Development of the Moss Physcomitrella patens for Assessment in Space Virginia Slater Kirk Findlay,...
-
Upload
mercy-goodman -
Category
Documents
-
view
214 -
download
0
Transcript of Development of the Moss Physcomitrella patens for Assessment in Space Virginia Slater Kirk Findlay,...
Development of the Moss Physcomitrella patens for
Assessment in Space
Virginia Slater
Kirk Findlay, TJ White, Dr. Maria Ivanchenko and Dr. Terri Lomax
Role of Plants on Earth
The Unique Conditions of a Space Environment
• Microgravity
• Cosmic Radiation
• Low Atmospheric Pressure
• High CO2
• Temperature
Microarray Technology
• Measures temporal and spatial gene expression.
• Provides information of gene involvement in a process or pathway.
Plant Genetic Assessment
and Control Module
Resource Adjustments:Biological Activate Genes Deactivate Genes Alter Genes
Physical Change light Change water Change gases Change nutrients
Plant-CenteredLife-Support
System
Life Support Outputs:Food Medicines VitaminsGas RecyclingWater RecyclingWaste RecyclingAesthetics/Avocation
Resource Inputs:Biological Plants Seed/spores Microbes
Physical Light Water Gases Nutrients
Objective
• Design plants to be used to assess the NASA Fundamental Space Biology Free-Flyer Satellite Program.
• Design and produce genetic constructs that are coupled with fluorescent tags.
• Transform the constructs into the moss Physcomitrella patens.
• Monitor protein expression to establish baseline standards.
Why Moss?
• Protonema– Cell division and
growth.– Signal transduction
• Gametophore– Organogenesis
– Establishment of the body plan.
– Plant development
Why Moss?
• Physcomatrella patens is a model organism for the study of plant development.
• Contains a super efficient gene targeting system.– 90% efficiency
Hypothesis
• Rubisco is located in the chloroplasts.
• We hypothesize that the Rubisco/GFP will cause the chloroplasts to fluoresce producing a signal that will be detectable from ground control.
Methodology
• Design primers for a portion of the Rubisco gene.
• Use designed primers in PCR to amplify that portion of Rubisco.
• Restrict the moss PCR product (Rubisco).• Restrict plasmid pMBL5.• Ligate pMBL5 and the Rubisco fragment
together.• Repeat with GFP (next slide).
Digestion of Expansin
1 kb Ladder
pMBL5 BamH I/Kpn
GFP fragment - BamH I/Kpn I
pMBL5 Not I/BamH I
Expansin fragment - Not I/BamH I
Expansin fragment - Not I/BamH I
?!?!?!?
AGATCTAACCACGAGAGTTTGGTGTGATCTCTGCAGTTTAAGCTAGTGAGCTGGTAGCAAGGGGCGATGGCGAGGCATAATGCAACAAAGCCTGTGACACTCATTCTTGCTGCACTGATGGTTCTTTCAGCCACCGACAACGTCGAAGGTCGTCATCACGTCAGAGATGGAAAAAACTGGCGCAAAGCTCATGCAACTTTCTACGGGGGTGCTGATGCTTCAGGAACTATGGGTAACTTTTTTCAACCTCTTGTTCAACTTCGGAGGCGTCCCATGAATCCTTACAAGTAGTAATTAAAACTTAAGTTTCTTGACAATGTGTATGCTTCCTATCTATTTGGAACTAAACCATTCCTCTGCTCTGATCAGAAACTTGAATCAGCTGCAAAGAGAATAAGACGCCAATATACATGTATCAGAAAACTAACGAAGAGGACTACAAATTTTGGATCTCTTCCATGTAGCTCTTGTCCATAAGGCACCACCTTATGGAGAAATTTTTTTTCGAAAGTTTTGAATTCAGAGATCGGTTGACTAAATAGTAACCTTCGAATGTGCAGACGGTGCATGCGGTGCATGCGGTTACGGAAACCTCTACAGCACTGGCTATGGAGTCGATTCGACAGCTTTGAGTACAGCTCTTTTCAACAATGGGGCAAAATGCGGAGCTTGTTTTGCGATCCAATGCTATCGTTCACAGTATTGCGTTCCAGGTTCACCTGTAATCACTGTCACAGCTACAAACTTCTGCCCTCCAACCACAAAGGTGATGGCACGCCAGGATGGTGTAATCCGCCAATGCGTCACTTCGACCTTGCGCAGCCTAGCTTCACCAAAATCGCTAAGTATAGAGCCGGCATCGTCCCCGTTCTCTTCAGAAGGTGTGCATTGCGTTGAAGACTGATTTGTAAATTGTGACTTTAAGCCTTAATTACTGAGGATGGAGACAGCTGTGCAATCACTTCGCAAATTAAACCATGCATGTTTTTAAGAAAACAGAAACGGCAGAACAAACCGTCAGCCAATTGAAAGAGATGTTCTGAAACTTAGTAAAAGAGGTTGTCTTAGTCCTGTTTGGATTGGTAGTTTGATATTACGAAGTCCGTACTGACCAAAACTTTGTTATATGCCTTGCACAATGCAGGGTACCATGCGAGAAAAAAGGTGGCGTCAGGTTCACTATCAATGGAAATAAGTATTTCAATCTCGTCCTAGTTCACAATGTTGGTGGAAAAGGCGATGTGCACGCAGTAGACAT
AATACAGAATGGATTCCCATGAAGCGAAACTGGGGAATGAACTGGCAACAGATGCT GGATCC
PP Expansin Gene
GTTATGACCAAG
TGGCCAGGCACTCTCCTTCCGAGTGACAACCAGTGATGGTAAGACCATAGTCTCTATGAACGCAACGCCATCTCACTGGAGCTTCGGCCAGACCTTCGAGGGAGGTCAGTTCGCTATGAATTGAATTCTGTAACCCCAAGAGCGGTGCCACTCGATGAATGCTTTAGGCGAAGAGTTGATCCACAAGGGAACCTAGACGCAGTTGAGTCTCAATCTAGCTTCATGATATTTGTTGATACCTATACTGGATACCAATCGGCGTCTTGAATCCTCAACATCTACCCTCCACGCTTTACCCAGATATCCCGAGATCTGGCCAACGTGAACGGTTTTGAAATTTACCAATATCAGTAGCACATAAAACCCATGGGGTACAATGATTTGTAGGTAGTGCGCAATCATGGGGAT
Future Plans
• Transform the moss cultures and select for stable transformations.
• Repeat the experiment using a structural protein.
• Monitor and analyze proteins levels to establish baseline standards for ground plants.
• Test moss cultures in space.
Acknowledgements
• Howard Hughes Medical Insitute
• McNair Scholar’s Program• Dr. Terri Lomax• Dr. Maria Ivanchenko• Kirk Findlay• TJ White• Dr. Kevin Ahern• Dr. Indira Rajagopal• The Lomax Lab• HHMI and McNair Scholars• Dept. of Botany and Plant
Pathology