MICROSATELLITE LETTERS

Development and characterization of new polymorphicmicrosatellite markers for Degenia velebitica (Degen) Hayek(Brassicaceae)

Ivan Radosavljevic • Jernej Jakse • Zlatko Satovic •

Branka Javornik • Zlatko Liber

Received: 21 November 2013 / Accepted: 25 November 2013

� Springer Science+Business Media Dordrecht 2013

Abstract Twelve novel polymorphic microsatellite

markers were developed for Degenia velebitica. All 12

microsatellite markers showed single-locus amplification

and reveal 88 alleles in 20 individuals from a natural popu-

lation. The number of alleles per microsatellite locus varied

from 3 to 19. The observed heterozygosity, the expected

heterozygosity, and polymorphic information content ran-

ged from 0.250 to 0.950, 0.234 to 0.938 and 0,220 to 0,908,

respectively. The significant deviations from the Hardy–

Weinberg expectations were detected in two microsatellite

loci. These new microsatellite markers will be a useful tool

for studying genetic diversity, genetic structure and phylo-

geography of D. velebitica, as well as for successful con-

servation and management of this endangered species.

Keywords Brassicaceae � Monotypic genus �Degenia velebitica � Microsatellites � Endemic �Endangered

Genus Degenia Hayek (Brasicaceae) consists of only one

species, Degenia velebitica (Degen) Hayek (Hayek 1910).

This species is known from several populations on Mt.

Velebit and Mt. Velika Kapela in the Republic of Croatia.

This species has been classified as an endangered taxon of

the Croatian flora (Nikolic and Topic 2005). In spite of

conservation status and protection by law, the exact area of

occupancy, abundance and basic population characteristics

of this taxon are still not known. In order to study genetic

diversity, genetic structure and phylogeography as well as

to carry out successful conservation and management of

this species our first goal was development of new

microsatellite markers. As a result twelve new microsat-

ellite markers were developed by this research.

Genomic DNA samples were extracted from dried D.

velebitica leaves using the GenElute Plant Genomic DNA

Miniprep Kit (Sigma-Aldrich, St. Louis, Missouri, USA).

New microsatellite markers were developed from genomic

DNA libraries enriched for GA, GT, AGA and ACT repeats

(Radosavljevic et al. 2012). Positive clones were selected

from the libraries and used for plasmid isolation (Wizard

Plus SV Minipreps, Promega Corporation, Madison, WI,

USA). Sequencing of plasmid isolates was performed by

means of T7 and SP6 universal primers using Big Dye

chemistry and an ABI 3730XL analyzer (Applied Biosys-

tems, Foster City, CA, USA). The sequences were edited and

assembled using Geneious� Pro software version 5.6.4

(Biomatters Ltd., Auckland, New Zealand). The sequences

of twelve polymorphic microsatellite loci were deposited

into GenBank under accession numbers KF727604 to

KF727615 (Table 1). PCR primer pairs flanking microsat-

ellite repeats were designed using the PRIMER 3 program

(Whitehead Institute, Cambridge, MA, USA). New PCR

primers were first tested on five randomly chosen Degenia

individuals. Only twelve polymorphic SSR markers with

good amplification were tested on the complete set of 20

individuals from the Mt. Velebit natural population. PCR

I. Radosavljevic � Z. Liber (&)

Department of Botany, Division of Biology, Faculty of Science,

University of Zagreb, Marulicev trg 9a, 10000 Zagreb, Croatia

e-mail: zlatko.liber@botanic.hr

J. Jakse � B. Javornik

Centre for Plant Biotechnology and Breeding, Agronomy

Department, Biotechnical Faculty, University of Ljubljana,

Jamnikarjeva 101, 1000 Ljubljana, Slovenia

Z. Satovic

Department of Seed Science and Technology, Faculty of

Agriculture, University of Zagreb, Svetosimunska cesta 25,

10000 Zagreb, Croatia

123

Conservation Genet Resour

DOI 10.1007/s12686-013-0105-4

amplification was performed using tailed primers (Schuelke

2000) and a two-step protocol with initial touchdown cycle

(Radosavljevic et al. 2012). The products were run on an ABI

3730XL analyzer (Applied Biosystems, Foster City, CA,

USA) using the commercial GeneScan service (Macrogen

Inc., Seoul, Korea). The results were analyzed using

GeneMapper 4.0 software (Applied Biosystems, Foster City,

CA, USA). For each microsatellite locus, the average num-

ber of alleles per locus (Na), the observed heterozygosity

(Ho), the expected heterozygosity or gene diversity (He), and

the polymorphism information content (PIC) were calcu-

lated using PowerMarker V3.25 (Bioinformatics Research

Center, Raleigh, NC, USA). GENEPOP version 3.4 (Labo-

ratiore de Genetique et Environment, Montpellier, France)

was used to test genotypic frequencies for conformance to

Hardy–Weinberg expectations (HWE) and to test the loci for

gametic disequilibrium. The sequential Bonferroni adjust-

ments were applied to correct for the effect of multiple tests

using SAS release 8.02 (SAS Institute Inc., Cary, NC, USA).

Each locus was evaluated for the presence of null alleles,

scoring errors, and allelic dropout using Micro-Checker

version 2.2.3. (University of Hul, UK).

A total of 88 alleles, ranging from 3 to 19 per locus, were

observed in the test population (Table 1). The observed

heterozygosity, the expected heterozygosity, and polymor-

phic information content ranged from 0.250 to 0.950, 0.234

to 0.938 and 0,220 to 0,908 respectively. Two out of the

twelve newly developed microsatellite loci (DvUZ001,

DvUZ010) showed significant deviations (P \ 0.05) from

HWE after the application of the sequential Bonferroni

corrections (Table 1). These two loci also exhibited an

overall excess of null allele frequencies using Brookfield’s

formula (0.163/DvUZ001/ and 0.177/DvUZ010/). Two out

of the 66 tests for linkage disequilibrium were significant

(P \ 0.05) after applying sequential Bonferroni corrections

(DvUZ011/DvUZ012; DvUZ005/DvUZ007).

The 12 new microsatellite markers will be useful tool

for studying genetic diversity, genetic structure and phy-

logeography of D. velebitica, as well as for successful

conservation and management of this endangered species.

Table 1 Characteristics of twelve new microsatellite markers for D. velebitica and results of the initial primer screening in a natural population

Locus

name

Primer sequence (50–30) Repeat

motif

Ta

(�C)

Size

range

(bp)

Na HO HE PIC GenBank

accession

number

DvUZ001 F: CAACACTTTTGGCGTGCTTA (GT)12 55 199–205 4 0.450 0.758* 0.681 KF727604

R: ATGGCCCATTGCAGAAGTTA

DvUZ002 F: GACGGAGACTTGCTCTCAGC (GA)31 55 210–272 19 0.900 0.938 0.908 KF727605

R: TAGGGCCGAGATCCACTAGA

DvUZ003 F: TCACCCAAACCTAAAGCAATG (GA)18 55 205–229 5 0.450 0.526 0.481 KF727606

R: ATTAGGTCCTCCAGCGAGGT

DvUZ004 F: AGCTACGTCAACGGACAAGA (GT)14 55 156–162 4 0.250 0.234 0.220 KF727607

R: TCATGTTTTCGGTCAAGCAG

DvUZ005 F: TGAATCGAGACAGAGCCACA (GA)20 55 168–195 6 0.500 0.804 0.742 KF727608

R: GACTTCTTGGCTCCAAACCA

DvUZ006 F: GACACGCAGAGCCAAAGAGT (AGA)11 55 204–222 5 0.400 0.688 0.603 KF727609

R: AGCTGTTCCAGGAAACGAAA

DvUZ007 F: GGACTGGGAACAAAGTGATGA (ACT)13 55 156–211 9 0.700 0.874 0.830 KF727610

R: TCTCCTTTAGATGGAGCAGCA

DvUZ008 F: CAAGCGAGGAGAGTGTGTTG (AGA)16 55 161–173 3 0.300 0.543 0.410 KF727611

R: TGTCATGAAGTGCCTTGAGC

DvUZ009 F: AGCCCCGATGGAAAACATA (GA)26 55 202–240 13 0.950 0.918 0.887 KF727612

R: GAGCGCAGGTCTTTTGAGTC

DvUZ010 F: TTCTTCTTCATTTCTCATCAGATTC (GA)18 55 156–194 12 0.550 0.915*** 0.871 KF727613

R: AAAGGAGAGATAGAACGAAAAGGA

DvUZ011 F: GAGTTTCTTGGGCTGATTCG (GA)13 55 142–159 4 0.450 0.587 0.500 KF727614

R: CTTTTCCCGGTATTGCATGT

DvUZ012 F: TCACAACAACACACGCTGAA (GA)14 55 197–209 4 0.500 0.641 0.572 KF727615

R: GTGGGGAGTATTTGGGAGGT

Ta annealing temperature, Na number of alleles, HO observed heterozygosity, HE expected heterozygosity, PIC polymorphic information content

Significant deviations from Hardy–Weinberg equilibrium after sequential Bonferroni corrections: *** significance at the 0.1 % nominal level;

** significance at the 1 % nominal level; * significance at the 5 % nominal level

Conservation Genet Resour

123

Acknowledgments This study was supported by the Scientific

Research Council of the Republic of Croatia, within the framework of

Project No. 119-1191193-1232 and 178-1191193-0212, and by the

Slovenian Research Agency Research Programme P4-0077.

References

Hayek A (1910) Die systematische Stellung von Lesquerella velebi-

tica Degen. Oesterr Bot Z 60(3):89–93

Nikolic T, Topic J (2005) Red Data Book of Vascular Flora of

Croatia. Ministry of Culture of the Republic of Croatia & State

Institute for Nature Protection, Zagreb

Radosavljevic I, Satovic Z, Jakse J, Javornik B, Greguras D, Jug-

Dujakovic M, Liber Z (2012) Development of New Microsat-

ellite Markers for Salvia officinalis L. and Its Potential Use in

Conservation-Genetic Studies of Narrow Endemic Salvia

brachyodon Vandas. Int J Mol Sci 13(9):12082–12093

Schuelke M (2000) An economic method for florescent labeling of

PCR fragments. Nat Biotechnol 18:233–234

Conservation Genet Resour

123