

uppl

emen

tary

info

rmat

ion

Development 143: doi:10.1242/dev.129973: Supplementary information

Figure S5. Mutants with disturbed meristem homeostasis display altered inflorescent

meristem size and shape.

Box-plot representation of length and width measurement of SEM images in imageJ

demonstrates the major differences among different genotypes. (A) Meristem maximal lengths.

(B) Meristems maximal widths. (C) The ratio between maximal length and maximal width for

each meristem. The mean of all ratios is indicated above the box in brown. All measurements

were done on meristems from 35-day-old plants at about 14 day after bolting. Black center lines

show the medians; box limits indicate the 25th and 75th percentiles; whiskers extend to 5th and

95th percentiles, outliers are marked by dots; for all measurements n=8. An example for typical

meristems presented in Fig S4. (D) Illustration of how the measurements were done.

Measurements were done in imageJ by stretching a line between maximal length or width points

for each meristem. In meristems with a curve, broken lines were measured. In meristems that

show a narrow region and a wider region like the one in D the wider region was measured.

Dev

elo

pmen

t • S

uppl

emen

tary

info

rmat

ion

Development 143: doi:10.1242/dev.129973: Supplementary information

Figure S6. Illustration of sample preparation for mRNA-Seq analysis. Eight-day-old

seedlings were dissected under a stereomicroscope. The cotyledons and young leaves were first

trimmed at a position adjacent to the hypocotyl-meristem junction. Next, the hypocotyl was

excised and the samples were immediately frozen in liquid nitrogen. On the right, highlighted in

blue, is the meristem. The bottom image shows the exposed meristem (arrow). Scale bars: 1 mm

for seedling and 200 μm for trimmed meristem.

Dev

elo

pmen

t • S

uppl

emen

tary

info

rmat

ion

Development 143: doi:10.1242/dev.129973: Supplementary information

Figure S7. Relative transcript levels of STM, CLV3, MIR166, CNA, PHB and PHV in wild-

type and mutants. Relative transcript levels were calculated from triplicate RT-qPCR reactions

of RNA samples prepared from SAM-enriched tissues from 8- and 15-day-old seedlings that

were collected as described in supplementary material Fig. S1. The transcript levels in Col are

set to 1. Relative expression is normalized to ACTIN2. Genotype and gene tested are indicated.

Dev

elo

pmen

t • S

uppl

emen

tary

info

rmat

ion

Development 143: doi:10.1242/dev.129973: Supplementary information

Movies 1 and 2. X-ray micro-CT of 15-day-old seedling meristem of Col-0 and clv3-2 jba-

1D/+ er-20. Seedlings were fixed dehydrated and brought to 100% ethanol, were then soaked in

2% potassium iodide (IKI) and were scanned using the XRadia Micro XCT 400 system. (Movie

1, see: http://dx.doi.org/10.6084/m9.figshare.3084610). Rotation view of Col-0 seedling, the

meristem is almost undetectable. (Movie 2, see: http://dx.doi.org/10.6084/m9.figshare.3084613)

Rotation view of clv3-2 jba-1D/+ er-20 triple mutant seedling. The huge meristem exhibits a

cylindrical shape.

Movies 3-8. X-ray micro-CT of 15-day-old seedling meristem from Col-0, jba1D/+ er-20

and clv3-2 jba-1D/+ er-20. Seedlings were fixed dehydrated and brought to 100% ethanol, were

then soaked in 2% potassium iodide (IKI) and were scanned using the XRadia Micro XCT 400

system. (Movies 3-5) Manually reconstructed serial longitudinal section (RCS) movies of Col-0

(Movie 3, see: http://dx.doi.org/10.6084/m9.figshare.3084583), jba-1D/+ er-20 (Movie 4, see:

http://dx.doi.org/10.6084/m9.figshare.3084586) and clv3-2 jba-1D/+ er-20 (Movie 5, see:

http://dx.doi.org/10.6084/m9.figshare.3084592). The typical dome shaped meristem observed in

Col-0 and jba-1D/+ er-20, is shifted into a more rectangular shape. (Movies 6-8) Manually

reconstructed serial transverse section (RCS) movies of Col-0 (Movie 6, see:

http://dx.doi.org/10.6084/m9.figshare.3084595), jba-1D/+ er-20 (Movie 7, see:

http://dx.doi.org/10.6084/m9.figshare.3084604) and clv3-2 jba-1D/+ er-20 (Movie 8, see:

http://dx.doi.org/10.6084/m9.figshare.3084607). Demonstrating the effect of meristem

enlargement on phyllotaxis and showing the isodiametric shape of the triple mutant huge

meristem.

Dev

elo

pmen

t • S

uppl

emen

tary

info

rmat

ion

Development 143: doi:10.1242/dev.129973: Supplementary information

Materials and Methods

Differential expression analysis by mRNA-seq

Shoot apical meristems (SAM) from 8- and 15-day-old seedlings (including Col-0, clv3-2,

jba-1D/+, jba-1D/+ er-20, and jba-1D/+ er-20 clv3-2) were collected as described in Figure S1

(each sample comprised 40 to 45 meristems), and were immediately frozen in liquid nitrogen.

Total RNA was isolated using Qiagen RNeasy Mini-kit and was used to prepare ten libraries

using the TruSeqTM-RNA kit. Single-end sequencing was performed by multiplexing the libraries

in an Illumina HiSeq2500 system at the Technion Genome Center (Israel).

The reads (51 nt long) were quality filtered and trimmed using Trimmomatic version 0.32 (1)

with the following options: -threads 8 -phred33 ILLUMINACLIP:adapters/TruSeq3-

SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36. The resulting

reads were then aligned to the TAIR10 version of the Arabidopsis thaliana genome sequence

(https://www.arabidopsis.org/) using TopHat version 2.0.12 (2) and Bowtie 2 version 2.1.0 (3)

with the following options: -p 8 (number of threads) -G TAIR10_nucleus.gff, where

TAIR10_nucleus.gff is a file containing the annotation for the nuclear genes in the Arabidopsis

genome in general feature format (GFF), and default values for all other parameters. The

resulting read alignments (in bam format) were used for transcript quantification with Cuffdiff

version 2.2.1 (4) with the following options: -p 8 (number of threads) -M filter_nucleus.gff,

where filter_nucleus.gff is a file containing the annotation for rRNA, tRNA, snRNA and

snoRNA genes in the Arabidopsis nuclear genome, which were masked for quantification

purposes.

The gene expression level (reads per kilobase of transcript per million of sequenced reads

(RPKM) calculation) values were tabulated and subjected to k-means clustering using Gene

Cluster 3.0 software (5), selecting a k value (number of clusters) of 1000, using "correlation

(centered)" as the similarity metric, and converging for 1000 runs. Genes that were not expressed

(i.e. with RPKM values equal to 0) across all samples were removed from the dataset before the

k-means analysis. We performed separate analyses for all samples, for samples corresponding to

the first collection date, and for samples corresponding to the second collection date. This

approach allowed us to identify co-expressed genes with highly correlated expression levels.

Heat maps were visualized using Java Tree view version 3.0 (6) after centering and normalizing

the expression values of selected genes. The RPKM values for each gene were centered by

subtracting their mean, and then normalize to make the sum of their squared deviations equal to

one. This step was performed to highlight the similar expression patterns regardless of their

absolute expression values (expressed as RPKM).

Dev

elo

pmen

t • S

uppl

emen

tary

info

rmat

ion

Development 143: doi:10.1242/dev.129973: Supplementary information

Quantitative RT-PCR analysis

Total RNA was isolated from 8-day-old seedlings growing on MS plates using the Qiagen

RNeasy Mini-kit. cDNA synthesis was performed with the Invitrogen SuperScript II Reverse

Transcriptase, using 1 μg of RNA. RTqPCR analysis was carried out using a Rotor-Gene-Q-

instrument (Qiagen), with Absolute-Blue-qPCR-SYBR-Green Mix (Thermo). Three independent

technical replicates were performed for each cDNA sample. ACTIN2 (AT3G18780) was used as

control and relative expression analysis was calculated using the 2-ddCT method (7). Primers

used for RT-qPCR analysis are as follows: ACT2-AT3G18780, GGATCTGT -

ACGGTAACATTGTGC (forward) and CCACCGATCCAGACACTGTAC (reverse); STM-

AT1G62360, GATAGGAACAATAATG - GGTCATCCG (forward) and

AACCACTGTACTTGCGCAAGAG (reverse); CLV3-AT2G27250, GTTCAAGGACTTTCCA

- ACCGCAAGATGAT (forward) and CCTTCTCTGCTTCTCCATTTG - CTCCAACC

(reverse);

References

1. Bolger AM, Lohse M, & Usadel B (2014) Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics (Oxford, England) 30(15):2114-2120.

2. Kim D, et al. (2013) TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome biology 14(4):R36.

3. Langmead B & Salzberg SL (2012) Fast gapped-read alignment with Bowtie 2. Nature methods 9(4):357-359.

4. Trapnell C, et al. (2013) Differential analysis of gene regulation at transcript resolution with RNA-seq. Nature biotechnology 31(1):46-53.

5. de Hoon MJ, Imoto S, Nolan J, & Miyano S (2004) Open source clustering software. Bioinformatics (Oxford, England) 20(9):1453-1454.

6. Saldanha AJ (2004) Java Treeview--extensible visualization of microarray data. Bioinformatics (Oxford, England) 20(17):3246-3248.

7. Livak, K. J. and Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408

Dev

elo

pmen

t • S

uppl

emen

tary

info

rmat

ion

Development 143: doi:10.1242/dev.129973: Supplementary information

Table S1: Meristem width and height measurements of 9 and 15 day old seedlings

8 Day

Col W

Col H

CLV3 W

CLV3 H

jba W

(Pr)

Jba H

(Pr)

jba W

(Pl)

Jba H

(Pl)

jba er W (Pr)

jba er H (Pr)

jba er W (Pl)

jba er H (Pl)

jba er CLV3 W

jba er CLV3 H

1 44.0 13.3 77.2 72.5 58.0 46.9 81.8 33.8 94.1 45.0 122.1 40.0 129.1 42.5

2 44.4 16.7 67.2 59.0 58.4 43.7 86.2 35.7 93.1 36.3 111.0 34.2 109.7 59.0

3 55.7 14.7 62.9 53.5 61.2 44.9 85.7 35.0 96.9 28.9 98.4 34.0 122.2 44.6

4 43.4 20.2 69.2 62.9 60.8 46.6 89.4 42.2 96.0 32.7 109.2 32.2 124.7 37.9

5 44.7 17.0 55.0 48.0 65.5 38.9 99.4 40.4 102.1 31.9 127.9 37.1 127.5 63.0

6 41.7 17.5 66.0 55.3 64.3 45.1 71.1 34.7 75.2 21.1 118.3 35.1 127.1 33.5

7 58.0 18.1 68.3 56.0 62.0 44.0 88.4 39.2 96.0 32.0 99.3 32.9 125.3 52.0

8 43.6 16.2 76.1 69.3 59.7 45.2 84.1 36.0 92.3 29.5 105.4 35.7 124.0 43.3

9 49.4 15.0 60.4 54.9 63.4 46.3 91.7 42.4 110.0 37.0 116.9 36.3 130.1 61.4

10 52.1 17.6 71.9 59.3 64.2 45.8 100.8 46.8 98.3 31.2 104.1 39.4 132.8 57.4

Avrage 47.7 16.6 67.4 59.0 61.8 44.7 87.9 38.6 95.4 32.5 111.3 35.7 125.2 49.5

15 Day

Col W

Col H

CLV3 W

CLV3 H

jba W

(Pr)

Jba H

(Pr)

jba W

(Pl)

Jba H

(Pl)

jba er W (Pr)

jba er H (Pr)

jba er W (Pl)

jba er H (Pl)

jba er CLV3 W

jba er CLV3 H

1 56.7 22.5 92.0 76.4 61.9 38.2 90.5

121.4 40.6 111.3

134.6 76.7

2 61.2 19.5 74.6 70.8 76.4 42.0 114.5

93.3 39.4 122.2

151.6 72.3

3 62.3 22.0 84.4 72.0 67.3 36.9 101.0

99.5 32.0 112.9

147.8 64.9

4 59.4 20.0 83.8 74.7 75.6 37.3 107.8

109.2 36.9 128.1

144.4 65.0

5 69.2 21.9 73.0 78.0 73.2 40.9 94.9

110.2 27.4 151.2

162.3 54.0

6 66.1 24.9 92.7 82.6 69.0 42.5 101.7

102.1 34.1 114.5

140.3 63.7

7 61.6 22.0 76.2 69.5 66.1 39.9 98.0

108.9 32.5 123.9

162.9 53.0

8 63.9 23.0 89.7 77.3 71.4 38.0 105.7

118.4 34.4 120.8

148.3 65.8

9 46.4 23.6 86.6 70.1 76.7 44.0 111.5

107.2 44.8 129.2

129.7 68.9

10 65.7 20.6 65.9 68.9 62.8 27.9 105.7

119.0 31.8 113.0

156.3 74.8

Avrage 61.3 22.0 81.9 74.0 70.0 38.8 103.1

108.9 35.4 122.7

147.8 65.9

Width: W and Height: H in micrometer

Dev

elo

pmen

t • S

uppl

emen

tary

info

rmat

ion

Development 143: doi:10.1242/dev.129973: Supplementary information

Supplementary material Table S2: mRNA-seq analysis quality control data

Sample Raw reads Reads

after QC Mapped

reads % of input

Mapped reads with

multiple alignments

% of mapped

reads with multiple

alignments (relative to

total mapped reads)

Col 8 45,262,389 44643190 43,309,836 97 1152086 2.7

clv3 8 43,522,363 42711864 41,817,843 97.9 1222901 2.9

jba1D/+ 8 35,514,884 34654164 33,919,658 97.9 1033409 3.0

jba1D/+ er 8 49,708,059 48667794 47,789,061 98.2 1261795 2.6

clv3 jba1D/+ er 8 32,001,362 31544741 30,537,932 96.8 1249850 4.1

Col 15 44,844,794 44295976 42,960,525 97.0 1310162 3.0

clv3 15 36,741,580 36271417 35,586,425 98.1 1262658 3.5

jba1D/+ 15 44,120,248 43142522 42,097,501 97.6 2071048 4.9

jba1D/+ er 15 34,020,742 33564663 32,953,496 98.2 929566 2.8

clv3 jba1D/+ er 15 41,982,022 41428905 40,615,618 98.0 1306244 3.2

Dev

elo

pmen

t • S

uppl

emen

tary

info

rmat

ion

Development 143: doi:10.1242/dev.129973: Supplementary information

Supplementary Table S3: Histones RPKM values

Locus ID Description RPKM (8-day-old apices) RPKM (15-day-old apices) Cluster

Col-0 clv3 jba jba er clv3 jba er

Col-0 clv3 jba jba er

clv3 jba er

AT1G01370 histone H3 13.7 10.2 11.7 11.4 14.6 7.5 5.9 7.3 19.7 14.6 628

AT1G06760 histone H1.1

352.1 321.8 279.9 298.6 304.3 366.1 436.8 411.0 431.0 395.0 522

AT1G07660 histone H4 129.3 41.1 43.0 44.9 40.1 56.6 32.3 31.6 54.0 47.0 961

AT1G07790 histone H2B

341.7 111.0 130.4 131.2 158.2 146.1 53.4 54.6 204.3 118.0 734

AT1G07820 histone H4 196.4 155.2 144.1 167.0 178.3 145.9 167.8 165.3 337.4 274.7 804

AT1G09200 histone H3 299.6 191.1 243.0 307.4 326.5 100.0 94.8 108.7 513.1 303.2 628

AT1G51060 histone H2A 10

208.9 182.1 213.1 218.3 275.5 80.8 73.4 69.0 301.5 181.0 321

AT1G52740 histone H2A protein 9

295.8 323.7 380.2 306.3 327.4 443.0 463.2 445.6 290.8 336.6 145

AT2G18050 histone H1-3

6.3 27.1 8.8 18.7 6.5 62.6 180.2 81.6 35.5 33.4 173

AT2G28720 histone H2B

102.9 82.3 48.4 55.2 47.1 86.1 96.0 75.0 89.3 87.4 364

AT2G28740 histone H4 284.1 185.5 183.2 222.9 215.8 145.9 128.6 134.5 369.5 280.5 849

AT2G30620 histone H1.2

218.4 162.7 184.9 153.0 170.7 216.1 221.7 258.1 157.9 201.8 455

AT2G37470 histone H2B

105.0 61.1 97.9 98.0 111.3 48.9 39.6 57.8 173.8 146.1 999

AT2G38810 histone H2A 8

39.3 33.6 37.7 39.0 43.1 17.1 22.3 27.9 57.6 41.4 628

AT3G09480 histone H2B

5.9 6.1 7.9 6.9 9.7 3.6 4.0 4.0 8.7 7.2 503

AT3G20670 histone H2A 13

136.9 97.1 129.5 135.9 177.8 42.6 40.3 54.8 212.7 139.6 628

AT3G27360 histone H3 71.7 55.8 77.6 89.2 87.3 36.3 34.7 34.8 178.5 101.1 1

AT3G45930 histone H4 57.8 57.9 64.7 70.1 74.9 21.9 28.2 25.3 141.5 75.6 628

AT3G45980 histone H2B

378.5 305.5 323.0 377.4 386.6 276.3 308.3 254.7 465.6 401.6 849

AT3G46030 histone H2B

168.5 200.3 215.4 218.9 248.0 110.3 155.2 140.1 300.2 220.3 503

AT3G46320 histone H4 63.5 50.7 71.1 70.6 63.8 20.2 23.2 28.9 136.6 78.8 628

AT3G53650 histone H2B

0.4 18.7 36.4 19.7 26.6 0.7 9.0 10.8 32.5 24.0 792

AT3G53730 histone H4 210.6 222.9 226.9 208.1 193.0 106.5 165.6 170.2 313.3 218.0 660

AT3G54560 histone H2A

145.0 101.6 139.8 133.2 136.1 70.8 76.7 101.9 228.7 176.9 999

AT4G13570 histone H2A

1.8 0.8 0.1 2.3 1.0 8.6 1.6 0.2 1.5 1.3 286

AT4G27230 histone H2A 2

123.9 96.0 105.7 103.4 129.0 69.7 73.0 62.8 163.6 135.3 849

AT4G40030 histone H3 530.6 483.2 493.3 464.2 456.8 564.6 592.8 556.5 613.1 527.9 20

AT4G40040 histone H3 748.0 888.5 725.7 743.2 741.8 850.5 1078.7 933.8 782.6 907.5 950

AT5G02560 histone H2A 12

6.0 8.3 8.5 8.8 7.0 8.6 7.1 7.3 14.2 7.5 138

AT5G02570 histone H2B

0.8 1.7 1.0 1.0 2.6 0.2 0.6 0.6 3.3 2.0 503

Dev

elo

pmen

t • S

uppl

emen

tary

info

rmat

ion

Development 143: doi:10.1242/dev.129973: Supplementary information

AT5G10390 histone H3 137.4 55.4 69.8 63.5 98.0 45.0 20.8 19.0 136.6 61.6 196

AT5G10400 histone H3 20.0 147.6 193.7 209.1 237.7 16.8 81.8 88.8 391.9 226.3 660

AT5G10980 histone H3 279.2 247.2 276.0 328.6 314.2 230.0 262.6 251.5 381.5 302.1 628

AT5G22880 histone H2B

230.4 368.7 254.9 467.2 468.8 121.7 204.8 116.1 757.0 449.0 318

AT5G27670 histone H2A 7

122.6 137.5 107.1 138.3 150.1 73.6 94.1 75.1 163.2 129.0 959

AT5G54640 histone H2A

65.6 63.0 62.0 67.2 68.5 51.1 59.9 50.7 94.2 73.8 1

AT5G59690 histone H4 362.7 283.0 370.6 330.3 420.6 166.3 236.2 311.5 522.5 546.9 206

AT5G59870 histone H2A 6

268.9 161.3 227.8 254.2 304.4 92.2 73.7 90.3 472.4 268.6 628

AT5G59910 histone H2B

386.8 337.2 373.9 388.2 448.3 243.7 251.9 242.2 570.7 410.7 628

AT5G59970 histone H4 182.5 133.6 142.7 176.9 175.3 70.4 64.1 74.9 294.7 156.8 628

AT5G65350 histone H3 3.6 16.0 11.1 11.7 10.5 1.8 5.6 3.3 9.8 3.8 462

AT5G65360 histone H3 305.0 201.2 261.4 284.5 323.2 88.6 81.6 81.8 501.0 245.2 628

Dev

elo

pmen

t • S

uppl

emen

tary

info

rmat

ion

Development 143: doi:10.1242/dev.129973: Supplementary information

Supplementary material Table S4: cell-cycle genes RPKM values

Locus ID Description RPKM (8-day-old apices) RPKM (15-day-old apices) Cluster

Col-0 clv3 jba jba er

clv3 jba er

Col-0 clv3 jba jba er

clv3 jba er

AT4G27180 kinesin 2 28.6 23.7 25.0 26.1 24.4 21.6 22.4 20.5 36.2 29.9 1

AT2G24490 replicon protein A2 17.5 17.3 20.0 18.6 26.9 5.8 5.2 5.9 26.8 11.7 11

AT5G08020 RPA70-kDa subunit B 11.3 9.4 10.3 10.6 15.5 3.7 2.8 2.8 14.2 6.3 11

AT1G07370 proliferating cellular nuclear antigen 1

35.5 30.8 36.3 33.4 50.4 12.5 8.9 10.3 47.4 22.6 11

AT5G22110 DNA polymerase epsilon subunit B2

4.9 4.7 4.4 4.2 6.0 2.3 1.9 1.7 5.7 3.2 11

AT2G40550 E2F target protein 1 14.9 15.3 17.5 15.8 21.6 8.5 8.2 8.1 20.4 12.5 11

AT1G76540 cyclin-dependent kinase B2-1

49.8 45.6 39.6 51.2 49.7 31.4 46.9 52.7 53.3 72.8 17

AT3G11520 cyclin-B1-3 16.7 13.2 11.0 15.7 14.5 5.5 5.0 8.0 10.6 10.8 51

AT1G44110 cyclin-A1-1 34.7 30.4 26.9 27.7 31.7 16.0 19.0 21.6 30.6 32.6 51

AT5G54670 kinesin 3 15.6 13.2 13.2 15.1 15.2 7.4 7.4 7.6 16.4 14.3 89

AT2G23430 cyclin-dependent kinase inhibitor 1

3.7 5.5 7.9 6.7 6.0 2.1 2.6 2.5 3.7 3.4 158

AT5G48820 cyclin-dependent kinase inhibitor 3

14.1 13.9 10.1 9.5 11.2 6.5 6.5 6.1 13.2 8.0 160

AT5G60930 kinesin family member 29.0 23.2 17.1 21.3 21.9 15.9 19.5 21.3 25.4 29.8 170

AT4G05190 kinesin 5 27.2 21.2 16.0 21.5 21.5 13.8 16.9 17.8 19.9 27.9 170

AT1G44900 minichromosome maintenance protein 2

14.6 19.7 20.0 17.0 25.0 6.7 7.0 7.2 23.5 13.4 182

AT1G09815 DNA polymerase delta subunit 4

55.5 54.6 43.2 50.3 55.5 35.8 45.1 45.0 71.1 66.8 206

AT4G21270 kinesin 1 17.6 13.8 12.9 15.8 16.1 10.7 12.3 13.9 19.8 21.2 206

AT5G61000 Replication factor-A protein 1-like protein

15.8 14.5 16.7 16.8 24.1 5.8 4.5 4.3 25.4 9.8 321

AT5G41880 DNA primase small subunit

12.1 10.3 12.2 11.3 13.7 4.6 4.2 4.8 16.1 10.1 321

AT5G44635 minichromosome maintenance protein 6

14.3 12.7 14.2 12.3 16.5 5.9 4.5 5.4 18.3 11.1 321

AT3G25100 cell division control protein 45

6.4 5.1 7.8 6.6 7.6 3.2 2.5 5.3 9.4 4.9 321

AT5G43080 cyclin A3-1 10.2 7.0 10.5 8.1 11.8 4.8 2.5 4.7 12.3 7.8 321

AT1G61000 kinetochore protein Nuf2

9.8 8.6 9.3 10.1 11.1 5.6 5.1 5.6 12.8 8.5 321

AT1G67630 DNA polymerase alpha 2 12.8 10.5 12.4 10.3 13.0 7.3 6.8 7.9 15.2 11.6 321

AT1G67320 DNA primase large subunit

16.0 12.2 16.3 13.7 16.8 9.3 8.5 7.4 19.7 12.4 321

AT3G44730 kinesin-like protein 1 4.8 5.3 4.2 6.8 6.2 2.9 3.8 3.1 6.3 5.0 333

AT3G50070 cyclin-D3-3 33.3 31.4 27.4 25.6 32.5 20.4 22.0 25.0 46.1 32.6 469

AT5G63960 DNA polymerase delta subunit 1

13.2 11.3 10.3 11.1 12.0 10.0 9.4 9.2 16.7 12.3 469

AT1G08260 DNA polymerase epsilon subunit 1

11.1 9.0 7.7 8.3 8.3 8.9 7.5 7.1 12.2 10.6 541

AT5G06150 cyclin-B1-2 54.7 49.3 38.4 51.2 48.7 20.9 25.0 36.4 39.0 50.0 564

AT3G20150 Kinesin motor family protein

23.0 17.6 13.9 19.0 18.4 9.9 10.6 12.7 17.5 20.9 564

Dev

elo

pmen

t • S

uppl

emen

tary

info

rmat

ion

Development 143: doi:10.1242/dev.129973: Supplementary information

AT1G16330 cyclin B3-1 9.4 7.3 6.0 9.1 8.2 4.2 4.4 5.2 7.2 9.2 564

AT1G49620 cyclin-dependent kinase inhibitor 7

8.6 10.9 7.1 8.8 10.7 4.6 6.4 4.2 7.6 7.4 579

AT1G79560 cell division protease ftsH-12

67.4 54.8 59.0 72.1 81.1 24.9 21.6 27.3 42.9 42.4 583

AT2G45080 cyclin-U2-1 8.8 5.1 3.7 3.1 2.6 4.5 5.5 3.9 7.8 4.3 589

AT5G27000 kinesin 4 3.1 2.9 2.8 2.9 3.1 2.4 2.1 5.0 3.4 3.9 611

AT3G54180 cyclin-dependent kinase B1-1

18.9 15.6 16.3 16.5 17.3 8.4 10.4 11.3 24.0 16.1 628

AT3G19210 Rad54-like protein 5.6 4.2 4.1 4.9 5.5 2.8 3.2 3.0 7.1 4.7 628

AT5G67100 DNA polymerase alpha catalytic subunit

12.6 10.9 12.4 11.2 13.7 6.8 6.0 7.9 16.2 13.0 628

AT5G49160 DNA (cytosine-5)-methyltransferase 1

27.5 21.4 24.8 24.2 27.6 16.3 13.7 16.8 33.7 27.1 628

AT2G42120 DNA polymerase delta subunit 2

10.9 10.4 11.1 11.3 12.5 8.1 6.2 7.7 15.6 11.6 628

AT4G37630 cyclin-D5-1 5.5 5.2 6.3 5.7 6.7 3.7 4.0 3.7 6.6 4.1 661

AT1G73690 cyclin-dependent kinase D-1

4.0 5.2 3.9 5.0 5.2 1.1 2.8 3.9 4.6 4.2 667

AT2G26760 cyclin-B1-4 19.2 21.8 18.1 23.0 24.0 8.1 12.2 15.8 19.0 23.4 667

AT3G19590 cell cycle arrest protein BUB3

32.8 25.7 23.8 27.9 28.3 15.1 17.0 18.4 36.1 32.2 688

AT2G38720 microtubule-associated protein 65-5

3.2 3.8 3.2 9.8 12.3 1.2 1.2 1.1 12.7 7.3 708

AT3G48160 protein DP-E2F-like 1 6.2 5.5 5.0 5.8 8.4 3.6 3.6 4.0 8.7 6.1 708

AT2G36200 kinesin family member 11

25.7 17.6 16.2 19.2 20.5 13.7 17.2 18.6 29.8 31.0 804

AT3G54630 kinetochore protein NDC80

10.0 9.6 7.6 8.1 9.3 6.5 8.7 8.8 12.0 10.6 804

AT3G22880 meiotic recombination protein DMC1-like

protein

17.0 16.0 19.1 29.4 26.4 6.9 8.8 7.4 28.7 27.4 823

AT3G48210 kinetochore protein Spc25

15.4 16.4 13.4 16.1 16.8 12.8 16.9 18.0 20.9 21.0 824

AT4G29730 histone-binding protein RBBP4

9.5 9.4 7.4 8.3 10.6 5.4 5.6 4.7 12.2 8.2 834

AT2G27970 cyclin-dependent kinases regulatory

subunit 2

89.2 74.2 64.7 94.4 90.4 47.7 52.6 42.8 119.7 94.6 849

AT3G05330 cyclin family protein 19.9 20.8 16.6 21.3 22.9 6.8 8.3 10.6 12.6 16.3 962

AT1G15660 centromere protein C 20.8 17.2 19.7 17.6 20.1 14.0 16.0 18.0 33.8 27.6 999

Dev

elo

pmen

t • S

uppl

emen

tary

info

rmat

ion