A

m

asbsrs©

K

1

(ni(

roCtvv

0d

Available online at www.sciencedirect.com

Journal of Virological Methods 148 (2008) 155–160

Development of a real-time PCR for the detection and quantitationof caprine herpesvirus 1 in goats

Gabriella Elia a, Elvira Tarsitano a, Michele Camero a, Anna Lucia Bellacicco a,Domenico Buonavoglia a, Marco Campolo a, Nicola Decaro a,

Julien Thiry b, Maria Tempesta a,∗a Department of Animal Health and Well-being, Faculty of Veterinary Medicine, University of Bari,

S.p. Casamassima km. 3, 70010 Valenzano, Italyb Department of Infectious and Parasitic Diseases, Faculty of Veterinary Medicine, University of Liege,

Boulevard de Colonster 20, B43b, 4000 Liege, Belgium

Received 24 July 2007; received in revised form 18 October 2007; accepted 26 October 2007

bstract

Caprine herpesvirus 1 (CpHV-1) is an alphaherpesvirus interfering with goat reproductive performances. The virus is associated with neonatalortality in kids and reproductive failure in adults.A real-time PCR assay based on TaqMan technology and targeting the gene encoding for glycoprotein C (gC) was developed for detection

nd quantitation of CpHV-1 in samples collected from infected goats. The detection limit of the assay was 1 × 102 standard DNA copies, with aensitivity of 1–2 logs higher than the conventional gel-based PCR assay targeting the same gene. The real-time PCR was reproducible, as showny satisfactory low intra-assay and interassay coefficients of variation. The quantitative assay was validated on clinical samples, including genital

wabs and various tissue samples collected from goats either infected naturally or experimentally with CpHV-1. The high sensitivity, simplicity andeproducibility of the CpHV-1 fluorogenic PCR assay, combined with its wide dynamic range and high throughput, make this method especiallyuitable for studies on the pathogenesis and for trials with experimental vaccines and antiviral drugs.

2007 Elsevier B.V. All rights reserved.

rv

etB

cdDd

eywords: Goat; Caprine herpesvirus 1; Real-time PCR

. Introduction

Infection by the �-herpesvirus Caprine herpesvirus 1CpHV-1) is common in goats. CpHV-1 is responsible foreonatal mortality in kids and reproductive failures such asnfertility, returns in service and abortions in adult animalsKoptopoulos, 1992).

CpHV-1 can infect goats by either the nasal or the genitaloute and the pathogenic pathways markedly differs on the basisf the virus entry. After intranasal infection, local replication ofpHV-1 can be followed by viraemia and the virus can reach

he genital tract, with the onset of typical lesion and with theirus being shed at high titres (Tempesta et al., 1999). By con-erse, after genital infection, there is a massive virus replication

∗ Corresponding author. Tel.: +39 080 4679838; fax: +39 080 4679843.E-mail address: m.tempesta@veterinaria.uniba.it (M. Tempesta).

atcr

c

166-0934/$ – see front matter © 2007 Elsevier B.V. All rights reserved.oi:10.1016/j.jviromet.2007.10.021

estricted to the genital mucosa, with erythema, oedema andesicular-necrotic lesions (Tempesta et al., 2000).

CpHV-1 establishes latent infections but its reactivation isxtremely difficult under both natural and experimental condi-ions and it has been reported rarely (Ackermann et al., 1986;uonavoglia et al., 1996; Plebani et al., 1983).

Diagnosis of CpHV-1 infection by virus isolation on tissueultures is time-consuming and poorly sensitive. Accordingly,ue to its higher sensitivity and versatility, detection of viralNA by polymerase chain reaction (PCR) is now regarded as theiagnostic “gold standard” technique for CpHV-1 (Tempesta etl., 1998). Nevertheless, PCR-based assays were not designatedo be quantitative and are exposed frequently to risks of carryover

ontamination, especially when a large sample throughput isequired.

The aim of this study was to develop a rapid, sensitive and spe-ific real-time PCR method to detect and quantify CpHV-1 DNA

1 gical

isflsbt

2

2

iasd

sSA

wet

2

oBDfM6dt

2

TCtctsrmrM−

2

oC

TtTdp(o

2

aue7tl

2

sicIp1tf91

tcDbDIvafC3aTvf

2

mi4

56 G. Elia et al. / Journal of Virolo

n biological samples of infected goats. Real-time PCR sub-tantially improves virus detection, as the use of target-specificuorescent probes is able to increase both the sensitivity andpecificity. Moreover, the estimation of CpHV-1 DNA copies iniological samples may provide a powerful tool to investigatehe pathogenetic mechanisms of CpHV-1 infection in goats.

. Materials and methods

.1. Samples

A total of 60 samples collected from goats naturally or exper-mentally infected with CpHV-1 were submitted to gel-basednd real-time PCR assays (Table 1). All the samples had beencreened by virus isolation and titration on tissue cultures asescribed elsewhere (Tempesta et al., 1999).

Total DNA was purified from nasal/vaginal swabs and tissueamples (25 mg) by using the DNeasy Tissue Kit (QIAGEN.p.A., Italy), followed by final elution of DNA with 200 �l ofE buffer and storage at −70 ◦C until use.The viral DNA extracted from mock-infected MDBK cells

as used as negative controls, along with the DNA extracts ofight nasal swabs and 12 vaginal swabs made from goats thatested negative for CpHV-1 antibodies.

.2. Design of primers and probe

Primers and probe (Table 2) targeting a conserved regionf the gC gene of the strain BA-1 of CpHV-1 (Gen-ank accession AY821804) were designed using the Beaconesigner software (Bio-Rad Laboratories S.r.l.) and purchased

rom MWG Biotech AG (Ebersberg, Germany). The Taq-an probe was labelled with the fluorescent reporter dye

-carboxyfluoroscein (FAM) at the 5′ end and with the quencherye 6-carboxytetramethylrhodamine (Blackhole Quencher 1) athe 3′ end.

.3. DNA standard

To obtain a standard for quantitative CpHV-1 PCR based onaqMan chemistry, the full-length sequence of the gC gene ofpHV-1 was cloned into p-GEM-3Z (Promega U.S.) by conven-

ional methods. Plasmid DNA was purified using a commercialolumn (Fast Plamid Mini, Eppendorf, Hamburg, Germany) andhe copy number was calculated by spectrofotometrical analy-is. Tenfold serial dilutions of the CpHV-1 gC standard DNA,epresenting 100 to 108 copies of DNA/10 �l of template, wereade out in TE (Tris–HCl, EDTA) buffer containing 30 �g car-

ier RNA (tRNA from Escherichia coli, Sigma–Aldrich S.r.l.,ilan, Italy) per ml. Aliquots of each dilution were frozen at70 ◦C and used only once.

.4. CpHV-1 gel-based PCR

Conventional PCR assay, targeting the gC gene and basedn ethidium bromide staining, was performed for detection ofpHV-1 DNA in clinical samples as previously described by

a2Mn

Methods 148 (2008) 155–160

empesta et al. (1998), with minor modifications. The reac-ion mix (50 �l) consisted of PCR buffer 1× (KCl 50 mM,ris–HCl 10 mM, pH 8.3), MgCl2 2.5 mM, 1.25 mM of eacheoxynucleotide (dATP, dCTP, dGTP, dTTP), 50 pmol of eachrimer CapIII and CapIV (Table 1), 1.25 U of Takara LA TaqTM

Takara Bio Inc.), 5 �l of dimethyl sulfoxide (DMSO) and 10 �lf template containing 10–50 ng of extracted DNA.

.4.1. CyclingAfter 1 min at 94 ◦C for template denaturation and enzyme

ctivation, amplification was obtained with 35 cycles of denat-ration at 95 ◦C for 1.30 min, annealing at 70 ◦C for 1 min andxtension at 72 ◦C for 1 min followed by a final extension of2 ◦C for 10 min. The PCR product (8 �l) was analyzed by elec-rophoresis through a 1.5% agarose gel and visualized under UVight after ethidium bromide staining.

.5. CpHV-1 real-time PCR

Duplicates of CpHV-1 standards and DNA templates wereubjected simultaneously to real-time analysis with each runncluding one negative control (no template). Amplification wasarried out in a 25-�l reaction volume containing 12.5 �l ofQTM Supermix (Bio-Rad Laboratories S.r.l.), 900 nM of eachrimer (CpHV-1For and CpHV-1Rev), 200 nM of probe CpHV-Pb and 10 �l of DNA. The thermal cycle protocol used washe following: activation of iTaq DNA polymerase at 95 ◦Cor 10 min followed by 45 cycles consisting of denaturation at5 ◦C for 1 min, primer annealing and extension at 70 ◦C formin.

In order to verify the absence of DNA losses during the extrac-ion step and of PCR inhibitors in the DNA templates, an internalontrol (IC), consisting of canine parvovirus type 2 (CPV-2)NA (Desario et al., 2005), was added to the lysis buffer (ALuffer, QIAGEN S.p.A., Italy) at the concentration of 10,000NA copies per milliliter of buffer. The fixed amount of the

C added to each sample had been calculated to give a mean CTalue in a real-time PCR assay (Decaro et al., 2005) of 36.26 withS.D. of 0.81 as calculated by 50 separate runs. Real-time PCR

or IC detection was carried out in a separate run, using primersPV-For (5′-AAACAGGAATTAACTATACTAATATATTTA-′) and CPV-Rev (5′-AAATTTGACCATTTGGATAAACT-3′)nd probe CPV-Pb (5′-6-FAM-TGGTCCTTTAACTGCA-TAAATAATGTACC-TAMRA-3′). Samples in which the CTalue for the IC was >37.88 (average plus 2 S.D.) were excludedrom the analysis.

.6. Analytical performance of the real-time assays

The analytic specificity of the real-time PCR assay was deter-ined using DNA prepared from other ruminant herpesviruses,

ncluding bovine herpesvirus type 1 and type 4 (BoHV-1, -) (Buonavoglia et al., 1984; Camero et al., 2004; Cavalli et

l., 1994), ovine herpesvirus type 2 (OvHV-2) (Decaro et al.,003), Alcelaphine herpesvirus 1 (AlHV-1, kindly supplied by. Engels, University of Zurich, CH), together with ovine ade-

ovirus (OAdV) (Decaro et al., 2002). DNA extracts from nasal

G. Elia et al. / Journal of Virological Methods 148 (2008) 155–160 157

Table 1Analysis of samples from goats infected with CpHV-1 by real-time PCR analysis, gel-based PCR and virus isolation on cell cultures

Samples Tissue or swab Infection Reactivation Virus isolation PCR Real-time titera

1. T21A PS NAT EXP − w 4.10 × 103

2. T1S VS EXP NO + + 2.90 × 106

3. T3S VS EXP NO + + 6.92 × 106

4. T5S VS EXP NO + + 6.33 × 106

5. T1L NS EXP NO + + 7.53 × 103

6. T6L VS EXP NO − − 2.09 × 102

7. T8L VS EXP NO − − 1.57 × 102

8. T7T VS EXP NO + + 2.29 × 106

9. T5C VS EXP NO − + 3.36 × 103

10. T6C VS EXP NO − + 9.09 × 103

11. T6C NS EXP NO + + 1.31 × 107

12. T8C VS EXP NO − − 5.30 × 103

13. T9C VS EXP NO − w 1.77 × 103

14. T9C NS EXP NO − + 6.74 × 103

15. T2772 VS NAT EXP + + 7.41 × 106

16. T2772b VS NAT EXP + + 5.52 × 106

17. 3D SG NAT EXP + + 4.48 × 108

18. 3D SG NAT EXP + + 9.64 × 107

19. 4D SG NAT EXP − w 3.48 × 104

20. 4D SG NAT EXP + + 5.20 × 104

21. TSa TG NAT EXP − + 5.64 × 104

22. TDa TG NAT EXP − + 4.04 × 104

23. TSb TG NAT EXP − + 4.16 × 104

24. TDb TG NAT EXP − + 3.78 × 104

25. F/1 F EXP NO − + 8.22 × 104

26. F/2 F EXP NO − + 7.46 × 105

27. F/3 F EXP NO + + 3.92 × 104

28. T1M VS EXP NO − + 3.88 × 103

29. T5M VS EXP NO + + 3.06 × 106

30. T8M VS EXP NO − + 7.95 × 103

31. T7R VS EXP NO + + 5.56 × 106

32. T9R VS EXP NO − − 7.34 × 102

33. T10R VS EXP NO − − 1.59 × 103

34. T3V VS NAT EXP + + 8.64 × 103

35. T7V VS NAT EXP + + 7.43 × 104

36. T1F NS EXP NO + + 9.42 × 106

37. T4F NS EXP NO − − 2.22 × 102

38. T8F NS EXP NO − − 6.40 × 103

39. T3P PS NAT EXP − w 3.76 × 103

40. T6P PS NAT EXP − − 3.10 × 103

41. TV1A VS EXP NO + + 3.30 × 104

42. TV2A VS EXP NO + + 3.34 × 105

43. TV3A VS EXP NO + + 2.69 × 106

44. TV4A VS EXP NO + + 9.25 × 106

45. TV5A VS EXP NO + + 6.09 × 106

46. TV6A VS EXP NO + + 2.89 × 106

47. TV7A VS EXP NO + + 1.18 × 106

48. TV8A VS EXP NO + + 3.47 × 104

49. TV9A VS EXP NO + + 5.68 × 104

50. TV10A VS EXP NO + + 9.36 × 104

51. TV1C VS EXP NO + + 1.85 × 105

52. TV2C VS EXP NO + + 1.72 × 106

53. TV3C VS EXP NO + + 3.65 × 105

54. TV4C VS EXP NO + + 9.98 × 105

55. TV5C VS EXP NO + + 4.55 × 104

56. TV6C VS EXP NO + + 6.87 × 104

57. TV7C VS EXP NO + + 5.13 × 104

58. TV8C VS EXP NO + + 7.55 × 104

59. TV9C VS EXP NO − w 9.85 × 103

60. TV10C VS EXP NO − − 1.57 × 103

Exp, experimental; Nat, natural; NO, not observed; NS, nasal swab; VS, vaginal swab; PS, prepucial swab; TG, trigeminal ganglia; SG, sacral ganglia; F, tissue poolfrom fetus; −, negative; +, positive; w, weak signal.

a Real-time titers are expressed as number of CpHV-1 DNA copies per 25 mg of tissue (tissue samples) or 10 �l of template (swabs).

158 G. Elia et al. / Journal of Virological Methods 148 (2008) 155–160

Table 2Oligonucleotides used in the CpHV-1 real-time and gel-based PCR assays

Primer/probe Sequence 5′–3′ Sense Positiona Amplicon size (bp)

CapIIIb AGGGCGCCGGTGGATGCTCTG + 632–653 414CapIVb GGCGGGCGGTGCGTCGTGA − 1027–1046CpHV-Forc TACCTCTTTCCCGCGCCCACG + 897–918 82CpHV-Revc TGTACACGCCCTCGGTCGCC − 959–979CpHV-Pbc FAM-CCGCCTGCCCCTCACCATCCGCTCC-TAMRA + 926–951

rain B

si

11tct

1tfbqsDrp

3

3o

qaNasico

cvTitt

wTba

Aws

sD(lr

3

ciit(w(ao

3results

The control samples from uninfected goats and from mock-infected MDBK cells tested negative by virus isolation, by PCR

Fig. 1. Standard curve of the CpHV1 real-time PCR assay. Tenfold dilutions

a Oligonucleotide position is referred to the sequence of CpHV-1 reference stb Gel-based PCR (Tempesta et al., 1998).c Real-time PCR.

wabs of goats tested negative for antibodies to CpHV-1 werencluded as negative controls.

The analytical sensitivity was assessed by analyzing serial0-fold dilutions of the CpHV-1 standard DNA, ranging from08 to 100 DNA copies/10 �l of template. The standard dilu-ions were tested in duplicate and used to construct the standardurve by plotting the plasmid copy number logarithm againsthe measured CT values.

In addition, real-time PCR was run with DNA from CpHV-reference strain BA-1 (Buonavoglia et al., 1996). The viral

itre was 106.50 TCID50/50 �l on MDBK cells. DNAs from 10-old dilutions of the viral suspension were extracted and testedy real-time or PCR. Within- and between-run precision of theuantitative real-time PCR assay was assessed by multiple mea-urements of samples containing different amounts of CpHV-1NA. The samples were evaluated in five replicates (within-

un precision) and in five separate experiments (between-runrecision).

. Results

.1. Analytical specificity and linear range of amplificationf real-time PCR assay

The specificity of the system designed for detection anduantitation of CpHV-1 DNA was assessed by testing in thessay samples known to be positive for other infectious agents.o cross-reactivity with BoHV-1 and -4, OvHV-2, AlHV-1

nd OAdV was observed likewise, no detectable fluorescenceignal was obtained in the negative control samples from mock-nfected MDBK cells as well as from CpHV-1-free goats,onfirming that the assay was highly specific for the detectionf CpHV-1 DNA.

To establish that the test had an acceptable sensitivity, it wasompared with conventional PCR (Tempesta et al., 1998). Airal suspension of the CpHV-1 strain BA-1 with a titre of 106.50

CID50/50 �l was diluted 1:10 and the dilutions were analyzedn duplicate by both the TaqMan assay and gel-based PCR. Real-ime analysis predicted that the starting DNA copy number ofhe viral suspension was 1.40 × 107/10 �l.

The detection limit of the CpHV-1 real-time PCR assay

as found to be 102 copies for the standard DNA and 10−2.50

CID50/50 �l for the BA-1 strain. The detection limit for the gel-ased PCR was 104 to 103 standard DNA copies/10 �l templatend 10−1.50 to 10−0.50 TCID50/50 �l of BA-1 strain of CpHV-1.

owaTc

A-1 (GenBank accession: AY821804).

ccordingly, the sensitivity of the CpHV-1 real-time PCR assayas 1–2 logs higher than the gel-based PCR assay targeting the

ame gene.The generated standard curve covered a linear range of

even orders of magnitude (from 102 to 108 copies of standardNA) and showed linearity over the entire quantitation range

slope = 3.658), providing an accurate measurement over a veryarge variety of starting target amounts. The coefficient of linearegression (R2) was equal to 0.9998 (Fig. 1).

.2. Precision of the quantitative real-time PCR

To asses the within- and between-run precision, field samplesontaining different amounts of CpHV-1 DNA were assayedn replicate on the same plate or in multiple experiments. Thentra-assay CVs were in the range from 7.75% (samples con-aining 7.65 × 103 DNA copies/10 �l of template) to 31.25%samples containing 3.20 × 102 DNA copies/10 �l of template),hereas the interassay CVs were comprised between 5.75%

samples containing 3.91 × 105 DNA copies/10 �l of template)nd 33.7% (samples containing 6.28 × 102 DNA copies/10 �lf template) (Fig. 2).

.3. Comparison of virus isolation, PCR and real-time PCR

f standard DNA prior to amplification were used, as indicated in the x-axis,hereas the corresponding cycle threshold (CT) values are presented on the y-

xis. Each dot represents the result of duplicate amplification of each dilution.he coefficient of determination (R2) and the slope value (s) of the regressionurve were calculated and are indicated.

G. Elia et al. / Journal of Virological

Fig. 2. Coefficients of variation intra-assay and interassay over the dynamicrange of the CpHV-1 real-time PCR assay. DNA amounts were calculated fort(a

apbnss(wnc

4

PsbtD

sctfiap

l1si

bc(sp

iTbbTioto

mttiut

ppeev(

endimals

bibh

A

Ith

R

A

B

he same samples in different assays (five consecutive runs) and within an assayfive times in the same assay). In each run, five replicates per sample werenalyzed.

nd by real-time PCR. As reported in Table 1, all the 60 sam-les were positive by real-time PCR and 51/60 tested positivey conventional gel-based PCR. Twenty-five samples resultedegative by virus isolation. By conventional PCR, 9 such 25amples were negative, 5 were weakly positive and 11 weretrongly positive. Accordingly, as observed in previous studiesTempesta et al., 1999, 2002), virus isolation onto cell culturesas poorly sensitive. CpHV-1 was never isolated from PCR-egative samples and from samples with a low number of DNAopies (<1.57 × 102).

. Discussion

In this study, the development of a TaqMan-based real-timeCR for detection and quantitation of CpHV-1 from clinicalpecimens is described. The real-time PCR assay was shown toe more efficient and more sensitive when compared to conven-ional gel-based PCR, since it was able to detect as few as 102

NA copies/10 �l of template.Compared with classical PCR protocols, real-time PCR has

everal major advantages. The time required for samples pro-essing is shorter, the contamination risks are lower becausehere are not post-PCR processing steps, and, finally, the speci-city is enhanced by the probe hybridization. As expected, nospecific amplification was obtained from the DNA of otherathogens or from CpHV-1-free goats.

The CpHV-1 real-time assay was highly reproducible andinear over a range of seven orders of magnitude, from 102 to08 copies, allowing a precise calculation of viral DNA load inamples containing a wide range of viral DNA amounts. Bothntra-assay and interassay CVs were satisfactorily low.

Usually, diagnosis of CpHV-1 infection is accomplishedy virus isolation onto cell cultures. Virus isolation is time-

onsuming since the onset of virus-induced cytopathic effectCPE) requires at least 3–5 days. Moreover, the virus can beuccessfully isolated only if the specimen is collected and storedroperly, since herpesviruses are very labile and the infectiv-

B

Methods 148 (2008) 155–160 159

ty quickly decreases under inappropriate storage conditions.he discovery and large-scale application of conventional gel-ased PCR has provided an alternative method, more sensitiveut only qualitative, for the diagnosis of CpHV-1 infection.itration of the virus load in clinical samples in cell cultures

s labour-consuming and requires at least 5 days for evaluationf virus-induced CPE. The real-time PCR allows to overcomehese constraints and, in addition, the assay displays a wide rangef detection and a good sensitivity.

The ability of the TaqMan assay to provide quantitative esti-ates of the viral DNA load in clinical specimens may allow

o gain new insights into the pathogenesis of CpHV-1 infec-ion, notably virus latency and the dynamics of virus sheddingn infected animals. Such a sensitive technique could help tonderstand unclear patterns of viral shedding, when the viraliters are very low and are undetectable by other techiniques.

Due to its analogies with genital infection by human her-esvirus type 2 (HHV-2), CpHV-1 infection in goats has beenroposed as a reliable animal model to evaluate the antiviralsffective against herpesviruses (Tempesta et al., 2007) and tovaluate the immune response and protection induced by inacti-ated vaccines after mucosal administration in the genital tractCamero et al., 2007).

To evaluate the effects of antiviral drugs in vitro, it is nec-ssary to determine the ability to inhibit virus replication aton-cytotoxic concentrations and to establish the concentration-ependent activities. Titration of infectious virus in cell culturess usually achieved by the end-point dilution method in cell

onolayers. Since distinguishing between virus-induced CPEnd non-specific cell alterations may be difficult, the estab-ished real-time PCR assay will be particularly suitable in thesetudies.

In conclusion, the real-time PCR described in this study wille helpful for evaluating the efficacy of antiviral drugs and exper-mental vaccines for CpHV-1. It will also provide data that coulde used for the study of analogous herpesviral infections ofumans.

cknowledgements

This work was supported by grants from University of Bari,taly: project ex 60% 2005 “Allestimento di una tecnica real-ime PCR per l’identificazione e quantificazione di caprineerpesvirus 1 in capre con infezione latente”.

eferences

ckermann, M., Metzler, A.E., McDonagh, H., Bruckner, L., Muller, H.K.,Kuhn, U., 1986. Stellen nichtbovine paarhfer ein IBR-Virus-reservoir dar?I. BHV-1 und CapHV-1 infektions und reaktivierungsversuche an ziegen,virustyp-spezifitat der humoralen antikorper und charakterisierung derviralen antigene. Schweiz. Arch. Tierheilk. 128, 557–573.

uonavoglia, C., Zicarelli, L., Di Trani, L., Orfei, Z., 1984. Isolamento di un

virus erpetico e di Acholeplasma laidlawi da una bovina affetta da metritepost-partum. Sel. Vet. 25, 731–732.

uonavoglia, C., Tempesta, M., Cavalli, A., Voigt, V., Buonavoglia, D., Con-serva, A., Corrente, M., 1996. Reactivation of caprine herpesvirus 1 inlatently infected goats. Comp. Immun. Microbiol. Infect. Dis. 19, 275–291.

1 gical

C

C

C

D

D

D

D

K

P

T

T

T

T

60 G. Elia et al. / Journal of Virolo

amero, M., Bellacicco, A.L., Tarsitano, E., Decaro, N., Martella, V., Tempesta,M., Buonavoglia, C., 2007. Intravaginal administration of an inactivatedvaccine prevents lesions induced by caprine herpesvirus 1 in goat. Vaccine25, 1658–1661.

amero, M., Tarsitano, E., Greco, G., Desario, C., Gargano, P., Lucifora, G.,Tempesta, M., 2004. Infezione da BoHV-4 associata a metrite-vaginite in unallevamento bovino. Large Anim. Rev. 10, 13–16.

avalli, A., Voigt, V., Tempesta, M., Buonavoglia, D., Buonavoglia, C., 1994.Isolamento di due stipiti di Bovine Herpesvirus 1 da polmoni di ovino. ActaMed. Vet. 40, 239–244.

ecaro, N., Elia, G., Martella, V., Desario, C., Campolo, M., Di Trani, L., Tar-sitano, E., Tempesta, M., Buonavoglia, C., 2005. A real-time PCR assay forrapid detection and quantitation of canine parvovirus type 2 in the feces ofdogs. Vet. Microbiol. 105, 19–28.

ecaro, N., Tinelli, A., Pratelli, A., Martella, V., Tempesta, M., Buonavoglia, C.,2003. First two confirmed cases of malignant catarrhal fever in Italy. NewMicrobiol. 26, 339–344.

ecaro, N., Tinelli, A., Zizzo, N., Greco, G., Terio, V., Bozzo, G., Lavazza, A.,

2002. Adenovirus associato a grave forma di polmonite negli agnelli. AttiXV SIPAOC, 68.

esario, C., Decaro, N., Campolo, M., Cavalli, A., Cirone, F., Elia, G., Martella,V., Lorusso, Camero, M., Buonavoglia, C., 2005. Canine parvovirus infec-tion: which diagnostic test for virus? J. Virol. Methods 121, 179–185.

T

Methods 148 (2008) 155–160

optopoulos, G., 1992. Goat herpesvirus 1 infection: a review. Vet. Bull. 62,77–84.

lebani, G.F., Engels, M., Metzler, A.E., Wyler, R., 1983. Caprine herpesvirusin der Schweiz: verbreitung, haufigkeit und latenz der infektion. Schweiz.Arch. Tierheilk. 125, 395–411.

empesta, M., Camero, M., Bellacicco, A.L., Tarsitano, E., Crescenzo, G., Thiry,J., Martella, V., Decaro, N., Elia, G., Neyts, J., Thiry, E., Buonavoglia, C.,2007. Potent inhibition of genital herpesvirus infection in goats by cidofovir.Antiviral Ther. 12, 977–979.

empesta, M., Greco, G., Pratelli, A., Buonavoglia, D., Camero, M., Martella,V., Buonavoglia, C., 2002. Reactivation of caprine herpesvirus 1 in experi-mentally infected goats. Vet. Rec. 150, 116–117.

empesta, M., Pratelli, A., Corrente, M., Buonavoglia, C., 1999. A prelimi-nary study on the pathogenicity of a strain of Caprine herpesvirus 1. Comp.Immunol. Microbiol. Infect. Dis. 22, 137–143.

empesta, M., Pratelli, A., Normanno, G., Camero, M., Buonavoglia, D., Greco,G., Buonavoglia, C., 2000. Experimental intravaginal infection of goats withcaprine herpesvirus 1. J. Vet. Med. B: Infect Dis. Vet. Public Health 47,

197–201.

empesta, M., Sagazio, P., Pratelli, A., De Palma, G., Corsalini, T., Buonavoglia,C., June 28–July 4, 1998. Detection of Caprine herpesvirus 1 by polymerasechain reaction. In: Proceedings of the Eighth World Conference on AnimalProduction, Seoul, pp. 414–415.