Determining the Role of Trib3 in Neuronal Apoptosis

Neela Zareen

Submitted in partial fulfillment of the

requirements for the degree of

Doctor of Philosophy

in the Graduate School of Arts and Sciences

COLUMBIA UNIVERSITY

2012

© 2012

Neela Zareen

All rights reserved

Abstract

Determining the Role of Trib3 in Neuronal Apoptosis

Neela Zareen

Naturally occurring apoptosis in the developing nervous system is an important event for the

proper shaping of the system, for eliminating precursor cells with mutations and for curbing the

population of post-mitotic neurons so that appropriate target innervation can take place. In the

latter case, neurons are usually subjected to a competition for a limited supply of target-derived

growth factor. A classic example includes neurons of the superior cervical ganglia that compete

for nerve growth factor (NGF). Cell death arising from lack of NGF stimulation is a topic of

intense research and remains enigmatic. Pro-apoptotic molecules that have been characterized so

far are partially responsible for inducing death and furthermore, it is not fully understood how

the homeostatic balance of the neuron is disrupted by NGF deprivation. In this thesis, a novel

neuronal pro-apoptotic protein Trib3 is defined. It is shown to be required for developmental

neuron death and to employ a cellular mechanism involving Akt and its substrates, the FoxO

transcription factors. It is also shown that Trib3 is transcriptionally regulated by the FoxO, JNK

and apoptotic cell-cycle pathways. The data further demonstrate that Trib3 functions in a feed-

forward loop with the FoxOs and deactivates Akt in a self-propelled pathway that amplifies the

apoptotic cascade resulting from NGF deprivation. Moreover, Trib3 is found to be induced and

necessary for neuron death in cellular models of Alzheimer’s and Parkinson’s diseases. The

latter preliminary findings have encouraged other researchers to begin exploring Trib3’s

mechanism and regulation in neurodegenerative disease models; this will advance our

knowledge and understanding of the cellular processes of neuron death and may lead to

development of novel therapeutic targets.

i

Table of Contents

Sections Page Number

Chapter 1: Background and Introduction 1

Developmental Cell Death 1

PCD in the Adult Brain 6

Neurotrophin Signaling and Neuron Survival 8

Akt, the Master Regulator 11

The Molecular Mechanisms of Neuron Death 15

The Bcl2/BH3 Proteins 18

DP5/HRK 18

Bim 19

EglN3/SM20/PHD3 20

The Mitochondrial Intrinsic Pathway 20

Caspase Activation 22

Apoptosis 24

Trib3 and the Tribbles Family 26

The Trib3 Protein 30

The NGF-Deprivation Model 37

Relevance of NGF Deprivation Models to Neurodegenerative Diseases 38

Rationale and Aims of the Thesis 39

Hypotheses and Findings 41

ii

Sections Page Number

Chapter 2: Results and Discussion 44

Introduction 44

Results 45

Discussion 82

Chapter 3: Neuron Death in the Trib3 KO Mouse SCG 91

Introduction 91

Hypothesis 93

Results 94

Discussion 97

Chapter 4: Preliminary Evidence that Trib3 is

Involved in Neurodegenerative Diseases 101

Introduction 101

Hypothesis 103

Results 103

Discussion 107

Chapter 5: Conclusions and Future Directions 109

Trib3’s Involvement in Developmental Death of SCG Neurons 109

Trib3 Deletion and its Effect in Developmental Death in vivo 112

iii

Trib3’s Potential Involvement in Neurodegenerative Diseases 113

Final Remarks 116

Chapter 6: Materials and Methods 117

References 123

Appendix 139

iv

Figures Page Number

Figure 1-1 Target size controls Neuron Population 5

Figure 1-2 Death by Neurotrophins 9

Figure 1-3 Akt Effectors 13

Figure 1-4 Activation of the Apoptotic Cell-Cycle Pathway 16

Figure 1-5 Bax Activation 21

Figure 1-6 Human Trib3 Splice Variants 29

Figure 1-7 Human Trib3 Promoter 30

Figure 2-1 Trib3 is Induced in Response to NGF Deprivation 46

Figure 2-2 shTrib3 Constructs Knock Down Trib3 50

Figure 2-3 Trib3 is Required for Neuronal Apoptosis Caused by NGF Withdrawal 52

Figure 2-4 Trib3 Overexpression is Sufficient to Promote Neuronal Apoptosis 55

Figure 2-5 Trib3 Contributes to Decrease in Akt Phosphorylation in PC12 Cells 59

Figure 2-6 Trib3 Contribute to Decrease in Akt Phosphorylation in SCG Neurons 61

Figure 2-7 Trib3 Expression is Sufficient to Reduce Akt Phosphorylation 63

Figure 2-8 Trib3 Contributes to FoxO1a Dephosphorylation in PC12 cells 66

Figure 2-9 Trib3 Contributes to Decrease in FoxO1a Phosphorylation in SCG Neurons 67

Figure 2-10 Trib3 Expression is Sufficient to Reduce Phosphorylation of FoxO1a 69

Figure 2-11 Trib3 Regulates FoxO1a Nuclear Translocation 72

Figure 2-12 Regulation of Trib3 Expression 76

Figure 2-13 Akt Inhibition Upregulates Trib3 mRNA 78

v

Figure 2-14 Inhibitors of JNK and Cdk4 Suppress Trib3 mRNA Induction 81

Figure 2-15 A Model of How Trib3 May Mediate Apoptosis in Sympathetic Neurons 88

Figure 3-1 Generation of Trib3-/- Mice 91

Figure 3-2 Trib3 Deletion Does not Affect Extent of Apoptosis 95

Figure 3-3 Multiple Kinases Phosphorylate Akt 98

Figure 4-1 Trib3 in Involved in Pathological Neuron Death 105

vi

Acknowledgements

I am grateful to my mentor Dr. Lloyd Greene for his guidance, support and the invaluable

training and inspiration he has provided, laying the foundations for my career as a scientist.

I would like to thank Dr. Subhas C. Biswas, a former member of the lab, for providing me with

advice and training in numerous experimental techniques.

I would like to express my gratitude to Dr. Jeanette Perron for teaching me how to prepare

lentiviral expression plasmids, tools that were very important for conducting my experiments.

I am thankful to my dear colleague Dr. Jin Liu for her generous gifts of cortical neuron cultures

on numerous occasions.

Finally, I am very grateful to all members of the Greene, Shelanski and Troy labs, past and

present, for their assistance and support.

vii

Dedication

I would like to dedicate this thesis to my mother, who has always been a source of strength and

endless love and one who has always given me her blessings in every aspect of my life.

To Zahit, an extraordinary human being and an equally wonderful friend, for his warmhearted

support throughout this journey.

To my friend Takaaki, a person of great inner strength and hope and one who has inspired me to

continue on with research in neuroscience.

1

Chapter 1

Background and Introduction

Developmental Cell Death

Cell proliferation and cell death are two very important events during animal

development. While it is readily discernible why cell proliferation is necessary as the organism

develops from a single fertilized egg, the role of cell death is counterintuitive. A small

percentage of dying cells may be expected as a result of epigenetic or developmental aberration;

however, the observed death of a massive number of cells, especially in the nervous system,

required further explanation, prompting many researchers to investigate this phenomenon. In

earlier times, cell death was perceived to be a passive phenomenon. Then a number of elegant

studies, using RNA and protein syntheses blocking drugs, revealed that de novo expression of

certain genes is required for this event [1]. This type of death is now known as programmed cell

death or PCD. The classic example of PCD is apoptosis; a process that is characterized by

specific biochemical and morphological features, such as a decrease in mitochondrial integrity

and membrane potential, exposure of the phospho-lipid phsophatidylserine to the outer side of

the plasma membrane (it is normally kept in the cytoplasmic side of the membrane by the

enzyme flippase), endonuclease degradation of DNA and chromatin condensation, and shrinking

of the cells to form apoptotic bodies that are removed by phagocytic macrophages [2]. This is

very distinct from necrosis, where the cells swell and burst, releasing their content into the

environment and adversely affecting neighboring cells via inflammation [2]. Other forms of

PCD include autophagic cell death that is characterized by autophagosomes, which are double-

2

membrane vesicles containing cytoplasmic organelles or degenerating cytosol that fuse with

lysosomes for subsequent degradation [2-4]. The newly emerging necroptosis is a form of

programmed necrosis that is induced by stimulating death receptors and that has its own unique

signaling pathway [5]. Since the focus of this thesis is confined to the process of apoptosis,

henceforth any mention of PCD will refer solely to this particular form of cell death.

The regression of massive number of cells is now acknowledged to be an integral part of

the normal developmental process. Whereas cell division is necessary for accumulation of

building blocks for various organs and organ systems, cell death is crucial for shaping and

sculpting of various organs and for tissue patterning. This is often referred to as morphogenetic

cell death [6]. Examples of such events include: formation of fingers and toes, invagination of

the epithelia as in the formation of the neural tube and evagination as in the formation of the

optic vesicle and fusing of structures to form the palate. Furthermore, apoptosis is effective in

deleting structures that are no longer needed [6]. During amphibian development, the tadpole

loses its tail and intestine on its way to becoming an adult. In humans, males initially harbor

mammary cells but later lose them due to testosterone exposure [6]. Apoptosis is also useful for

quality control, which involves the elimination of cells that may acquire errors after

differentiation or other harmful characteristics. An example of this is the removal of

lymphocytes that produce self-reactive receptors [6]. Molecules such as BMPs, Wnts, Shh,

FGFs and Notch regulate differentiation at various stages and are also responsible for regulating

early PCD [7]. For example, in Drosophila wing disc, disruption of Dpp and Wg gradients

causes discontinuities within the smooth gradients that are then corrected by triggering PCD via

both cell-autonomous and cell non-autonomous JNK pathway, removing the disrupting cells [7].

3

Also in Drosophila, borders between populations of different cell types are at risk for signaling

conflict and ambiguity in identity and PCD is used to eliminate cells to sharpen and refine

borders of segments. Hox proteins function downstream of morphogens and have been shown to

regulate PCD in segment borders of Drosophila and Xenopus [7].

Though apoptosis is apparent in all organ systems during development, this phenomenon

is quite pronounced in shaping of the nervous system [8]. During the formation of the nervous

system, cells undergo a series of steps, which include induction, proliferation, migration,

restriction and determination, axonal path-finding and synapse formation [9]. PCD during early

neural development within proliferating neural precursor cells or newly formed postmitotic cells

is important for normal development of the CNS and PNS and this is distinct from late stage

PCD that is related to axon guidance and limitations in trophic factor availability [9, 10]. A

primary function of early death is curbing precursor cell populations and affecting the size and

morphology of the resulting neuronal structures [9]. In the Drosophila embryo, the first PCD

occurs within the neural population in the head region at stage 11 [7]. In vertebrates, such as

Xenopus, apoptosis is observed within the anterior regions of the neuroectoderm at late

gastrulation and in zebrafish, first patterned PCD is within neural cells and occurs at 12 hours

after fertilization [7]. In higher vertebrates, the quantity of neuron loss ranges from 15 percent of

the initial neuron population of the auditory relay nuclei to about 85 percent in the

mesencephalic nucleus of the trigeminal nerve of the avian brain [9]. In chicks, the first sign

of PCD is seen in the anterior neural plate, which becomes the brain shortly after gastrulation;

PCD continues on in the dorsal plate (neural crest cells) and floor plate (glia) cells [7]. In mice,

apoptosis is evident during gastrulation starting at about E6.5 [7]. Virtually all neuron and glial

4

populations of the spinal cord, sensory ganglia, autonomic ganglia, the retina, brainstem,

thalamus, cerebellum and cortex undergo PCD [9].

Any interruption in the apoptotic process can have dire consequences. Mutant mice

deficient in proper regulatory mechanisms for apoptosis exhibit morphological deformities in the

CNS. For example, in mice null for Apaf-1, a factor necessary for caspase-3 activation, none of

the homozygous embryos survive beyond E16.5 [11]. They develop severe deformities in

craniofacial structure, such as rostral exencephaly, an absence of skull vault and facial midline

and palate cleft; this was also accompanied by interdigital webbing in their paws [11].

Moreover, knockout of caspase-3, the protein necessary for the execution of the final stages of

apoptosis also results in gross abnormalities in brain formation in mice, where the brain matter

simply protrudes out of the skull [12]. In Xenopus embryos, overexpression of the anti-

apoptotic protein Bcl-2 prolongs neurogenesis and delays axonogenesis [7].

Late stage PCD functions in error correction, selective removal of neurons that have

either migrated to an ectopic position, have axons going astray during path-finding, or have

innervated the wrong target [9, 13]. Because synaptic connections must be specific, especially

where spatial topographic mapping must be precise, the nervous system depends on PCD to fine-

tune the connectivity. The discovery of the first neurotrophin, nerve growth factor (NGF) by

Rita Levi-Montalcini aided in formulating the neurotrophic hypothesis [13]. Originally the

hypothesis stated that neurons are produced in excess and must compete for a limited supply of

trophic support to innervate their targets, providing sufficient target innervation while those that

lose this competition are eliminated by PCD [13, 14]. Now the hypothesis has been modified to

include trophic support from afferent inputs and other cellular partners such as glia [9, 13, 14].

5

Trophic agents from glia and extracellular matrix and local cell-cell interactions between neurons

and non-neuronal cells play a role in promoting the survival of developing neurons. A

quantitative system matching is said to be the primary role for post mitotic PCD during

synaptogenesis in the vertebrate nervous system, where the number of surviving neurons

correlates directly to their target tissue size (Fig. 1-1) [8, 9, 13, 14].

This has been demonstrated by experiments in which complete or partial deletion of targets

resulted in a significant increase in apoptosis of innervating neurons. Conversely experiments,

where target availability had been increased, resulted in a dramatic increase in the number of

surviving neurons [8, 13]. For example, a reduction of afferent input to neurons resulted in a

significant increase in neuronal death in the cochlear nuclei of the chick and mouse and in the

spinal motoneurons of the chick [8, 13]. In the PNS, Viktor Hamburger demonstrated the

importance of NGF for the survival of DRG (dorsal root ganglia) neurons when he administered

daily injections of NGF to developing chicks, which resulted in a 40% decrease in death in their

brachial and thoracic DRG populations compared to their untreated counterparts [15]. Target or

Target Size Controls Neuron Population. Major features of naturally occurring neuronal death during development. In most regions about 50 percent of the neurons that are initially generated die at about the time the population as a whole begins to form connections within its target field.

Cowan et al. 1984

Figure 1-1

6

afferent derived support is important in the CNS, as well. The dopaminergic neurons of the

SNpc (substantia nigra pars compacta) of the midbrain, for example, undergo naturally occurring

cell death around the time of birth starting at E20 [16]. PCD in these neurons is biphasic in that

it occurs again at age P12 until about P16 [16]. During the first phase of PCD, these neurons

rely, at least in part, on a limited supply of GDNF (glial-cell-line-derived neurotrophic factor)

from the striatum for their survival [16]. Although it has been difficult to determine the exact

magnitude of apoptotic dopaminergic neurons during the second phase and the PCD controlling

factors, these neurons seem to rely on their striatal target for survival during this period [16].

Moreover, in vitro studies have revealed that embryonic mesencephalic DA (dopamine) neurons

form an appropriate number of axons only in the presence of appropriate target tissue, and that

the viability and differentiation of these neurons increased when they had soluble factors purified

from the striatum in the culture medium or when they were co-cultured with the striatum [16].

PCD in the Adult Brain

Neurogenesis is not limited to the developing nervous system. In humans, neurogenesis

continues to occur in the dentate gyrus (DG) of the hippocampus, which is critical for enhancing

neuronal plasticity in learning and memory formation and possibly holds regenerative capacity

following injury [17, 18]. In the DG of adult rats, approximately 10,000 cells are generated daily

and 60 to 80 percent die within 1 month after their production [19]. What is more is that many

of these become granule cell neurons, extend axons into CA3 region and express robust LTP

before dying, indicating that the new cells function as neurons and may be engaging in

competition to survive just as neurons do in the developing brain [19]. Their survival is also

dependent on the environment; hippocampal learning tasks, larger cages with more rats and

7

novel objects dramatically decrease the number of apoptotic newborn neurons [19].

Furthermore, it appears that the molecular mechanism responsible for apoptotic death during

development, which will be discussed shortly, is also conserved in adult neurons undergoing

apoptosis. For example, the BH3-multi domain protein Bax is a necessary proapoptotic factor in

developing neurons and research has shown that adult neurodegeneration of the newly formed

neurons in DG is greatly reduced in Bax knockout mice [20].

Neural loss can also result when PCD proceeds improperly due to inappropriate trophic

factor signaling or errors in the molecular mechanisms that regulate cell survival and death,

leading to deficits in the functional capabilities of the brain as seen in various neurodegenerative

diseases, such as Alzheimer’s disease (AD) and Parkinson’s disease [13]. Neurotrophins play an

important role in maintaining survival in the adult brain. For example, NGF maintains and

regulates the cholinergic phenotype of basal forebrain neurons through the retrograde transport

of the NGF/TrkA receptor complex from the cortex and hippocampus, where NGF is produced

[21]. Furthermore, NGF has been found to protect cholinergic neurons following age-related

atrophy and experimental surgical lesions and plays a role in improving memory in aged rodents

(Williams 1986) [22]. Other neurotrophins such as BDNF (brain derived neurotrophic factor),

NT-3 (neurotrophin), NT-4 and CNTF (ciliary neurotrophic factor) were found to be effective in

rescuing axotomized facial and sciatic nerves [23]. NGF deprivation has been shown to result

in loss of cholinergic basal forebrain neurons in patients with Alzheimer’s disease [21, 24] and a

recent publication reported that the level of NGF is reduced in plasma of patients with

Huntington’s disease [25]. In AD brains, NGF levels are reduced in the basal forebrain;

transgenic mice (AD11) with NGF neutralizing antibody exhibit progressive neurodegeneration

8

that resembles many features of AD, including redistribution of phosphorylated tau and

accumulation of β-amyloid [21]. NGF has been used for therapeutic purposes in AD patients in

order to reduce neuron loss; however, since NGF cannot cross the blood brain barrier, it was

injected directly into brain parenchyma and this resulted in a rescue of the cholinergic deficit and

decreased levels of hyperphosphorylated tau and beta amyloid, rescuing object recognition

deficits, as well [21].

Neurotrophin Signaling and Neuron Survival

Neurotrophins are a family of secreted growth factors that are important for cell

proliferation, survival and differentiation. The family includes nerve growth factor (NGF),

brain-derived neurotrophic factor (BDNF), neurotophin-3 (NT3) and neurotrophin-4/5 (NT4/5)

[26]. Their signaling is mediated via two types of receptors: the Trk family of tyrosine kinase

receptors and the p75 receptor. The p75 receptor belongs to the tumor necrosis factor family

[26]. NGF binds to TrkA, BDNF and NT-4/5 bind to TrkB, and NT3 binds to TrkC with high

affinity and can also bind to TrkA and B, but with lower affinity [27]. NGF binds to TrkA,

promoting survival and neurite outgrowth [23, 26]. The story of the p75NTR is more complex.

Initially, it was thought that NGF binding to either TrkA or p75NTR promoted survival, but later

the theory was modified to what is known as the “dependence receptor paradigm” when it was

observed that unoccupied p75NTR induced apoptosis and NGF binding to p75NTR blocked this

apoptosis [14]. However, subsequent research findings revealed that NGF acts as a pro-

apoptotic ligand of p75NTR in a variety of cells, including neurons, but promotes survival when

bound to both TrkA and p75NTR [14, 28]. Later it was discovered that the precursor of NGF,

proNGF, binds to the p75NTR [14]. A second receptor for proNGF is sortilin, which can bind

9

proNGF along with p75NTR and induce apoptosis (Fig. 1-2) [29]. p75NTR signaling leads to an

increase in JNK (c-Jun N-terminal kinase), PTEN and ceramide levels and induces apoptosis

after injury, stress or inflammation.

NGF is a highly conserved protein first identified in mouse sarcoma tissues by Rita Levi-

Montalcini [30, 31]. In the PNS, NGF acts on sympathetic neurons and sensory neurons

involved in nociception and temperature sensation; in these neurons NGF stimulates neurite

outgrowth, hypertrophy, and synthesis of enzymes involved in neurotransmitter production,

supporting overall survival [23, 30]. In the CNS, NGF is necessary for survival and functioning

of cholinergic neurons in the basal forebrain [23]. NGF is first produced as proNGF molecules

with 241 amino acids that are cleaved by convertases such as furin and convertases 1 and 2,

resulting in formation of 13kDa mature NGF, which is also referred to as βNGF or 2.5S NGF

[23, 32]. The mature form exists as non-covalently bound homodimer [23, 32]. NGF signaling

takes place in two ways: locally and retrogradely from distal axons [28, 33]. A local source of

NGF will induce axon growth whereas NGF derived from distal axons alone is sufficient to

Death by Neurotrophins.

Ichim et al. 2012

Figure 1-2

10

retrogradely support neuronal survival [28, 33]. During local signaling, the NGF homodimer

selectively binds to its receptor, TrkA, with a dissociation constant (kd) of 10-11 [23]. This causes

TrkA to dimerize and autophosphorylate at several tyrosine residues in the receptor’s

cytoplasmic domain [27]. The signal is transduced by a number of cytoplasmic molecules,

including the GTP-binding protein Ras, signaling molecules phospholipase-Cγ, phosphatidyl

inositol-3’ kinase and the adaptor protein Shc, which help to trigger kinase cascades that lead to

activation of transcription factors and a variety of cellular events that ensure viability, growth,

differentiation and injury repair [27, 34]. Ras in most cases is responsible for promoting 40 to 60

percent of neurotrophin-dependent survival and it does so by propagating the NGF signaling via

the PI3K/Akt and the MEK/ERK pathways [34-36]. The PI3K/Akt pathway has been shown to

be responsible for propagating 80 percent of survival in neurons and neurite outgrowth to some

extent; the MEK/ERK pathway is largely responsible for neurite outgrowth, but can also promote

survival [36, 37]. PI3K can be activated by the adaptor protein Gab-1, as well [36].

In retrograde signaling, the NGF-TrkA complex is endocytosed and forms an organelle

known as the signaling endosome, which is then carried to the cell body [38]. An alternate view

is the wave theory, which states that NGF binds to TrkA at the distal axon and causes a rapid

phosphorylation across the axonal membrane all the way to the cell body [33, 38]. The

retrograde signaling may consist of a combination of both types and results in the activation of

downstream effector molecules and kinases as described above [33, 38]. The developing

sympathetic neurons from the superior cervical ganglia rely exclusively on retrograde NGF

signaling from the their target organs, among which is the submandibular gland [39].

11

Akt, the Master Regulator

Akt is the vertebrate homologue of the viral oncogene v-Akt from the transforming

retrovirus AKT8 that was isolated from an AK mouse T-cell lymphoma [40]. The Akt, also

known as PKB (protein kinase B), family closely resembles the protein kinase A (PKA) and

protein kinase C (PKC) families. There are three closely related Akt forms in mammalian cells:

Akt1/PKBα, Akt2/PKBβ, and Akt3/PKBγ [41, 42]. Akt1 is expressed ubiquitously except for

the kidneys, liver and spleen; Akt2 is highly expressed in muscle, intestinal and reproductive

tissue and Akt3 is expressed the highest in the brain and testis [40]. The three Akt isoforms

behave very similarly in that they become activated and phosphorylate their substrates with equal

efficacy; therefore they are often perceived as being functionally redundant [40, 41]. The Akt

molecule contains an N-terminal pleckstrin homology (PH) domain that enables Akt to associate

with the plasma membrane, a central kinase domain and a carboxyl-terminal regulatory domain

that contains a hydrophobic motif (HM) [40-42]. As a homologue of a viral oncogene, Akt

activity usually leads to suppression of apoptosis and differentiation and to increased cell-cycle

progression [40]. Various trophic factors can activate Akt, such as platelet-derived growth factor

receptor (PDGF), insulin, epidermal growth factor (EGF), basic fibroblast growth factor,

neurotrophins and insulin-like growth factor (IGF-I), and neurotrophins such as the likes of NGF

and BDNF [43-46]. When growth factors bind to their respective receptors, PI3K

(phosphoinositide-3 kinase) is activated and phosphorylates PIP2 (phophatidylinositol 3,4,5

trisphosphate (PtdIns(3,4,5)P2) at the 3’ position on its inositol ring and converts PIP2 to PIP3 at

the plasma membrane [41, 42, 47]. PIP3 in turn recruits Akt and 3-phosphoinositide-dpendent

kinase 1 (PDK1) by binding to their PH domains and this is the rate limiting step of the entire

12

process [40, 42]. A class III histone deacetylase (HDAC) named SIRT1 has been shown to

deacetylate a lysine residue in Akt’s PH domain, promoting its interaction with PIP3 and PDK1

[48]. The final step of a multistep activation process is the phosphorylation of Akt on two

residues: Thr308 and Ser473 [49]. The Thr308 site of Akt lies in its catalytic domain and is

phosphorylated by PDK1, which enhances its activity over 30-fold. The Ser473 site, lying in its

carboxy-terminal hydrophobic motif is phosphorylated by the mTORC2 complex, which

contains mTOR, GβL and rictor and is known as PDK2 [41, 50, 51]. The phosphorylation of

Ser473 seems to be a prerequisite for Thr308 phosphorylation (Scheid 2002, Sarbassov 2005)

[49, 51]. The phosphorylation of these two sites is important for Akt function in that

phosphorylated Thr308 determines Akt activity and phosphorylated Ser473 gives Akt its

substrate specificity [52]. Phospho-mimetic Akt mutants (T308D/S473D) exhibit constitutive

kinase activation and alanine mutants (T308A/S473A) show little activity even after growth

factor stimulation Akt [43]. In addition to these sites, phosphorylation at Ser124 and Thr450

serves as the first step to full activation of Akt [43].

The activated Akt can positively or negatively affect the functions of its substrates, alter

their subcellular localization or modify their protein stabilities and regulate a wide variety of

cellular processes (Fig. 1-3) [42]. Akt influences metabolism via phosphorylation of glycogen

synthase kinase 3β (GSK3β), which regulates glycogen synthesis [42, 47]. Cell cycle progression

and proliferation is controlled by Akt as it directly targets CDKIs p21WAF1/CIP1 and p27KIP1 and

indirectly modulates cyclin D1 and p53 levels [40, 42]. Moreover, Akt regulates protein

synthesis via tuberous sclerosis complexes 1 and 2 (TSC1/2), mTOR, elongation-initiation factor

4E-BP1 (4E binding protein-1) and S6K, etc. [42, 43].

13

Of particular interest to this thesis work and as mentioned earlier is Akt’s ability to

suppress apoptosis and promote cell survival. The PI3K/Akt pathway has been found to be

sufficient and sometimes necessary for neuron survival under various stressful conditions [53].

In experiments where activated forms of Akt were constitutively expressed in sympathetic

neurons, they survived even when NGF was removed [54]. Furthermore, in neurodegenerative

diseases, a decrease in Akt phosphorylation and activation has been linked to neuron death [55].

Akt accomplishes this by modulating the behavior and levels of various apoptotic and anti-

apoptotic factors in the cell, such as BAD, forkhead box O transcription factors (FoxOs), Bim,

apoptosis signal-regulating kinase 1 (Ask 1), caspase 9, FasL, inhibitor of nuclear factor-κB

kinase (IKK-NFκB), etc [43, 56]. BAD for example is a proapoptotic Bcl-2 family member and

BAD acts by sequestering Bcl-xL, a pro-survival Bcl-2 protein, and indirectly helps to release

cytochrome c from mitochondria [40, 57]. Akt blocks the activity of BAD by phosphorylating it

at Ser136, which creates a binding motif for the chaperone molecule 14-3-3 and the interaction

between BAD and 14-3-3 neutralizes BAD [57]. Other ways Akt can block apoptosis is by

Figure 1-3

Akt Effectors

Hers et al. 2011

14

phosphorylating IAPs (inhibitor of apoptosis proteins) and enhancing their pro-survival

activities, which include neutralization of caspases; Akt can also phosphorylate Apaf1 and

reduce its pro-apoptotic function [40]. Furthermore, Akt blocks the activation of transcriptional

pathways that become activated in neurons deprived of NGF and prevents these pathways from

inducing downstream pro-apoptotic genes. These include the JNK, cell cycle and FoxO

pathways, which will be discussed in detail shortly etc. [40, 43, 56, 58]

A number of factors can regulate Akt activity either positively or negatively by

interacting directly with Akt; these include oncogenes T-cell leukemia (Tcl1) family members,

JNK interacting protein 1 (JIP1), growth factor receptor-binding protein-10 (Grb10), Ras

GTPase-activation protein (RasGAP), Hsp90/Cdc37 molecular chaperone complex, a tribbles

homologue 3 (TRB3), adaptor protein containing PH domain, PTB domain and leucine-zipper

motif (APPL), C-terminal modulator protein (CTMP), Akt phosphorylation enhancer or hook-

related protein-1 (APE), SH3 domain containing protein Src and Arg-binding protein 2γ, breast

tumor kinase (Btk), prohibin 2(PHB2) and pleckstrin homology-like domain, family A, member

3 (PHLDA2) [40, 43, 59]. During stress and injury or natural apoptotic death, Akt is

antagonized in a number of ways. For example, proNGF binding to p75NTR leads to apoptosis

and this event occurs naturally during late stages of neurodevelopment in order to prune and fine

tune synaptic connectivity. Activation of p75NTR increases intracellular ceramide

concentrations, which activates protein phosphatase 2A (PP2A) [60, 61]. Akt is a substrate of

protein PP2A, which preferentially dephosphorylates Akt on the Thr308 site, but can also

dephosphorylate the Ser473 site, leading to complete inactivation of Akt and deregulation of its

downstream substrates [60]. In basal forebrain neurons, proNGF binding to p75NTR results in

15

induction of PTEN (phosphatase and tensin homolog deleted on chromosome 10), which is a

dual lipid/protein phosphatase that dephosphorylates PIP3 and antagonizes Akt activation by

PI3K [62]. As will be seen in this thesis, induction of the protein Trib3 also participates in

regulation of Akt activity during neuronal cell death.

The Molecular Mechanisms of Neuron Death

As already mentioned, Akt regulates neuron survival by phosphorylating numerous

substrates. One group of such substrates, belongs to the forkhead family of transcription factors

and includes FKHR (FoxO1a), FKHRL1 (FoxO3a) and AFX (FoxO4) [56, 58]. They are

phosphorylated by Akt, which causes them to be bound to 14-3-3 proteins and retained in the

cytoplasm [58]. When NGF or other survival factors are removed, Akt is inactivated and the

FoxOs become dephosphorylated and free to translocate to the nucleus; there they can

transactivate their target genes, such as Bim and Fas ligand that can trigger apoptosis [56, 58, 63,

64]. FoxOs are powerful tumor suppressors; they were found to inhibit tumor growth both in

vitro and in vivo in breast cancer, leukemia, prostate cancer and glioblastoma, although genetic

inactivation of the FoxOs is rare [56]. Activation of FoxO3a has been show to induce the pro-

apoptotic BH3 only proteins Bim and PUMA in response to cytokine or growth factor

deprivation [56, 58, 63, 64].

In addition to the FoxOs, other transcriptional pathways become activated in response to

NGF withdrawal. This includes the cell-cycle, JNK, NF-Y and p53/p63/p73 pathways and this is

in accordance with the observation that de novo transcription of genes is required for apoptosis to

commence after removal of NGF [65-68]. As neural precursor cells exit cell cycle and

16

differentiate, levels of CDK4 drop significantly and remain low in the post-mitotic neuron and

the CDK4/cyclinD1 complex is kept inactivated by CDK inhibitors, such as p16(INK4a) [69].

Trophic factor withdrawal results in the upregulation of Sertad1, which binds to CDK4/cyclinD1

complex, rendering it impervious to p16 (INK4a); this ultimately results in an increases in CDK4

activity [70, 71]. The substrates of CDK4 include Rb pocket proteins, such as Rb, p107 and

p130, which bind to E2F transcription factors along with chromatin modifiers, such as Suv39H1

and histone deacetylase, forming a DNA bound transcription-silencing complex [69]. The figure

below (Fig. 1-4) shows that when CDK4 becomes activated as a result of NGF withdrawal, it

hyperphosphorylates these pocket proteins, dissociating the complex and de-repressing E2F-

repressed genes, B- and C- mybs [69, 72]. B- and C-mybs are also transcription factors that are

among the genes that are de-repressed following NGF withdrawal and CDK4 activation and

these transactivate pro-apoptotic molecules, such as Bim [69, 73, 74].

An additional known transcription pathway activated during NGF deprivation is the JNK

pathway. JNKs (c-Jun N-terminal kinases) are phosphorylated and activated in response to a

Figure 1-4

Activation of the apoptotic cell-cycle pathway.

Greene et al. 2004

17

variety of apoptotic stimuli, including DNA damage, heat shock, ischemia-reperfusion, oxidative

stress, axonal injury and loss of trophic support [65, 75]. It is not fully understood how the

activation is initiated, but research findings so far indicate that a combination of TrkA receptor

inactivation and proNGF mediated p75NTR activity can activate this pathway [65]. Rho GTPase

family members Rac1 and Cdc42 lead to activation of mixed lineage kinases (MLKs) and they

phosphorylate and activate mitogen-activated protein kinase kinases 4 and 7 (MKK4 and MKK7)

[76]. These kinases in turn activate JNK, which then phosphorylates c-Jun at Ser63 and activates

it [76]. Two scaffolding proteins, POSH (plenty of SH) and JIP (JNK interacting protein)

interact with the above mentioned molecules to form a multi-protein complex (Kukekov 2006)

[77]. c-Jun has also been shown to bind to the promoter regions of Bim and HRK/Dp5 and

activate them [78, 79]. The peptidyl-prolyl isomerase Pin1 catalyzes cis-trans isomerization of

the proline residue in phosphorylated Ser/Thr-Pro motifs in mitogen-activated protein kinase

substrates, such as c-Jun [80]. Pin1 acts as a transcriptional coactivator as JNK phosphorylation

of c-Jun promotes Pin1 and c-Jun interaction, enhancing c-Jun’s transcriptional activities [80].

Yet another pathway activated during NGF deprivation involves NF-Y. The transcription

factor NF-Y is present at a constant level, bound to its target DNA region, an inverted CCAAT

box (ICB), both during NGF signaling and under stress [68]. Upon NGF withdrawal, NF-Y

requires interactions with coactivators CBP and P300 to transactivate Bim [68]. During various

stresses, CBP and p300 can also bind to c-Jun, FoxO and Myb and enhance their transcriptional

activities [68].

A more recently emerging neuronal apoptotic pathway includes p53, p63 and p73

proteins. The tumor suppressor p53 is a transcription factor and promotes apoptosis by inducing

18

proapoptotic molecules involved in the mitochondrial intrinsic pathway, which include Puma,

NOXA (BH3-only), Bax, Apaf-1 and Perp [66, 81]. A related protein p63 also plays a role in

NGF deprivation-related apoptosis by inducing some of the genes controlled by p53; knocking

out either p53 or p63 confers partial protection from NGF-deprivation in sympathetic neurons

[81]. p73 is a pro-survival protein that partially antagonizes p53 and knocking out p73 induces

apoptosis [66, 81].

The Bcl2/BH3 Proteins

Once the necessary transcriptional pathways are activated in response to NGF

deprivation, downstream pro-apoptotic genes are transcribed and translated, initiating the

mitochondrial intrinsic apoptotic pathway. Many of the pro-apoptotic genes that are induced

belong to the Bcl2 family with conserved BH3 domains; their products are the gatekeepers and

key players of the intrinsic pathway [82]. There are three classes: the BH3-multidomain anti-

apoptotic proteins, such as Bcl2, BclxL, Mcl-1 and A1 that inhibit mitochondrial cytochrome c

release and apoptosis; the BH3-only pro-apoptotic Bim, DP5/Hrk, PUMA, Noxa, Bad, Bik and

Bmf; and the BH3-multidomain Bax and Bak that cause cytochrome c release [82-87].

Two Well-Known BH3-only Proteins Involved In Death Caused By NGF Deprivation

DP5/HRK

DP5 is the rodent orthologue of human Harakiri (Hrk) gene and was the first BH3-only

protein to have been found to be upregulated in response to NGF deprivation in sympathetic

neurons and in neuronal PC12 cells [88]. The JNK pathway is responsible for transcriptionally

19

regulating DP5 under stress and the Dp5 promoter region contains a binding site for c-Jun and

ATF2 transcription factors [78]. DP5 is thought to neutralize Bcl2 and BclxL, allowing

mitochondrial outer membrane permeabilization by Bax and Bak [82]. SCG neurons from Dp5

or Bim knockdown animals are partially protected from NGF withdrawal related death and SCG

neurons from either Dp5 or Bim knockout mice die somewhat slowly in the absence of NGF [85,

88] .

Bim

BH3-only Bim mRNA levels are upregulated in response to NGF deprivation and the

promoter region of Bim contains binding sites for transcription factors associated with the FoxO,

JNK, apoptotic cell-cycle and NF-Y pathways [63, 64, 68, 74, 79, 89]. Three major isoforms of

Bim protein are BimEL, BimL and BimS. BimEL, BimL contain a region that allows them to bind

to the LC8 (dynein light chain 1), a component of the dynein motor complex associated with the

microtubule cytoskeleton. BimEL is the major isoform of Bim found in sympathetic neurons,

cerebellar granule neurons (CGNs) and dorsal root ganglion (DRG) neurons [79, 85].

Overexpressing Bim in sympathetic neurons increased the level of cytochrome c in the

cytoplasm and the number of pyknotic nuclei [79]. Sympathetic neurons and CGNs from Bim

knockout mice were partially protected from apoptosis after NGF deprivation and K+

withdrawal, respectively [85]. The activation of the MLK/JNK/c-Jun pathway not only regulates

Bim transcriptionally, but also modifies Bim post-translationally in that JNK phosphorylates

BimEL and BimL at the Ser65 residue [90] and this process seems necessary in mediating

apoptosis in response to trophic factor deprivation and that arising from p75NTR activation [91].

Conversely, NGF inhibits Bim activity via the MEK/ERK pathway, which phosphorylates BimEL

20

and BimL, resulting in its ubiquitination and degradation [92, 93]. As noted above SCG neurons

from Bim knockdown animals are partially protected from NGF withdrawal related death and

SCG neurons from Bim knockout mice die somewhat slowly in the absence of NGF [85] .

EglN3/SM20/PHD3, a Pro-apoptotic Protein that is not a Bcl2 Family Member

The prolyl hydroxylase SM20 is closely related to C. elegans Egl9 protein, which has a role in

inhibiting the egg laying process; in mammals, it is thought to be a mitochondrial protein, whose

mRNA levels are upregulated in NGF-deprived SCG neurons [94]. SM20 is transcriptionally

regulated by the JNK pathway and results in caspase-3-dependent apoptosis and appears to

increase the level of cytochrome c in both cytoplasm and mitochondria [95, 96]. The SM20-/-

mice displayed extra neurons in their superior cervical ganglia and underwent apoptosis at a

slower rate with no apparent effects on their sensory neuron population [97].

The Mitochondrial Intrinsic Pathway

Until recently the view on how Bcl2 proteins interacted with each other to promote

apoptosis has been as the following. In a healthy neuron the BH3-multidomain Bax and Bak are

retained in the cytoplasm through their interaction with the Bcl2, BclxL, Mcl-1 and A1 proteins

[82]. Upon NGF deprivation, the BH3-only pro-apoptotic proteins are upregulated by the

transcriptional pathways described earlier and they bind and neutralize the anti-apoptotic

proteins, freeing Bax and Bak to translocate to the mitochondria [98]. There they form homo-

oligomers and insert into the outer membrane of the mitochondria, forming channels through

which cytochrome c escapes into the cytoplasm [98]. This constitutes what is known as the

21

“displacement” model and is supported by a high resolution visualization of interactions between

the BH3 fragment of Bim and BclxL (Fig. 1-5) [98].

Willis et al. 2005

Since Bax and Bak are structurally similar to the anti-apoptotic proteins Bcl2 and BclxL, it was

tested whether or not Bim can also bind Bax; an artificially induced helix form of Bim (aka

Stapled Bim) was found to bind Bax in vitro [99]. Thus, a second model of “direct binding”

emerged, which stated that the pro-apoptotic BH3-only proteins comprised both “sensitizers” and

“activators” (Fig. 4) [98]. According to this model, the sensitizers such as Bad or Bik bound to

Bcl2 and BclxL, thereby displacing them from Bax and Bak and the “activators” bound to Bax and

Bak, triggering their oligomerization and mitochondrial localization [98]. Recently, Bim,

PUMA and tBid (truncated Bid) were found to contain OMM (outer mitochondrial membrane)

targeting sequences in their C-terminal portion, enabling them to bind to the OMM [100]. The

C-terminal ends of these proteins were also shown to interact with extra-mitochondrial Bax and

Figure 1-5

Bax Activation

Willis et al. 2005

22

to result in cytochrome c release [100]. In Bax null mice, developmental death is delayed, which

resulted in superfluous facial motor neurons and superior cervical ganglionic sympathetic

neurons [101]. In culture, the Bax-/- sympathetic neurons survived without NGF for up to 23

days, displaying reduced numbers of processes and small soma [101].

Caspase Activation

Regardless of the actual methods by which Bax is activated and the integrity of the OMM

is compromised, cytochrome c release is a key event that precipitates caspase activation and

execution of the final apoptotic steps [82, 98, 100, 102]. In the cytoplasm, cytochrome c forms a

complex called the apoptosome by binding to Apaf-1 (C. elegans ced-4), caspase-9 and dATP,

which then activates effector caspases [102]. Caspases are mammalian orthologs of the C.

elegans ced-3 gene and are related to mammalian interleukin-1β-converting enzyme (ICE) [103].

The name is a contraction of cysteine-dependent aspartate-specific protease [104]. In healthy

neurons, they exist as inactive zymogens or proenzymes with three domains: an N-terminal

domain, and a large and a small subunit. Mammals have two distinct caspase subfamilies: one

that processes proinflammatory cytokines and the other group is required for apoptosis; in the

latter group there are initiator caspases that recruit various cofactors and lead to the activation of

effector caspases that execute the final apoptotic response during cell death [103, 104]. Initiator

caspase 9 contains a CARD (caspase recruitment domain), which is also present in Apaf-1 and is

necessary for their interaction with each other [103]. The apoptosome binds about 5 to 7

procaspase-9 molecules and this interaction possibly leads to a conformational change in the

procaspases-9, bringing its catalytic domain closer to the apoptosome [105]. The active

apoptosome recruites effector procaspase-3 or -7 and leads to their activation via proteolytic

23

cleavage; these effector caspases are necessary for the final execution of the apoptotic process

[105, 106]. The importance of caspase-9 function is demonstrated by the observation that

caspase-9-/- mice do not survive and have gross malformations of the brain [107]. In these mice,

the deletion of caspase-9 leads to markedly reduced levels of active caspase-3 and apoptosis in

the developing brain, resulting in the brain protruding out of the skull; the phenotypes of such

mice were remarkably similar to caspase-3 null mice described earlier [12].

NGF deprivation-related apoptosis is depended on the activation of caspase-2; however

the position of this protein in the canonical caspase activation pathway is not clear and has been

proposed to function as both an activator and an effector caspase [108, 109]. Whereas caspase-2

knockdown protected WT sympathetic neurons from NGF deprivation-related death, caspase-2

null neurons continued to undergo apoptosis as in the WT neurons; this was accomplished by a

compensatory mechanism in which the caspase-9 pathway became activated [109]. Also in these

neurons, the levels of caspase-9 and IAP inhibiting protein DIABLO are increased and knocking

down caspape-9, DIABLO or Apaf-1 conferred protection from death [109]. These findings

suggest that in WT sympathetic neurons, caspase-2 is dominant while the caspase-9 pathway is

neutralized by IAPs (inhibitor of apoptosis) [109]. Caspase-2 does contain a CARD and has

been shown to bind to the death adaptor protein RAIDD; however, it is not clear how caspase-2

becomes activated as a result of NGF deprivation and BH3-protein activity [110]. Furthermore,

since cytochrome c release is necessary in sympathetic neurons in order to trigger apoptosis, it is

theorized that caspase-2 lies upstream of the mitochondrial intrinsic pathway or that it normally

resides in the mitochondria and then escapes into the cytoplasm along with cytochrome c [109].

24

In conditions of heat-shock and ER stress, caspase-2 has been found to cleave Bid though the

significance of this finding is not clearly understood [110].

Apoptosis

Activated effector caspases, such as caspase-3, induce cell death by degrading their

substrates, which include proteins involved in DNA metabolism, maintaining cytoskeletal

scaffolds, cell-cycle regulation, signal transduction, etc. [111, 112]. During apoptosis, nuclear

DNA is condensed and degraded into small fragments roughly 180bp long and multiples thereof;

this is carried out by the endonuclease CAD (caspase activated DNAse) [111]. This commits the

cells to death and also destroys any viruses and prevents harmful mutations from propagating

any further inside the organism. There is a caspase-regulated DNAse complex known as DFF

(DNA fragmentation factor) that is composed of CAD and its inhibitor ICAD; in healthy cells,

ICAD binds to CAD and keeps it inactive [111]. Effector caspases degrade ICAD, freeing CAD

to engage in DNA fragmentation [111]. A protein named acinus is activated by caspase 3 and

induces chromatin condensation. The cytoskeleton of the apoptotic cell also undergoes drastic

changes; the nucleus fragments, the cell body shrinks and the cell becomes detached from

surrounding cells and basal membranes as a result of cytoskeletal protein cleavage by caspases

[112]. Caspase-6 degrades lamins, the intermediate filament scaffold proteins of the nuclear

envelope, causing nuclear fragmentation or pyknosis [111]. Caspase-3 cleaves and constitutively

activates an F actin-depolymerizing enzyme called gelsolin; in some cells, actin itself is cleaved

by effector caspases [111]. The serine/threonine kinase PAK is also cleaved by caspase-3 to

generate a constitutively active kinase necessary for the formation of apoptotic bodies, which are

25

small membrane-bound vesicles containing condensed cytoplasmic material from fragmented

apoptotic cells [111].

Interestingly, effector caspases increase Cdk activity in the cell by degrading Cdk

inhibitors. The functions of Cdks during apoptosis are unclear, but their activity appears to be

required for DNA condensation and cell body shrinkage, functions that are quite distinct from

their normal tasks during mitosis [111]. Effector caspases also target enzymes responsible for

repair and housekeeping in the neuron. PARP (Poly (ADP-ribose) polymerase) is found in the

nucleus, where it detects DNA nicks and catalyzes the ADP-ribosylation of histones and other

nuclear proteins, facilitating DNA repair [111]. Caspase-3 cleaves PARP, a process necessary

for shutting down energy expensive repair processes in the neuron after it has been committed to

apoptosis [111]. Also as CAD produces many DNA fragments during apoptosis, it is necessary

to deactivate PARP and its repair mechanism so that energy is conserved for proper conclusion

of apoptosis [111]. In the absence of a sufficient energy pool to maintain ionic homeostasis, the

cell can die quickly by default necrosis.

Caspase substrates also include a large number of signal transduction proteins, such as

mitogen-activated kinase kinase kinase MEKK1 and MST1 [111]. Caspase cleavage of

MEKK1, for example, provides a positive feedback loop for signaling apoptosis because the

caspase-cleaved kinase fragment induces caspase activation and apoptosis; similarly, cleavage of

MST1 by caspase-3 yields a constitutive kinase that is a potent inducer of apoptosis [111].

Caspase-3 can also cleave and inactivate the anti-apoptotic kinases Akt and c-Raf, thus

propagating more positive apoptotic feedback loops [111]. The Bcl-2 family of anti-apoptotic

proteins is also a substrate of effector caspases. Upon their activation, effector caspases can

26

cleave Bcl2 and BclxL and generate fragments that resemble the proapoptotic family members

Bax and Bak with proapoptotic activity [111]. This conversion is a feedback loop that ensures

that all anti-apoptotic brakes are removed at the final stages of apoptosis and that it can proceed

at an accelerated speed.

Trib3 and the Tribbles Family

Trib3, the subject of this thesis, was first described as neuronal putative cell death

inducible kinase or NIPK [113]. Trib3 is the mammalian homolog of the Drosophila

melanogaster gene, Tribbles, which acts as a negative regulator of String or Cdc25 and blocks

mitosis in the early mesoderm [114, 115]. String is a phosphatase that induces cell cycle

progression beyond the G2 phase by removing all cell division-inhibitory phosphates from Cdk1

[114, 115]. Tribbles regulates Drosophila oogenesis by degrading Slbo, the fruit fly ortholog of

the mammalian transcriptions factor C/EBP and it is thought that Tribbles does this as part of an

E3 ligase complex [116]. String is subject to proteasomal degradation by Tribbles also during

oogenesis so that a proper number of eggs versus nurse cells can form in the Drosophila, and trb

mutant embryos undergo an extra cycle of cell division [117]. Wing development in flies is also

regulated by Tribbles in that it reduces the protein levels of String and Twine (Cdc25 orthologs)

in order to reduce the number of cell divisions in the wing imaginal disc as the wings are

normally composed of a few large cells [118]. In summary, Tribbles regulates cell division

during fly development through proteasomal degradation of the phosphatases String and Twine

and the transcription factor Slbo [118].

27

Mammalian tribbles family members are pseudokinases that function in a cell-type

specific manner; they are encoded by three genes that are known as Trib1 (C8FW, SKIP1), Trib2

(C5FW, SKIP2, GS3955) and Trib3, also known as NIPK in rodents and SKIP3 or SINK in

humans. [118-122]. All three gene products are associated with human malignancies [122-127].

Trib1 mRNA is expressed in most human tissues, but in higher concentrations in skeletal muscle,

thyroid gland, pancreas, peripheral blood leukocytes and bone marrow [128]. Trib2 mRNA is

abundant in peripheral blood leukocytes while Trib3 mRNA is abundant in peripheral blood

leukoctyes and in bone marrow [128]. The human Trib1 gene is located on chromosome 8 at

q24.13 [118]. Trib1 protein can bind to 12-lipoxygenase (12-LOX), an enzyme that metabolizes

arachidonic acid and may take part in other cellular functions [118]. Trib1 can also interact with

MAPKK, specifically the ERK activator MEK1 and JNK activators MKK4 and SEK1; these

interactions have been shown to not only modulate MAPK activity, but also increase the levels

of Trib1 [118, 119]. Trib1 is found in nuclei and contains a proline-rich domain at its N-terminal

that is necessary for its nuclear localization [118]. All three Trib proteins have a septapeptide

IL(D/L)HPW(F/L) motif that is important for their interaction with MEK1; mutating this motif

in Trib1 abrogated its interaction with MEK1 and resulted in decreased levels of ERK

phosphorylation, indicating that Trib1’s interaction with MEK1 is necessary for ERK

phosphorylation [124]. Both Trib1 and 2 are found to be activated in myeloid leukemogenesis

and Trib1 overexpression enhances ERK phosphorylation while reducing apoptosis of leukemic

cells [124]. Human Trib2 gene is located on chromosome 2 at p24.3 and was identified in

human osteoblasts; it is also highly upregulated in metastatic prostate cancer cells [118]. Trib2 is

transcriptionally regulated by oncogenic Notch1 and both Trib1 and Trib2 proteins can bind

COP1 E3 ligase and promote degradation of C/EBP-α, thereby inducing leukemia [122, 124]. In

28

malignant melanoma, Trib2 mRNA is upregulated and levels of mRNA encoding the pro-

apoptotic Bim protein are decreased; conversely, low levels of Trib2 and high levels of Bim

mRNA are found in non-melanoma cells, suggesting an inverse relationship between the two

molecules [123]. Additionally, Trib2 was found to promote the survival of melanoma cells by

suppressing FoxO levels [123]. In Xenopus, Trib2 is necessary for proper cell division during

the blastula stage and for proper expression patterns of neural crest cell markers, somite

formation and eye development [129]. Trib2 was reported to interact with Akt in a co-

immunoprecipitation study and was able to block IGF1 (insulin-like growth factor) induced

phosphorylation of Akt at both the Ser473 and Thr308 sites [130].

The human Trib3 gene is located on chromosome 20 at p13-p12.2 and has a few splice

variants [118, 131]. The human gene is organized into four exons interrupted by three introns.

The mRNA isoforms contain alternative splice variants of the first exon termed 1A and 1B and

the variant 1B can be further subdivided into smaller splice variants as shown in the figure below

(Fig. 1-6). Trib3 mRNA isoform 1A is detectable in unstressed HepG2 cells, but increases by 2

fold and 4 fold in response to thapsigargin and arsenite treatment, toxins that induce ER stress

[131]. Isoform 1B on the other hand is very scarce in unstressed cells, but increases by more

than 10 fold after treatment with the toxins [132].

29

A 918bp promoter region between -7857 to -6940 of human Trib3 was isolated and

subjected to luciferase-based reporter assays, which revealed that treatment with thapsigargin

and arsenite lead to about 500 to 900 fold increase in luciferase activity [131]. The region was

found to have sequences of regulatory elements such as those found in the CHOP promoter

(C/EBP) and Asns promoters (nutrient sensing response element or NSRE1) (Fig. 1-7), which are

responsive to ER and arsenite stresses [131].

Figure 1-6

Human Trib3 splice variants

Ord et al. 2005

30

The Trib3 Protein

Trib3 protein is homologous to serine/threonine kinases with a well conserved substrate-

binding domain known as the Trb domain, but itself is a pseudokinase in that it lacks key

residues for catalytic and ATP binding domains and this has been confirmed by biochemical

assays [125, 128, 130]. Over the years various researchers have shown that the mammalian

Trib3 has a wide range of functions and binding partners.

Trib3 interacts with the transcription factors ATF4 and CHOP [125, 131, 133, 134].

CHOP belongs to the C/EBP family of transcription factors and is usually induced during DNA

damage, extracellular and ER stress, causing cell cycle arrest and apoptosis [135]. ATF4 is a

Figure 1-7

Human Trib3 promoter

Ord et al. 2005

31

member of the activating transcription factor family and often heterodimerizes with CHOP to

also activate genes in response to ER stress, leading to apoptosis [136]. The ATF4-CHOP

heterodimer binds to the Trib3 promoter region, inducing Trib3 mRNA levels in response to

toxins that result in ER stress and cell death [131, 134]. On the other hand, Trib3 was found to

inhibit their transcriptional activities in GT1-7 HepG2 cells; thus the Trib3-CHOP-ATF4

interaction constitutes a self-regulatory network that regulates Trib3 levels during stress, leading

to cell death [131, 134]. Trib3 is differentially regulated during stress; while it is upregulated

and results in cell death in response to ER stress, it is downregulated by p53 during genotoxic

stress [137]. Neuronal PC12 cells treated with tunicamycin underwent ER stress, resulting in

Trib3 and PUMA upregulation and apoptosis, which were blocked by the addition of IGF-1

(insulin-like growth factor) [138]. It was shown that Trib3 was necessary for PUMA

upregulation and that this might have been via FoxO3 phosphorylation and activation that

occurred as a result of tunicamycin induced deactivation of Akt [138].

NF-κB signaling is affected by Trib3. NF-κB belongs to a group of transcription factors

that are involved in immune regulation and they do so by regulating downstream genes such as

cytokines, chemokines, adhesion molecules and effectors [139]. NF-κB also plays critical roles

in regulating cell death and cell survival as it transactivates genes necessary for proliferation and

cell death. These include Casper/c-FLIP, c-IAPs, TRAF1, TRAF2, Bfl-1/A1, BclxL, Fas ligand,

c-myc and cyclin D1 [140]. NF-κB exists as a heterodimer consisting of a DNA-binding subunit

p50 and a transactivator p65 [140]. The phosphorylation of p65 causes NF-κB to interact with

transcriptional co-activator p300/CBP (CREB binding protein), which enhances the

transcriptional competence of nuclear NF-κB [140, 141]. Trib3 has been found to bind to p65

32

and block its phosphorylation by PKA (protein kinase A), thus negatively regulating NF-κB

dependent transcription [139]. The phosphorylation and activation of p65 generally promotes

cell survival and Trib3 overexpression has proved to sensitize cells to TNF and TRAIL induced

apoptosis [139].

Aside from playing a role in cell death in response to stress, Trib3 is also highly

expressed in certain carcinomas including lung, esophageal and colon tumors, in acute myeloid

leukemia and in various human gastrointestinal cancer lines [125, 126, 142, 143]. Experiments

using PC6-3 (human prostate carcinoma) cells revealed that Trib3’s mRNA and proteins levels

are induced in tumor cells that are starved of nutrients, such as glucose and amino acids, as it

usually happens when tumors reach a critical mass [144]. This induction of Trib3 was

dependent on PI3K activity as treatment with drugs that block PI3K also blocked Trib3

upregulation [144]. Interestingly, this study showed that Trib3 induction in response to limiting

nutrient conditions actually promoted their survival and protected the cells from starvation-

induced apoptosis thus allowing the growth of tumor cells even in less favorable environments

[144].

The transcriptional regulator CtIP (CtBP-interacting protein) is implicated in

tumorigenesis and is known to interact with Rb, BRCA1 and LOM4 and has been shown to bind

Trib3, as well [142]. Trib3 expression is also necessary for the migration and invasion of HepG2

cells in vitro and is responsible for regulating the TGFβ-SMAD pathway [145]. Trib3 is in a

positive feedback loop with the transcription factor SMAD3 in that Trib3 binds to it and

facilitates its translocation to the nucleus, where SMAD3 in turn transactivates Trib3 [145].

SMAD3 is a target for Smurf2 (SMAD ubiquitin regulatory factor 2), which ubiquitylates and

33

degrades SMAD3; Trib3 stabilizes SMAD3 by binding Smuf2 and leading to its degradation via

the ubiquitin-proteosomal pathway [145]. As the cells in the growing tumor experience hypoxia

and anoxia, the resulting stressful conditions illicit responses such as the UPR (unfolded protein

response). CHOP, ATF4 and Trib3, factors involved in ER stress, also become activated in these

cells [125, 146]. Experiments with human adenocarcinoma and osteosarcoma cells revealed that

Trib3 is induced by ATF4, which then binds ATF4 and leads to its degradation; this negative

feedback loop between ATF4 and Trib3 downregulates the stress signal and allows tumor cells to

adapt and continue with growth [125]. In anoxic breast cancer cell lines, Trib3 is induced by

HuR, ATF4 and NFκB pathways and may also be regulated by HIF-1α (hypoxia-inducible factor

1), which is activated by a broad range of oxygen concentrations in order to protect cells from

the damaging effects of oxidative stress. [146]. A global gene expression profiling revealed that

Trib3 is induced in ischemic preconditioning of rat retina, as well [147]. So far Trib3 is induced

in mammalian cells subjected to various stresses and induces apoptosis or promotes survival

depending on the circumstances and cell type. The following paragraphs will reveal yet other

functions of Trib3, which include regulating signal transduction and energy metabolism.

Trib3 gene expression is high in HeLa cells, where Trib3 can bind the MAP kinases

MEKK1 and MKK7 and enhance ERK and JNK activation at low concentrations, but not at high

doses and conversely, MKK7 overexpression leads to increased levels of Trib3 protein [128].

Trib3 transcripts and proteins have short half-lives, but Trib3’s interaction with MAPKKs

stabilizes its protein level. Thus, Trib3 is able to modulate MAPKK activity by either a positive

feedforward or negative feedback loop depending on its concentration in the cell [128]. The E3

ligase SIAH1 (seven in absentia homolog) binds to Trib3, leading to its ubiquitination and

34

proteasomal degradation [148]. Trib3 itself associates with the E3 ligase COP1 and promotes

degradation of ACC (acetyl-coenzyme-A carboxylase), an enzyme necessary for long fatty acid

chain synthesis [149]. In this manner Trib3 enhances lipolysis under fasting conditions [149].

Transgenic mice expressing Trib3 in adipose tissue were found to be protected from diet-induced

obesity that results from enhanced fatty acid oxidation [149].

Aside from the MAP kinases, Trib3 also has been reported by various researchers to

regulate the serine/threonine kinase Akt [130, 150-154]. This is of particular relevance to the

present thesis work as will become apparent as we proceed. A yeast-two hybrid screen revealed

for the first time that Trib3 is a binding partner for an Akt1 mutant that lacks its N-terminal PH

domain; this was followed by mammalian two-hybrid assays in 293T cells that showed Trib3

interacting with WT Akt [130]. Co-immunoprecipitation studies of proteins from HepG2

whole-cell extracts showed endogenous Trib3-Akt interaction and exogenous flag-tagged Trib3

coprecipitated with HA-tagged Akt1 and Akt2 [130]. Furthermore, a Trib3 splice variant lacking

residues 239-265 (ΔTrib3) interacted only weakly with Akt [130]. It was also reported that

Trib3 overexpression inhibited IFG1 (insulin-like growth factor) induced Akt phosphorylation at

both Thr308 and Ser 473 residues and that although Trib3 can bind both phosphorylated and

unphosphorylated Akt, it interacts with unphosphorylated Akt with stronger affinity [130].

Furthermore, residues 240 to 315 of Akt1 were necessary for association with Trib3, which

indicated that Trib3 may bind Akt and physically block the Thr308 phosphorylation site [130].

Trib3 was found to engage Akt during insulin signaling in various non-neuronal cells [155].

Under normal conditions, food intake results in insulin stimulated uptake of glucose in muscles

and other tissues and inhibits hepatic glucose production. The action of insulin on hepatocytes

35

commences as insulin binds to its receptor and phosphorylation of insulin-receptor substrate

proteins takes place on tyrosine residues. Eventually Akt is phosphorylated and phosphorylates

and inhibits GSK3β, which positively regulates gluconeogenesis. Akt also blocks FoxO1

activation, inhibiting the transcription of gluconeogenic genes. The end result is a reduction in

gluconeogenesis and hepatic glucose output. In hepatocytes that are particularly responsive to

insulin and in HEK293 cells, Trib3 was observed to interfere with insulin signaling and glucose

metabolism by binding to Akt and blocking its phosphorylation at both the Thr308 and Ser473

residues [130]. In normal mice, Trib3 is induced up to 10 to 20 fold by starvation and was found

in complexes with Akt [130]. The same research showed that Trib3 binds preferentially to the

unphosphorylated version of Akt and that it most likely masks the Thr308 residue, physically

preventing it from becoming phosphorylated [130]. Trib3 is also elevated in obese diabetic

mice, where increased expression of Trib3 blocks Akt activation, leading to insulin resistance,

hyperglycemia and non-alcoholic fatty liver disease (NAFLD) [130, 150]. In another study, it

was determined that chronic ethanol intake resulted in insulin resistance and hyperglycemia in

rats and that the mechanism responsible was decreased levels of phospho-Akt due to elevated

levels of Trib3 protein in liver cell cytoplasm [151]. In utero exposure to ethanol also resulted in

insulin-resistant diabetes in muscle cells of rat offspring [152]. Reduced levels of phospho-Akt

were also observed in these cells and in liver cells of other rats maintained on an ethanol diet,

accompanied by elevated levels of Trib3 and PTEN that were also hypoacetylated [152, 153].

PTEN is a known negative regulator of Akt and deacetylation enhances its activity and this is in

concordance with the observed decrease in Akt activity in these cells; however, it is unclear what

the significance of Trib3 acetylation is [153]. It has been long observed that pancreatic β-cells

die from apoptosis in female rats shortly after parturition and it is now determined that there are

36

reduced levels of phospho-Akt, and increased ATF4/CHOP-dependent stimulation of Trib3

expression resulting from ER stress and UPR [154].

A missense Trib3 polymorphism, with a minor allele frequency of 15%, has been

described in which a glutamine residue is substituted by an arginine at position 84 (Q84R) [156].

This Trib3 variant binds to the pleckstrin homology domain of Akt with high affinity, preventing

its plasma membrane association, and overexpressing the variant decreased insulin induced

phosphorylation and activation of Akt by approximately 22% [156]. Molecular modeling

suggests that the RR (homozygous mutant) variant may form additional salt bridges with the PH

domain of Akt, which may account for the higher affinity of this mutant for Akt [157]. The RR

variant attenuated insulin-induced phosphorylation of Akt on both of its regulatory sites and

since eNOS is a substrate of Akt, eNOS phosphorylation was reduced, as well [157]. Insulin

stimulated production of NO and cyclic GMP that are necessary for vasodilation in cells

expressing Trib3 Q84 in comparison with cells expressing the R84 variant, which displayed only

a small increase [157]. Both Italian Caucasians and a Chinese population with the Q84R Trib3

polymorphism displayed reduced insulin sensitivity and high cardiovascular risk factors, such as

abdominal obesity, hypertriglyceridemia and thickening of the intima-media (innermost two

layers of the arterial wall) and a predisposition toward type 2 diabetes and myocardial infarction

at earlier age compared to individuals with the QQ genotype (WT homozygous) [158-162].

Adding to Trib3’s repertoire of activities was the finding that it may have a role in neuron

death. Mayumi-Matsuda et al. used RLCS (restriction landmark cDNA scanning) and reported

that Trib3 cDNA levels were upregulated when the PC6-3 subline of PC12 cells and developing

sympathetic neurons were deprived of NGF for various time periods between 6 and 24 hours

37

[113]. Given Trib3’s well documented role in inhibiting Akt phosphorylation and given the

importance of Akt in neuron survival, it is not unreasonable to contemplate what role, if any,

Trib3 might have in neurons. The group also reported that cortical neurons overexpress Trib3 in

response to Ca2+ ionophores excitotoxicity [113]. Similar findings were reported by Kristiansen

et al 2011 when they reported that Trib3 mRNA levels are up regulated in developing rat

sympathetic neurons in response to NGF deprivation for 18 hours and that this effect is

attenuated in the presence of MLK inhibitor CEP11004, indicating that Trib3 may be regulated

by the MLK/JNK/cJun pathway [163]. Furthermore, Trib3 became upregulated in neuronal

PC12 cell treated with 6OHDA (6-hydroxy dopamine), a neurotoxin that enters neurons via

dopamine and noradrenaline reuptake transporters and selectively kills dopaminergic neurons

and is used to induce Parkinsonism in laboratory animals [164]. The toxin is also used in

neuronal cultures to study the molecular mechanisms of sporadic Parkinson’s disease. SAGE

(serial analysis of gene expression) revealed that treating neuronal PC12 cells with 100 µM

6OHDA for 8 hours results in upregulation of Trib3 mRNA among others (c-Fos, cJun, ATF4,

CHOP, RTP801), raising the possibility that Trib3 is involved in Parkinsonian

neurodegeneration [164].

The NGF-Deprivation Model

Cell culture models are effective tools for studying death promoted by NGF deprivation.

These models include PC12 cells (pheochromocytoma cells) and neonatal sympathetic neurons

from the superior cervical ganglia that are dependent on NGF for survival. PC12 cells closely

resemble sympathetic neurons in that they synthesize and store dopamine and norepinephrine

and they respond to NGF by exiting the cell-cycle, becoming electrically excitable and producing

38

neurites at which point they are referred to as neuronal PC12 cells [165]. They are a useful

component of the NGF-deprivation model in that they undergo apoptosis when NGF is

withdrawn from the medium just as sympathetic neurons do in culture and in vivo during

development [166]. Furthermore, the ease with which PC12 cells can be propagated and grown

in abundance reduces the need for animal sacrifice and time consuming dissection for primary

neuronal culture. Much of our current knowledge about the various molecules and pathways

involved in neuronal apoptosis have been obtained by experiments carried out in PC12 cells by

various researchers and then corroborated in primary sympathetic neuronal cultures [64, 74, 88,

167]. Primary sympathetic neurons are obtained from early postnatal rat pups, a period during

which developmental PCD of these neurons continues in vivo. Therefore, this culture is effective

in corroborating experimental data initially obtained from neuronal PC12 cells. The NGF-

deprivation model is very useful in not only understanding the cell death process during

development, but also may also provide insight about pathological neuron loss observed in

various neurodegenerative diseases.

Relevance of NGF Deprivation Models to Neurodegenerative Diseases

Many of the key molecules first characterized in the NGF-deprivation model were found

to play critical roles in mediating death in diseases, as well. For example, aside from NGF

deprivation, Bim transcripts and protein were shown to be upregulated in the entorhinal cortex of

postmortem AD brains [168]. Furthermore, when cultured cortical and hippocampal neurons

were treated with Aβ, Bim became upregulated and was found to be required for the death

promoted by Aβ in these neurons [168]. The apoptotic cell-cycle pathway described earlier is

also responsible for transcriptionally upregulating Bim in AD neurons and in AD culture models

39

[64, 168]. As another example, transcript levels for the BH3-only gene Dp5 were upregulated in

CGNs (cerebellar granule neurons) in response to KCl and serum deprivation, in cortical neurons

in response to amyloid β peptide toxicity, in axotomized retinal ganglion cells, in axotomized

mouse motoneurons and in the spinal cords of human amyotrophic lateral sclerosis patients [169,

170]. Finally, as has been discussed earlier, there may be a direct correlation between loss of

NGF support and development of neurodegenerative diseases, such as Alzheimer’s disease.

Using neuronal PC12 cells, it has been shown that NGF and TrkA signaling is necessary for

normal processing of APP (amyloid precursor protein) and cell differentiation and survival [171-

173]. These findings have been corroborated in hippocampal neurons, a neuron population

susceptible to amyloid β toxicity in the diseased brain [172, 173]. Thus, the NGF-deprivation

model, comprised of neuronal PC12 cells and primary neonatal sympathetic neurons in culture,

is a potentially useful system for investigating the possible role of Trib3 in both normal and

pathological neuron death and answering questions regarding its mechanism and regulation.

Rationale and Aims of this Thesis

Though much has been uncovered regarding the molecular mechanisms by which

neurons die from NGF deprivation, the entire process is not fully understood. The BH3-only

proapoptotic genes Bim, Dp5 and the prolyl hydroxylase SM20 are important for inducing death

in this paradigm; however, they are not indispensable because their deletion affords only partial

protection from death [85, 87, 97], indicating the existence of other pro-apoptotic molecules.

Furthermore, the roles they play involve directly compromising the integrity of the mitochondrial

membrane and promoting cytochrome c release, events that are many steps downstream of the

initial stress resulting from NGF deprivation. Therefore, it is also possible that there are

40

unidentified molecules that may be involved in processes further upstream of the apoptotic

cascade. Trib3 presents itself as an attractive candidate that may fit the above criteria for two

reasons. One, it is upregulated in NGF deprived neuronal cultures, suggesting that it might be a

pro-apoptotic molecule; and two, because it negatively regulates Akt in non-neuronal cells, it

may do the same in neurons, thereby regulating the apoptotic cascade many steps upstream of the

mitochondrial intrinsic pathway and caspase activation. Since Akt activation is of paramount

significance for neuron survival, the activation process is regulated at multiple steps by multiple

factors as already discussed here [43, 59]. On the other hand, developmental apoptosis that

occurs in response to limited levels of NGF in the periphery is also crucial for proper formation

of neuronal circuits. Therefore, a molecular switch must exist in order to tip the closely

regulated homeostatic balance of the neuron in favor of apoptosis. Just as we have observed

self-amplifying pathways that effectively divert all energy toward apoptosis and ensure its proper

conclusion post caspase activation [111], it is possible that similar self-amplifying pathway(s)

exist(s) that is/are responsible for rapidly amplifying the effects of a limited NGF supply, thereby

effectively deactivating Akt and initiating neuron death.

After the initial reports made by Mayumi-Matsuda et al., [113] no follow up research has

been conducted to explore the significance of Trib3 mRNA upregulation in NGF deprived

neurons; therefore, it was logical and important for me to ask what role, if any, Trib3 plays in

neuronal apoptosis, what molecular mechanism(s) it employs and how it is regulated in neurons

under stress. In addition, given the observed tendency of Trib3 to interact with a wide variety of

proteins and, at times, engage in feedback and feedforward loops, it was of interest to explore

whether Trib3 can potentially play a key role in an amplification process that might disable Akt

41

signaling. If Trib3 does play a role in amplifying the apoptotic signal at its onset in the NGF-

deprivation model, this would be an important insight, which may enable researchers to gain

control over the process of apoptosis in adult neurons and to potentially decelerate or halt the

progression of neurodegeneration. Therefore, in addition to investigating Trib3’s role in the

NGF-deprivation model, I briefly explored its role in the 6OHDA and amyloid β toxin models of

pathologic neurodegeneration.

Based on the rationale and aims discussed above, this thesis tests the following hypotheses

regarding Trib3 and its role in neuron death caused by NGF deprivation.

Hypotheses and Findings

I. Trib3 is involved in inducing apoptosis in neurons deprived of NGF. Trib3

mRNA is upregulated in stressful conditions, such as ER stress, oxidative stress, and

excitotoxicity and induces apoptosis [113, 133, 134]. Sympathetic neurons and PC12

cells deprived of NGF also exhibit an increase in Trib3 mRNA levels [113].

Therefore, it is possible that Trib3 is involved in the apoptotic process responsible for

developmental sympathetic neuron death during development. My experimental data

show that Trib3 is both sufficient and necessary for death of cultured PC12 cells and

sympathetic neurons after NGF deprivation.

II. Trib3 regulates Akt phosphorylation in neurons and mediates apoptosis by

causing Akt deactivation. The PI3-K/Akt pathway is an important transducer of

NGF signaling and is necessary for maintaining neuron survival [53]. Trib3 has been

42

shown to block Akt phosphorylation and activation in hepatocytes, resulting in

disruption of insulin signaling and glucose metabolism [130]. Given the importance

of Akt in neuron survival, it is necessary and logical to investigate whether or not

Trib3 plays any role in regulating Akt activity in neurons. My findings show that

Trib3 is sufficient to lower Akt phosphorylation in neurons and that Trib3 plays a role

in the decrease in phospho-Akt levels that occurs in NGF-deprived neurons.

III. Trib3 is transcriptionally regulated by the FoxO, JNK and apoptotic cell-cycle

pathways. Programmed cell death resulting from NGF deprivation requires

activation of the FoxO, JNK and the apoptotic cell-cycle pathways [64, 69]. The

transcription factors associated with these pathways are responsible for activating

downstream proapoptotic genes. These include the BH3-only molecules Bim, Dp5,

and the non-BH3 SM20 [64, 78, 96]. If Trib3 has a pro-apoptotic role in neurons, it is

possible that it too is under the transcriptional regulation of these pathways. My data

show that Trib3 induction after NGF deprivation requires FoxO transcription factors.

It also appears that JNK and apoptotic cell cycle signaling is also required.

IV. Trib3, Akt and FoxO are linked in a self-amplifying feedback loop. Pro-apoptotic

FoxO activity is negatively regulated by Akt and therefore increases with NGF

deprivation [56]. Since FoxO also regulates Trib3 expression and Trib3 inhibits Akt

activity, NGF deprivation should trigger a self-amplifying loop that includes Akt,

43

FoxO and Trib3. My data support such a loop and show that Trib3 is required for

FoxO nuclear translocation and activation in response to NGF deprivation.

44

Chapter 2

Results and Discussion

Introduction

Neuronal apoptosis in the developing nervous system is important for proper shaping of

the system’s structure and elimination of neural pre-cursor cells harboring damaging mutations

[9]. Target-derived neurotrophic factors play a significant role during late-stage neuronal

apoptosis in that their limited availability results in the disposal of approximately half of all post-

mitotic neural population, allowing only those neurons that match their targets to survive and

establish functional neural connectivity [8, 9]. NGF is the quintessential neurotrophic factor that

promotes the survival of sympathetic and a sub-population of sensory neurons in the PNS, where

they compete for its limited availability [14, 15, 31]. A hallmark feature of the naturally

occurring PCD resulting from this competition is the de novo transcription-dependent synthesis

of pro-apoptotic proteins, without which the process is inhibited [1]. Neuronal apoptosis is a

complex process that employs a variety of intracellular proteins and pathways and is not

understood in its entirety. RNAi knockdown and genetic knockout studies of the traditional

BH3-only genes revealed they are important, but not indispensable in inducing apoptosis and that

other pro-apoptotic molecules must exist [85, 87, 97]. Moreover, the molecular process via

which a limited supply of NGF deregulates the neuron’s homeostatic balance is not understood

well. It is likely that the deactivation of a master regulator of cell survival, Akt, is an integral

part of this process. The pseudokinase Trib3 has been known to negatively affect Akt activation

in non-neuronal cells under various stressful conditions [130, 150-154]. Therefore, because it

45

was reported that Trib3 mRNA is upregulated in the NGF-deprivation model [113], I decided to

investigate its potential role in mediating apoptosis in NGF-starved neuronal PC12 cells and

neonatal sympathetic neurons. In this chapter, I present the experimental data and their possible

significance.

Results

Trib3 mRNA and protein are upregulated in response to NGF deprivation. It has been

reported that Trib3 transcript levels are upregulated in NGF-deprived SCG neurons [113], [163].

I sought to confirm this in neuronal PC12 cells and SCG neurons by subjecting the cultures to

NGF withdrawal for various time periods and found that Trib3 mRNA levels are indeed

upregulated in both cell populations and that the extent of induction was approximately 3-7 fold

before the first evident signs of cell death caused by NGF deprivation at about 16 hours (Fig. 2-

1A-C). In SCG neuron cultures, Trib3 mRNA appeared to be maximally induced by as early as

4 hours after NGF removal (Fig. 2-1C). The experiments presented in Fig. 2-1 A and C were

done using antibody against human NGF and therefore to rule out possibilities of any artifact

arising from using this antibody, I repeated the NGF withdrawal in neuronal PC12 cell cultures

where NGF was removed by repeatedly washing of the cells with NGF-free medium without the

addition of anti-NGF antibody (Fig. 2-1 B). In this case also, there was an appreciable induction

of Trib3 mRNA.

In order to determine whether the induction of Trib3 mRNA is reflected by elevation of

Trib3 protein levels under these conditions, neuronal PC12 cell were subjected to 16 hours of

46

0

5

10

Rela

tive

Trib

3 m

RNA

Leve

ls

*

*

*

NGF -NGF 8hr

-NGF 12 hr

-NGF 16 hr

-NGF 20 hr

A.

0

5

10

NGF -NGF 8 hr

Rel

ativ

e Tr

ib3

mR

NA

Leve

ls

-NGF 16 hr

-NGF 4 hr

B

PC12 Cells

SCG Neurons

NGF Trib3

ERK

-NGF 16 hrs

C

0

1

2

3

Rela

tive

Trb3

Pro

tein

Lev

els ¥

NGF -NGF 16 hr

PC12 Cells

D

+NGF -NGF 8 hr

19 µm

NGF -NGF 16 hr

28 µm Trib3

Trib3 + Tuj1 + Topro III

SCG Neurons PC12 Cells

E

F. -NGF 8 hr + Trib3 Blocking peptide

Figure 2-1

0

5

10

Rela

tive

Leve

ls o

f Tr

ib3

mRN

A

NGF -NGF 18 hrs

*

G.

PC12 Cells

PC12 Cells

47

Figure 2-1: Trib3 is induced in response to NGF deprivation. Neuronal PC12 cells (A, B)

and SCG neurons (C) were deprived of NGF for the indicated times. Anti-NGF antibody was

used for PC12 cells (A, D) and SCG neurons (C) and NGF was removed by repeated washing of

PC12 cells (B) without the use of anti-NGF antibody. Total mRNA was isolated and subjected

to reverse transcription followed by quantitative PCR using Trib3 primers (A-C). Rat GAPDH

and alpha-tubulin mRNA levels were used to normalize input cDNA. The data are reported as

relative increase in mRNA levels normalized to NGF control and represent mean +/- S.E. of

three experiments for PC12 cells (A, B) and +/- range of two experiments for SCG neurons (C).

(D, E) Neuronal PC12 cells were deprived of NGF for 17 hours. Whole cell lysates were

subjected to SDS PAGE. Error bars represent mean +/- S.E. of four experiments.

Immunocytochemistry of SCG neuron (F) and neuronal PC12 cell (G) cultures showing Trib3

protein upregulation after NGF deprivation. Tuj1 immunostaining (green) for neurons and

ToproIII staining (blue) for nuclei were done, as well. Note absence of signal in presence of a

Trib3 blocking peptide. *p<0.05; ¥p<0.005 vs. no NGF withdrawal (Student’s t-test). Scale bar

for SCG neurons = 19 µm and for PC1 2 cells = 28 µm.

48

NGF deprivation, which revealed that there is an approximate doubling of the Trib3 protein

levels (Fig. 2-1 D, E). Immunostaining of SCG and PC12 cell cultures also indicated an increase

in Trib3 protein expression levels after NGF withdrawal. Expression was mainly cytoplasmic

with some apparent nuclear staining (Fig. 2-1F, G).

Trib3 mediates neuron death caused by NGF deprivation. Since the discovery of Trib3

mRNA upregulation in SCG neurons after NGF deprivation, nothing has been reported about

what role Trib3 may actually play under these conditions. To explore this, three independent

shRNA constructs against rat Trib3 were generated and two of these constructs were delivered

by either transfection or lentivirus transduction to neuronal PC12 cells and SCG neurons,

respectively. The lentiviral constructs also expressed eGFP and proved to be nearly 100%

efficient in infecting both neuronal PC12 cells and SCG neurons (Fig. 2-2F). The shRNA

constructs efficiently knocked down over-expressed rat Trib3 in HEK293 cells (Fig. 2-2A, B).

They also effectively silenced expression of endogenous Trib3 in NGF deprived sympathetic

neurons (Fig. 2-2E).

Initial experiments carried out with neuronal PC12 cells indicated that Trib3 knockdown

using shTrib3#1 provides partial protection from NGF deprivation with approximately 2-fold

more cells surviving after 24 hours (Fig. 2-3A). Extension of these studies to sympathetic

neurons revealed that Trib3 silencing protects both cell bodies and neurites for at least one week

following NGF withdrawal (Fig. 2-3 B-D). Quantification of neuron survival confirmed the long-

term protective effect of Trib3 knockdown (Fig. 2-3E and F); similar results were achieved with

shTrib3#1 and shTrib3#2, and so the data were pooled in (Fig. 2-3F). An average of about 65%

of Trib3 deleted neurons survived after 6 days of NGF deprivation versus about 25% of NGF

49

deprived control neurons. (Fig. 2-3E, F). A scrambled shRNA against Trib3 was used as the

control (Fig. 2-3E) in some experiments and a shRNA against dsRed was used as the control in

other experiments (Fig. 2-3F). Both yielded comparable results, indicating that there were no

non-specific effects of shRNAs or virus on neuron survival.

The BH3-only pro-apoptotic protein Bim is induced in response to NGF deprivation and

its deletion or silencing in sympathetic neurons and PC12 cells provides partial protection from

NGF deprivation [74, 85]. The effects of Bim and Trib3 knockdown, either separately or

together, were investigated. A previously described siRNA sequence against Bim, shBim#1 that

effectively silences endogenous rat Bim [74], was cloned into the lentiviral plasmid. A second

independent lentivirally-delivered shRNA that reduces endogenous rat Bim expression by 75-

80%, shBim#2, was also generated (Fig. 2-2D, E). Silencing of both Bim and Trib3 led to only a

modest increase in protection (Fig. 2-3A, G, H). These data indicate that Trib3 is a necessary

for mediating neuron death evoked by NGF deprivation and that Trib3 and Bim participate along

the same pathway to promote neuronal apoptosis.

50

Trib3

GFP

Trib3 shTrib3 #1 shTrib3 #2 shTrib3 #3

+ + + + + + +

+ +

Scrambled shTrib3#1 + + sh_ds Red

- - - - - -

- - -

- -

-

-

- -

- -

- - -

- - - - -

A B C D E F

0

0.5

1

1.5

2

A B C D E F

Rela

tive

Trib

3 Pr

otei

n Le

vels

* ** ***

A. HEK293 Cells

B. D.

NGF Ctl

No NGF Ctl

No NGF

shBim #1

No NGF

shBim #2

Bim

ERK

0

0.5

1

1.5

2

Rela

tive

Bim

Pro

tein

Lev

els

NGF Ctl

No NGF Ctl

No NGF shBim

#1

No NGF shBim

#2

C.

E.

Figure 2-2

NGF + sh_dsRed NGF + shTrib3 #1 -NGF + sh_dsRed -NGF + shTrib3 #1

Trib3

Trib3 + GFP + Topro III

30μm

30μm

SCG Neurons

Neuronal PC12 Cells

51

Figure 2-2: shTrib3 constructs knock down both exogenous and endogenous Trib3. (A)

HEK293 cells were co-infected with lentiviruses expressing Trib3 and shTrib3 or control shRNA

(sh_dsRed or scrambled shTrib3#1) constructs, and whole cell lysates were prepared three days

later and subjected to immunoblotting for Trib3 or GFP. (B) Quantification of relative Trib3

protein expression under conditions described in panel (A). Values are normalized to GFP

expression to correct for infection efficiency and are expressed as means ± S.E. of three

experiments. (C) Neuronal PC12 cells were infected with lentivirus infected with either control

(sh_dsRed) or shRNA against two different Bim for 3 days and subjected to NGF deprivation for

16 hours. Cells were lysed and lysates subjected to immunoblotting using antibody against Bim.

(D) The relative protein levels were normalized against total ERK and quantified. (E) SCG

neuronal cultures were infected with either control or shTrib3#1 expressing lentivirus for 3 days

followed by 8 hours of continued NGF treatment or NGF deprivation, all as indicated. Neurons

were fixed and immunostained using antibody against Trib3 and ToproIII nuclear staining was

used, as well. (F) In order to assess the efficacy of lentiviral transduction, both neuronal PC12

cells and SCG neurons were infected with shTrib3 expressing lentivirus for 3 days and then

imaged using an epi-fluorscent microscope. Differences from Trib3 expressing samples without

Trib3 shRNA: *p<0.005; **p<0.05; ***p<0.0005 (Student’s t-test). Scale bar = 30 µm.

Phase

Fluor

Neuronal PC12 SCG F. Lentiviral Transduction Efficiency

52

**

0

50

100

1 Day 2 Days 3 Days

NGF

no NGF

shTrib3#1

shBim#1

shTrib3#1+shBim#1

** **

*

% V

iabl

e PC

12 C

ells

*

*

** **

*

B.

C.

D.

+ NGF Control

- NGF 7 Days Control

- NGF 7 Days shTrib3

SCG Neurons

SCG Neurons

E.

0

50

100

1 Day 2 Days 3 Days 6 days

% V

iabl

e SC

G N

euro

ns

+NGF Control

-NGF shTrib3

-NGF Control

0

50

100

1 Day 2 Days 3 Days 6 days

% V

iabl

e SC

G N

euro

ns

-NGF Control

+NGF Control

-NGF shBim#1

-NGF shTrib3 & shBim#1

0

50

100

1 Day 2 Days 3 Days 6 Days

% V

iabl

e SC

G N

euro

ns

-NGF shTrib3 & shBim#2

+NGF Control

-NGF Control

-NGF shBim#2

F.

G. H.

A.

SCG Neurons

Neuronal PC12 Cells

Figure 2-3

* *

* *

* *

* * * *

*

* *

* * *

*

% V

iabl

e SC

G N

euro

ns

0.00

50.00

100.00

5 Days 6 Days

NGF

scrmbledshTrib3#1shTrib3#1

* *

53

Figure 2-3: Trib3 is required for neuronal apoptosis caused by NGF withdrawal. (A)

Neuronal PC12 cells were transfected with either control shRNA, shTrib3, shBim or

shTrib3+shBim constructs in the pSIREN vector and NGF was either retained or removed from

the medium 48 hours post transfection. Viable, transfected (GFP+) cells were counted at

indicated times after NGF withdrawal. Values represent means ± S.E. (four independent

experiments, each in triplicate or in sets of 6) and are expressed relative to cell number with NGF

and control shRNA construct. (B-D) Confocal images of SCG neurons infected with either

control or shTrib3 lentivirus for 72 hours, followed by NGF deprivation for 7 days. Note the

presence of many neurites in cultures without NGF and infected with shTrib3. Scale bar = 16

µm. (E) SCG neurons were infected with the indicated lentiviruses including a different control

shRNA (scrambled shRNA against Trib3) and an shRNA construct against Trib3, and surviving

neurons were counted at indicated times and values are given as means ± S.E. (a single

experiment performed in triplicate) relative to the neuron number in cultures with NGF and

control shRNA. (F-H) SCG neurons were infected with the indicated lentiviruses, which include

control (sh_dsRed) and two different shRNA constructs against Trib3 and Bim, alone and in

combination for three days. Counts of surviving neurons were performed at the indicated times

and values are given as means ± S.E. (between four to ten independent experiments performed in

triplicate) relative to the neuron number in cultures with NGF and control shRNA on each day.

*p<0.005 and **p<0.05 compared with no NGF control (Student’s t-test).

54

Trb3 over-expression is sufficient to promote neuron death in presence of NGF. It has been

shown that Trib3 has pro-apoptotic activity in several non-neuronal systems [137, 174].

However, no data have been presented on whether Trib3 can induce death of NGF-responsive

neurons. Lentivirally induced overexpression of Trib3 in both neuronal PC12 cells and SCG

neurons (Fig. 2-4A, C) resulted in a steady decline in viability even though the cultures were

maintained in the presence of NGF (Fig. 2-4B, D). In order to determine whether cortical

neurons, that are independent of NGF support, are also vulnerable to Trib3 expression, Trib3 was

overexpressed lentivirally in cortical neuron cultures for various time periods (Fig. 2-4E, F).

Overexpressing Trib3 did not result in cortical neuron death (Fig. 2-4E) indicating that not all

neuron populations may be susceptible to Trib3. This finding also shows that the results obtained

with neuronal PC12 cells and SCG neurons were not due to any non-specific toxic effects of the

construct.

55

Figure 2-4

Trib3 Ctl

PC12 Cells

SCG Neurons

0

50

100

Num

ber o

f Vi

able

PC1

2 Ce

lls

** *

Ctl Ctl Ctl Trib3 Trib3 Trib3 2 Days 5 Days 6 Days

0

100

200

300

Num

ber o

f Via

ble

SCG

Neu

rons

*** *¥ *¥

Ctl Ctl Ctl Ctl Trib3 Trib3 Trib3 Trib3 3 Days 6 Days 4 Days 5 Days

Trib3

ERK

Ctl Ctl Trib3 Trib3 Trib3 Ctl

5 Days 7 Days

Trib3

ERK

3 Days

5 Days

A. B.

C.

D.

56

Figure 2-4: Trib3 overexpression is sufficient to promote neuronal apoptosis. Replicate

cultures of neuronal PC12 cells (A, B), SCG neurons (C, D) and cortical neurons (E, F) were

infected with lentivirus expressing eitherTrib3+eGFP or eGFP (control) alone and maintained

with NGF. Cells were lysed after indicated time points and numbers of remaining intact nuclei

were counted. Cell lysates were also subjected to immunoblotting using antibody against Trib3

and total ERK. Panels (A, C, E) show representative blots. Panels (B, D, F) show mean values

of viable neurons +/- S.E. of three experiments for PC12 cells (B), four experiments for SCG

neurons (D) and six experiments for cortical neurons (F) each carried out in triplicate. *p<0.005;

**p<0.05; ***p<0.01; *¥p<0.0005; vs. time-matched control; Student’s t-test.

5 Days 6 Days Ctl

Trib3

0

10

20

30

40

50

Num

ber o

f Liv

e C

ortic

al N

euro

ns

Ctl Trib3

5 Days Trib3 Ctl Trib3

7 Days

ERK

Trib3

Trib3

Ctl

Cortical Neurons

Ctl

10 Days

E.

F.

57

Trib3 regulates neuronal AKT phosphorylation. Trib3 is reported to bind AKT and block its

phosphorylation, and therefore activity, in various non-neuronal cell types [130, 150-154]. The

phosphorylation and activation of Akt is an important event because active Akt is necessary for

neuron survival [53, 54]. NGF deprivation leads to Akt’s dephosphorylation and deactivation,

contributing to neuronal death [54]. Given these facts, the logical next step was to determine

whether or not Trib3 plays any role in the Akt dephosphorylation that follows NGF deprivation.

Preliminary experiments in neuronal PC12 cells were carried out by infecting the cultures with

lentivirus expressing control or shTrib3 constructs followed by NGF deprivation for 16 hours.

Western immunoblotting for Akt phosphorylation at Ser473 and Thr308 (Fig. 2-5A) revealed

that Akt dephosphorylation in response to NGF withdrawal was prevented by Trib3 knockdown,

without affecting the total Akt levels. Phospho-Akt levels were quantified after normalizing to

total ERK and total Akt (Fig. 2-5B-F). Similarly, endogenous Trib3 was knocked down in

sympathetic neurons followed by 16 hours of NGF deprivation. The decrease in Akt

phosphorylation at both sites that occurs with NGF withdrawal was significantly reversed by

Trib3 silencing (Fig. 2-6A, B) with no significant effect on total Akt levels under all conditions

or on phospho-Akt in presence of NGF (Fig. 2-6C, D). These findings support the idea that

Trib3 expression due to NGF deprivation reduces Akt phosphorylation/activity, contributing to

neuron death.

In order to determine whether expressing Trib3 would be sufficient to mediate Akt

dephosphorylation in neuronal PC12 cells and sympathetic neurons, the cells were infected with

a Trib3-expressing lentivirus in the presence of NGF. The levels of phospho-Akt were assessed

by western immunoblotting 5 days after lentiviral infection. In each case, levels of phospho-Akt

58

(both Ser473 and Thr308) decreased by about 40-60%, with no significant change in total Akt

expression (Fig. 2-7 A-D). Trib3 is therefore sufficient to cause Akt dephosphorylation in the

presence of NGF.

59

pAkt (S473)

pAkt (T308)

Total Akt

ERK

ERK

ERK

NGF NGF shTrib3

NGF Ctl

-NGF shTrib3

-NGF -NGF Ctl

0.0

0.5

1.0

1.5

2.0

pAKT_S473 normalized to total ERK

NGF NGF Ctl

NGF shTrib3

-NGF -NGF Ctl

-NGF shTrib3

Rela

tive

Prot

ein

Leve

l

0.0

0.5

1.0

NGF NGF shTrib3

NGF Ctl

-NGF shTrib3

-NGF -NGF Ctl

pAKT_T308 normalized to total ERK

Rela

tive

Prot

ein

Leve

l

0.0

0.5

1.0

NGF NGF shTrib3

NGF Ctl

-NGF shTrib3

-NGF -NGF Ctl

Total AKT normalized to total ERK

Rela

tive

Prot

ein

Leve

l

0.0

0.5

1.0

pAKT_S473 normalized to total Akt

NGF NGF Ctl

NGF shTrib3

-NGF -NGF Ctl

-NGF shTrib3

Rela

tive

Prot

ein

Leve

l

0.0

0.5

1.0

1.5

NGF NGF shTrib3

NGF Ctl

-NGF shTrib3

-NGF -NGF Ctl

pAKT_T308 normalized to total Akt

Rela

tive

Prot

ein

Leve

l

A. B.

C. D.

E. F.

Figure 2-5

Neuronal PC12 Cells

60

Figure 2-5: Trib3 contributes to the decrease in Akt phosphorylation in neuronal PC12

cells that occurs after NGF deprivation. (A-F) Neuronal PC12 cell cultures were infected with

lentivirus expressing shTrib3 or shRNA against dsRed (control). 72 hours post infection, NGF

was removed for 16 hours and the neurons were lysed and lysates were subjected to SDS-PAGE

and immunoblotted using the antisera against phospho-Akt (pT308 and pS473), total Akt and

total ERK. Panel (A) shows a representative immunoblot. Protein levels quantified and

normalized against total ERK (B-D) and against total Akt (E-F).

61

Figure 2-6: Trib3 contributes to the decrease in Akt phosphorylation in SCG neurons after

NGF deprivation. (A-D) SCG neuron cultures were infected with lentivirus expressing shTrib3

or sh_dsRed (control). 72 hours post infection, NGF was removed for 16 hours and the neurons

were lysed and lysates were subjected to SDS-PAGE and immunoblotted using the antisera

against phospho-Akt (pT308 and pS473), total Akt and total ERK. Panels (A, C) show

representative blots. Panel (B, D) shows mean values for protein levels ± S.E. for 5-6

ERK pAKT(S473)

NGF Ctl

-NGF Ctl

-NGF shTrib3

ERK

pAKT(T308) Total AKT

0.0

0.5

1.0

Rela

tive

Prot

ein

Leve

ls

* *

pAKT(T308) Total AKT pAKT(S473)

NGF Ctl

-NGF shTrib3 -NGF Ctl

NGF Ctl

-NGF Ctl

NGF shTrib3

pAKT(S473)

pAKT(T308)

Total AKT

ERK

ERK

ERK

0.00

0.50

1.00

1.50

2.00

pAKT (S473)

Rela

tive

Prot

ein

Leve

ls

pAKT (T308) Total AKT

NGF Ctl -NGF Ctl NGF shTrib3

Figure 2-6

A. B.

C. D.

SCG Neurons

62

independent experiments, each normalized against total ERK. *p<0.05 compared to no NGF

control; Student’s t-test.

63

Figure 2-7: Trib3 expression is sufficient to reduce Akt phosphorylation. Neuronal PC12

cells (A, B) and SCG neurons (C, D) were infected with either control or Trib3 expressing

lentivirus and maintained with NGF. Five days after infection, cell lysates were subjected to

SDS-PAGE and immunoblotted using antibodies against phospho-AKT (pSer473 and pThr308),

total AKT and total ERK. Representative immunoblots are shown in panels (A) and (C); graphs

(B) and (D) show mean values ± S.E. for 4-6 independent experiments, in each case normalized

to ERK levels. *p<0.05; **p<0.005, compared to control; Student’s t-test.

pAKT (S473) ERK

Total AKT ERK

ERK

Control

ERK Trib3

pAKT (T308)

Trib3

0

0.5

1

Rela

tive

Prot

ein

Leve

ls

*

*

pS473 pT308 Tot AKT

Control Trib3

pAKT

pAKT (T308)

Total AKT ERK

ERK

Control Trib3

Trib3 ERK

0

0.5

1

Rela

tive

Prot

ein

Leve

ls

pS473 pT308 Tot AKT

* **

Control Trib3

Neuronal PC12 Cells

SCG Neurons

A. B.

C. D.

Figure 2-7

64

Trib3 regulates phosphorylation of the Akt substrate FoxO1a. The forkhead family of

transcription factors includes well-described substrates of Akt. In the presence of NGF, Akt

phosphorylates the forkhead family member FoxO1a at Ser256 and Thr24 and this promotes its

interaction with 14-3-3 proteins and sequestration in the cytoplasm [56, 58, 175]. Disruption of

NGF signaling and consequent dephosphorylation/deactivation of Akt results in FoxO1a

dephosphorylation, its dissociation from 14-3-3 proteins and its translocation to the nucleus [56,

58, 175]. Once in the nucleus, Foxo1a transactivates pro-apoptotic genes such as Bim and

contributes to neuron death [56, 63]. Because Trib3 induces Akt dephosphorylation when NGF

is withdrawn, Trib3 should play a significant role in regulating phospho-FoxO1a levels under the

same conditions. To test this idea, preliminary experiments were performed in neuronal PC12

cells. The cells were infected with lentivirus expressing control or Trib3 shRNA and then

examined for levels of phospho-FoxO1a 16 hours later. Western immunoblotting against

phospho-FoxO1a and total FoxO1a (Fig.2-8A) revealed that there is about a 50% decrease in the

levels of phospho-FoxO1a in response to NGF deprivation, but that this was fully rescued by

Trib3 knockdown (Fig. 2-8B-D). Findings were confirmed in sympathetic neurons that were

also subjected to the same conditions, which revealed that levels of phospho-FoxO1a fell by an

average of about 75% with NGF deprivation and control shRNA and that this was restored to an

average of only 20% loss after Trib3 silencing (Fig. 2-9A, B). There was an overall trend

towards elevation of total FoxO1a levels after NGF deprivation, but this was not significant, nor

was there a significant effect of Trib3 knockdown on levels of phospho-FoxO1a in presence of

NGF (Fig.2-9 C, and D).

65

In addition, to test whether Trib3 is sufficient to mediate apoptosis in neuronal PC12 cells and

SCG neurons by deregulating Akt substrates in the presence of NGF, FoxO1a phosphorylation

was examined in NGF-treated cell cultures infected with lentivirus expressing Trib3. This

resulted in an approximate 50% loss of FoxO1a phosphorylation in both systems with no

significant change in total FoxO1a levels (Fig. 2-10 A-D). Taken together, these findings show

that Trib3 significantly contributes not only to the fall in Akt phosphorylation triggered by NGF

withdrawal, but also to the consequent dephosphorylation of the Akt substrate FoxO1a.

66

Figure 2-8: Trib3 contributes to FoxO1a dephosphorylation in PC12 cells after NGF

deprivation. Neuronal PC12 cells (A-D) were infected with lentivirus expressing shTrib3 or

control shRNA. 72 hours post infection, NGF was removed for 16 hours and the cells were

lysed and lysates were subjected to SDS-PAGE and immunoblotted using the antisera phospho-

FoxO1a, total FoxO1a and total ERK. Panel (A) show representative blots. Protein levels

quantified relative to total ERK (B, C) and Total FoxO1a (D).

NGF NGF shTrib3

-NGF Ctl

-NGF shTrib3

NGF Ctl -NGF

pFoxO1a

Tot FoxO1a

ERK

0.0

0.5

1.0

1.5

2.0

pFoxO1a normalized to total ERK

NGF NGF Ctl

NGF shTrib3

-NGF -NGF Ctl

-NGF shTrib3

Rela

tive

Prot

ein

Leve

l

0.0

0.5

1.0

1.5

2.0

Total FoxO1a normalized to total ERK

NGF NGF Ctl

NGF shTrib3

-NGF -NGF Ctl

-NGF shTrib3

Rela

tive

Prot

ein

Leve

l

0.0

0.5

1.0

1.5

2.0

pFoxO1a normalized to total FoxO1a

NGF NGF Ctl

NGF shTrib3

-NGF -NGF Ctl

-NGF shTrib3

Rela

tive

Prot

ein

Leve

l

A. B.

C. D.

Figure 2-8

Neuronal PC12 Cells

67

Figure 2-9: Trib3 contributes to the decrease in FoxO1a phosphorylation in SCG neurons

that occurs after NGF deprivation. (A-D) SCG neurons were infected with lentivirus

expressing shTrib3 or sh_dsRNA (control). 72 hours post infection, NGF was removed for 16

hours and the neurons were lysed and lysates were subjected to SDS-PAGE and immunoblotted

using the antisera against phospho-FoxO1a, total FoxO1a and total ERK. Panels (A, C) show

representative blots. Panels (B-D) show protein levels quantified relative to total ERK. Mean

values for protein levels ± S.E. for 8 independent experiments (A, B) and 4 independent

pFoxO1a

ERK

ERK

NGF Ctl

-NGF Ctl

-NGF shTrib3

Tot FoxO1a

0.0

0.5

1.0

1.5

Rela

tive

Prot

ein

Leve

ls

pFoxO1a Tot FoxO1a

*

NGF Ctl -NGF shTrib3 -NGF Ctl

NGF Ctl

-NGF Ctl

NGF shTrib3

pFoxO1a

Tot FoxO1a

ERK

0.0

0.5

1.0

1.5

Rela

tive

Leve

ls o

f Pro

tein

s

pFoxO1a Total FoxO1a

A. B.

D. C.

Figure 2-9

NGF Ctl -NGF Ctl NGF shTrib3

SCG Neurons

68

experiments (C, D), in each case normalized against total ERK. *p<0.005 compared to no NGF

control, Student’s t-test.

69

Figure 2-10: Trib3 expression is sufficient to reduce phosphorylation of FoxO1a in

neuronal cells. Neuronal PC12 cells (A, B) and SCG neurons (C, D) were infected with either

control or Trib3 expressing lentivirus and maintained with NGF. 5 days after infection, cell

lysates were subjected to SDS-PAGE and immunoblotted using antibodies against phospho-

FoxO1a, total FoxO1a and total ERK. Panels (A) and (C) show representative blots; panels (B)

ERK pFoxO1a

Control

ERK Trib3

ERK

Trib3

Total FoxO1a

0

0.5

1

Re

lativ

e Pr

otei

n Le

vels

*

pFoxO1a Tot FoxO1a

Control Trib3

Total FoxO1a

Control Trib3 pFoxO1a

ERK

ERK

Trib3 ERK

0

0.5

1

**

Rela

tive

Prot

ein

Leve

ls

pFoxO1a Tot FoxO1a

Control Trib3

Neuronal PC12 Cells

SCG Neurons

B. A.

D. C.

Figure 2-10

70

and (D) show mean values ± S.E. for 4 independent experiments, in each case normalized to total

ERK levels. *p<0.05, N=4; **p<0.005 compared with control (Student’s paired t-test).

71

Trib3 promotes and is required for FoxO1a’s translocation to the nucleus in response to

NGF withdrawal. As described above, an indirect effect of NGF deprivation is the

dephosphorylation and consequent nuclear translocation of FoxO family members that drive

neuron death via transactivation of pro-apoptotic genes such as Bim [56, 63]. Neuronal PC12

cells were deprived of NGF for 16 hours and immunostained using total FoxO1a antibody. This

showed a more than 6-fold increase in the number of FoxO1a positive nuclei, confirming that in

my hands FoxO1a does indeed localize to nuclei in the absence of NGF (Fig 2-11A, D). Trib3’s

effect on FoxO1a phosphorylation warranted an investigation into whether Trib3 also affects its

nuclear translocation. First, neuronal PC12 cells were infected with Trib3 lentivirus in the

presence of NGF, which resulted in a nearly 5-fold increase in proportion of cells with detectable

nuclear FoxO1a (Fig. 2-11B, D). Thus, Trib3 expression is sufficient to drive nuclear FoxO1a

translocation. In order to determine whether silencing Trib3 would affect the nuclear

translocation of FoxO1a that occurs in response to NGF deprivation, endogenous Trib3 was

knocked down in neuronal PC12 cells. After 16 hours of NGF deprivation, nearly all cells with

control shRNA were positive for nuclear FoxO1a staining (Fig. 2-11C, D). This was nearly fully

prevented by knockdown of Trib3 (Fig. 2-11C, D). Thus, Trib3 is required for the pro-apoptotic

nuclear translocation of FoxO1a that occurs in response to NGF deprivation.

72

Figure 2-11

A.

B.

Ctl

Trib3

GFP FoxO1a Topro III

20μm 20μm 20μm

NGF

-NGF 15 hrs

FoxO1a FoxO1a + Topro III

20μm 20μm

73

C.

D.

GFP FoxO1a Topro III

NGF+Ctl

-NGF 16hrs +Ctl

NGF+shTrib3

-NGF 16hrs +shTrib3

20μm 20μm 20μm

0.0

50.0

100.0

%Ce

lls w

ith N

ucle

ar F

oxO

1a S

tain

ing

NGF - NGF pWPI Trib3 NGF Ctl

NGF shTrib3

-NGF shTrib3

-NGF Ctl

*

* *

*

*

74

Figure 2-11: Trib3 regulates FoxO1a Nuclear Translocation. (A) NGF withdrawal induces

nuclear localization of FoxO. Neuronal PC12 cells were either maintained in NGF or deprived

of NGF for 16 hours and then subjected to immunostaining for FoxO1a. ToproIII is used for

nuclear staining. NGF deprivation causes FoxO1a to translocate to the nuclei. (B) Trib3

overexpression promotes nuclear translocation of FoxO1a. Neuronal PC12 cells were infected

for 5 days with lentivirus expressing either Trib3 or eGFP only (control) while maintained with

NGF and then subjected to immunostaining for eGFP and FoxO1a. (C) Trib3 is required for

nuclear translocation of FoxO1a in response to NGF deprivation. Neuronal PC12 cells were

infected with lentivirus expressing shTrib3 or sh_dsRed (control) for 72 hours and were either

maintained with NGF or deprived of NGF for an additional 16 hours. Cells were immunostained

as indicated for GFP and FoxO1a. Scale bar = 20 µm. (D) Quantification of the effects of NGF

withdrawal and Trib3 on nuclear translocation of FoxO1a. Left-hand bars show the effects of

NGF withdrawal and middle bars show the effects of Trib3 over-expression on nuclear

translocation of FoxO1a with or without Trib3 over-expression. Right-hand bars show the effect

of Trib3 knockdown on FoxO1a nuclear translocation caused by NGF deprivation. Conditions

correspond to those in panels A, B and C, respectively. Between 30 to 84 nuclei were blindly

evaluated per culture. Values are means ± S.E. for three independent experiments. *p<0.001,

compared with either no NGF (left hand bars), pWPI control (middle bars) or –NGF control

(right hand bars); Student’s t-test.

75

Trib3 induction after NGF withdrawal requires FoxO transcription factors. FoxO

transcription factors participate in neuron death by transactivating pro-apoptotic genes, of which

Bim has been the most studied [63, 64]. Examination of the rat Trib3 promoter (using Gene

Promoter Miner ( http://GPMiner.mbc.nctu.edu.tw/) [176] revealed two putative binding sites

for FoxO transcription factors: ttTTGTTtgttt and gttTGTTTgtttt within the 3kb region upstream

of +1 initiation site. These binding sites look somewhat similar to the FoxO binding sites in

mouse and human genes, which is TTGTTTAC [177]. Therefore, it is possible that FoxO plays

a role in Trib3 regulation in the absence of NGF. This hypothesis was tested in NGF-treated

neuronal PC12 cells and sympathetic neurons that were infected for 3 days with lentivirus

expressing either control or a previously described shRNA targeting FoxO family members

including FoxO1a [178]. The relative Trib3 mRNA levels were quantified after an additional 16

hours with or without NGF. In both systems, FoxO silencing blocked the induction of Trib3

mRNA caused by NGF removal (Fig. 2-12A, B). Considering all the data so far, it is clear that

Trib3 is essential for nuclear translocation of FoxO after NGF deprivation and that FoxO is in

turn required for transcriptional induction of Trib3. This suggests that Trib3 and FoxO are

linked in a feed forward loop that is triggered by NGF withdrawal.

76

Figure 2-12: Regulation of Trib3 expression. (A, B) Induction of Trib3 in response to NGF

deprivation requires FoxO. Neuronal PC12 cells (A) and SCG neurons (B) were infected with

shFoxO or control shRNA expressing lentivirus for 72 hours. Cultures were maintained with or

without NGF for an additional 16 hours for PC12 cells and 24 hours for SCG neurons. Total

mRNA was isolated and quantitative PCR was performed using Trib3 primers. Rat alpha-tubulin

mRNA levels were used to normalize input cDNA. Values are means ± S.E. of three (A) and

one (B) independent experiments done in triplicate. §p<0.05; ¥p<0.005; compared to -NGF

control; Student’s t-test.

0

3

5

8

10

Rela

tive

Leve

ls o

f Trib

3 m

RNA

NGF shF

§

NGF -NGF NGF Ctl

-NGF Ctl

-NGF shF

0

2

4

Rela

tive

Lev

els

of T

rib3

mRN

A

NGF Ctl

-NGF Ctl

NGF shF

-NGF shF

¥

A.

B.

PC12 Cells

SCG Neurons

Figure 2-12

77

Akt deactivation triggers Trib3 induction and cell death. Akt activity is required for neuron

survival and Akt deactivation promotes neuron death in part by leading to FoxO

dephosphorylation and consequent translocation of FoxO to the nucleus where it transactivates

pro-apoptotic genes [56, 63]. Since the data above indicate that Trib3 is a FoxO target, it stands

to reason that loss of Akt signaling should be sufficient to induce Trib3 transcription. To test this

idea, neuronal PC12 cells were treated with two drugs (Triciribine and 3-formylchromone

thiosemicarbazone, Cu(II)Cl2 complex, also referred to as Akt inhibitor XI from EMD

Bioscience) that inhibit Akt phosphorylation by different mechanisms [179, 180]. In the

presence of NGF, concentrations of the drugs that block Akt phosphorylation (Fig. 2-13A)

caused cell death at levels similar to those achieved by NGF deprivation alone (Fig. 2-13B). The

drugs also led to a significant induction of Trib3 transcripts under these conditions and as a

positive control, it was found that there was an induction of Bim transcripts, as well (Fig. 2-13C).

These observations thus indicate that the suppression of Akt signaling is sufficient to promote

Trib3 induction, even in the presence of NGF. Because Akt and Trib3 appear to negatively

regulate one another, our findings suggest that the two are linked in a loop in which a decrease in

Akt activity leads to induction of Trib3 that in turn depresses Akt activity and so forth. Although

loss of Akt signaling may lead to activation of additional pro-apoptotic transcriptional pathways,

these findings are consistent with the idea that Trib3 expression is controlled by a pathway that

includes negative regulation by Akt and positive regulation by nuclear FoxOs.

78

Figure 2-13: Akt Inhibition Upregulates Trib3 mRNA. (A) Inhibition of Akt

phosphorylation by various inhibitors. Cell lysates of neuronal PC12 cells treated with various

concentrations of Triciribine, and compound XI in the presence of NGF for 20 hours were

subjected to SDS-PAGE and immunoblotted using antisera against phospho-Akt (pT308), total

Akt, and ERK. (B) Inhibition of Akt activity promotes cell death. Neuronal PC12 cells were

treated with the indicated concentrations of Akt inhibiting drugs for 20 hours while maintained

with NGF. Viable cells were then counted. Values are means ± S.E. of three independent

experiments each performed in triplicate. *p<0.05 (Student’s t-test), compared with

0

50

100

% V

iabl

e Ce

lls *

* *

NGF

-NGF

NGF 5 μM

Tri

NGF DMSO

0

15

30

45

60

Rela

tive

Leve

ls o

f mRN

A

Bim Trib3

¤

¤

¤

¤

NGF NGF NGF DMSO

NGF DMSO

NGF Tri

NGF Tri

NGF XI

NGF XI

NGF 10 μM

XI

Figure 2-13

A. B.

C.

pT308

Total AKT

NGF NGF

DMSO Tri

40µM Tri

20µM Tri

10µM Tri

5µM Xi

20µM Xi

10µM Xi

5µM

ERK

79

NGF/DMSO. (C) Akt inhibition induces Trib3 mRNA. cDNA derived from cultures treated as

in (D) were subjected to quantitative PCR using Trib3 and Bim primers. Rat alpha-tubulin

mRNA levels were used to normalize input cDNA. Values are means ± S.E. of three independent

experiments each performed in triplicate. ¤p<0.005, (Student’s t-test) compared with

NGF/DMSO.

80

The cell cycle and JNK pathways also appear to be required for Trib3 induction in

response to NGF deprivation. NGF deprivation leads to activation of multiple transcriptional

pathways that ultimately promote induction of pro-apoptotic genes. The most intensively studied

pro-apoptotic target is Bim for which induction involves at least 5 different transcription factors

and interference with any one of these pathways disrupts Bim induction by NGF deprivation [63,

64, 68, 74, 79]. Two such pathways include the JNK and apoptotic cell-cycle pathways [69, 74,

181]. c-Jun N-terminal kinases (JNKs) leads to c-Jun activation and c-Jun dependent Bim

transcription [79]. Furthermore, examination of the rat Trib3 promoter revealed in addition to a

potential FoxO binding site, sequences for potential binding of AP1/c-Jun and Myb. The binding

sequence identified for AP1/c-Jun is aTGACTca, which is very closely conserved in the human

TRIB3 gene as TGAGTCA [182]. Three binding sequences for Myb were identified, as well:

cAACTGtctgt, ccgtaCAGTTg and tAACTGagatt, two of which, appear to be conserved in the

Trib3 gene of other species, including in humans, as C/TAACG/TG [183]. To assess whether

this pathway is also required for Trib3 induction, Trib3 mRNA levels were measured in neuronal

PC12 cells deprived of NGF in the presence or absence of the JNK inhibitors SP600125 (JNKi)

[184] and D-JNKi-1 [185]. Both inhibitors blocked Trib3 induction caused by NGF withdrawal

(Fig. 2-14). In order to determine if the cell-cycle pathway is involved in Trib3 regulation,

PC12 cells were treated with two different Cdk inhibitors, flavopiridol [186] and roscovitine

[187]. They fully blocked Trib3 mRNA induction triggered by NGF withdrawal (Fig. 2-14).

These findings support the idea that induction of Trib3 by NGF deprivation, as in the case of

Bim, requires simultaneous activation of at least the FoxO, c-Jun and Myb transcriptional

pathways.

81

Figure 2-14: Inhibitors of JNK and Cdk4 suppress Trib3 mRNA induction in response to

NGF deprivation. Neuronal PC12 cells were treated with the Cdk4 inhibiting drugs roscovitin

and flavopiridol and the JNK inhibitors SP600125 (JNKi) and DJnkI1 in the presence and

absence of NGF for 16 hours. cDNA derived from the cultures was subjected to quantitative

PCR using Trib3 primers. Rat alpha-tubulin mRNA levels were used to normalize input cDNA.

*p<0.05, (four independent experiments performed in triplicate); **p<0.05, (two independent

experiments performed in triplicate) compared with –NGF control; Student’s t-test.

0

2

4

6

8

Rela

tive

Leve

ls o

f Trib

3 m

RNA

* * *

**

NGF NGF NGF NGF NGF -NGF -NGF -NGF -NGF -NGF Flavopiridol Roscovitin SP600125 DJnki 1

Naiive PC12

Figure 2-14

82

Discussion

NGF signaling via TrkA receptors is required for axonal growth, neuron survival and

proper innervation by sympathetic and a subpopulation of sensory neurons of their targets [23].

Its availability in limited supply during the latter part of development ensures that the correct

number of neurons is involved in synapse formation and that supernumerary neurons that fail to

form proper synapses are eliminated [8]. The intracellular processes leading up to neuron death

at this stage of development is not fully understood. The NGF deprivation model using neuronal

PC12 cells and primary neonatal sympathetic neurons is an effective tool for studying the

molecular mechanisms governing apoptosis; furthermore, since much of the mechanism is

conserved in both developmental and pathological death paradigms, unlocking the mysteries of

the former may help elucidate the mechanisms in the latter. To date a number of pro-apoptotic

genes have been studied, such as Bim, Hrk/Dp5, and EglN3/SM20 and their knockdown or

deletion revealed that only partial protection from NGF deprivation is achieved, indicating that

they are not fully accountable for mediating apoptosis [85, 87, 97]. One can certainly perform

experiments where all of the above mentioned genes are simultaneously deleted and examine

whether complete protection from NGF deprivation could be achieved; however, when Trib3

was reported to be upregulated in the NGF-deprivation model and that it can interfere with Akt

activity [113], it was important to follow up and determine its role in neuron death. The

characterization of novel pro-apoptotic factors is desirable in that there is the likelihood of

unveiling new mechanistic pathways within the apoptotic cascade. This is especially important

given the carefully controlled homeostasis of the neuron to ensure its survival; delineating the

83

functions of new genes can bring us closer to understanding how this homeostatic control is

perturbed.

Trib3 mRNA levels were significantly upregulated in PC12 cells and sympathetic

neurons, which was first reported by Mayumi-Matsuda and colleagues in 1999. This combined

with reports of Trib3’s broad range of functions in cells and stress conditions and its active role

in inducing apoptosis in non-neuronal cells, were instrumental in the decision to launch my

investigation to understand the role of Trib3 in NGF-deprived neurons. It was necessary to begin

by reproducing the results of others and determine whether or not Trib3 mRNA and protein

levels would be induced in my hands. Depriving neuronal PC12 cells and primary sympathetic

cultures of NGF over a few time points did indeed show that Trib3 is induced, both at mRNA

and protein levels; this was later confirmed by Kristiansen et al. [163]. These initial experiments

were also important for optimizing the culture conditions of our NGF-deprivation model in

which the follow up experiments were performed. Neonatal primary sympathetic cultures were

used because during this developing phase, they are completely dependent on NGF for survival

and undergo apoptosis in vivo. Neuronal PC12 cells were used because as mentioned earlier,

they mimic sympathetic neurons and are ideal for performing preliminary experiments.

The question of whether or not Trib3 is involved in neuronal apoptosis was finally

determined by endogenous Trib3 knockdown experiments in which significant protection from

death was observed in both cell culture types. Most impressively, the axons and processes of

NGF-deprived SCG neurons were protected from degeneration and the overall morphologies of

these neurons were maintained for a prolonged period nearly as well as those cultured in the

presence of NGF. Trib3’s ability to protect axons is significant because often in pathological

84

neuron death, the demise of the neurons is usually initiated with axon degeneration and thus,

protecting axons can potentially arrest neuron death [188].

Knocking down endogenous Trib3 did not confer full protection possibly because there

was a residual level of Trib3 still being expressed. Also the other transcriptionally upregulated

proteins such as Bim, Hrk/DP5, PUMA or SM20 can participate in apoptosis [85, 88, 94, 189].

Also, a recently transcriptome analyses under conditions of NGF deprivation revealed that

numerous other genes are upregulated and any number of these molecules can potentially induce

death [163]. Bim has been extensively studied in the NGF-deprivation model and was knocked

down in this set of experiments, as well. This protected neuronal PC12 cells to an extent that

was comparable to Trib3 knockdown 1 to 2 days after NGF deprivation, but afforded only

modest protection compared to Trib3 knockdown in sympathetic neurons. Since neither Trib3

nor Bim knockdown alone could afford complete protection, they were knocked down

simultaneously, which did not result in significantly increased protection compared to that seen

for Trib3 knockdown alone. This indicates that perhaps Trib3 and Bim are functioning along the

same apoptotic pathway in the neuron.

One fundamental feature of the pro-apoptotic genes studied so far, such as Bim, Hrk/Dp5

and SM20, is that they can induce death even when cultures were maintained in NGF [92, 95,

190]. Trib3, too, has proved to be sufficient in inducing death in the presence of NGF, asserting

itself as a bona fide pro-apoptotic protein. Unlike the cases of neuronal PC12 cells and SCG

neurons, overexpressing Trib3 in cortical neurons did not result in their death and this may be

because either Trib3 does not play a role in their apoptosis or that Trib3 plays a role only under

conditions of stress. This latter possibility may conform with the observations made by

85

Mayumi-Matsuda et al., who reported that Trib3 cDNA levels were elevated in cortical neurons

in response to Ca2+ ionophore excitotoxicity [113].

The present data indicate that Akt is a target of Trib3 in neurons. Trib3 is necessary for

Akt dephosphorylation in the absence of NGF and it attenuates phospho-Akt levels in the

presence of NGF. These experimental data from neuronal cells are in agreement with previous

reports in which Trib3 has been shown to interact with Akt and result in its dephosphorylation in

non-neuronal cell [130]. Akt phosphorylation at Ser473 and Thr308 residues is necessary for

full Akt activation and survival of the neuron [53]. Upon NGF stimulation of TrkA receptors,

Akt suppresses various pro-apoptotic molecules and pathways, such as FoxO transcription

factors that are phosphorylated and sequestered in the cytosol [56]. I found that FoxO1a is

deregulated by Trib3 during NGF withdrawal. This must be a consequence of Trib3 mediated

dephosphorylation of Akt. Trib3 knockdown rescued FoxO1a from dephosphorylation when

NGF was withdrawn and conversely Trib3 overexpression in the presence of NGF reduced the

levels of phospho-FoxO1a. In line with FoxO1a’s phosphorylation status dictating whether or

not the transcription factor will translocate to the nucleus, I found that Trib3 mediated

dephosphorylation of FoxO1 promoted its nuclear translocation, which was inhibited by Trib3

knockdown. Thus, the aforementioned findings regarding Trib3, Akt and its substrate FoxO1a

correlate with the observations that Trib3 knockdown is protective and that its overexpression is

deleterious for neuronal cells. As a form of programmed cell death, apoptosis resulting from

NGF deprivation requires that new transcription and translation events take place [1]. In the

absence of NGF, the FoxO, JNK, and apoptotic cell-cycle transcriptional pathways are among

several regulatory pathways that are activated, inducing pro-apoptotic genes [56, 63, 69, 79]. I

86

found that Trib3 is transcriptionally regulated by FoxO transcription factors in both neuronal

PC12 cells and sympathetic neurons. Treating neuronal PC12 cells with drugs that inhibit CDK4

and JNK activity, suppressed Trib3 mRNA induction in the absence of NGF, suggesting that

these pathways may be necessary, as well. The observations confirm reports made by

Kristiansen et al., where MLK inhibitor CEP-11004 suppressed Trib3 transcription during NGF

deprivation [163]. In the case of Bim, its induction requires the FoxO, JNK, apoptotic cell-cycle,

and NF-Y pathways [63, 64, 68, 74, 79]. Other pro-apoptotic genes, HRK/DP5 and SM20 are

transcriptionally upregulated by the JNK pathway [96, 170]. Thus, the results regarding Trib3

regulation in NGF deprived cells conform to this model and as predicted, show that Trib3 is

indeed in a feedforward loop with the FoxO transcription factors.

If Akt regulates FoxO activation and Trib3 is transcriptionally induced by FoxO, then

Akt deactivation must lead to Trib3 induction. As expected, treatment of neuronal PC12 cells

with Akt inhibiting drugs upregulated Trib3, showing that Trib3 is in a negative feedback loop

with Akt. Interestingly, Trib3 induction resulting from Akt inhibition was much greater

compared to what has been observed after NGF deprivation. This probably indicates that NGF

deprivation alone is not sufficient for complete Akt deactivation in the neuron. This is not

unusual because Akt phosphorylation and activation are not solely dependent on NGF/TrkA

activity. Akt can be phosphorylated in response to a number of growth factors and trophic

factors binding to their respective receptors and/ or Trk and both SCG neurons and PC12 cells

express many of the necessary receptors [43-46]. NGF deprivation may result in Akt

deactivation to a degree that is sufficient to induce Trib3 and initiate the apoptotic cascade.

87

Collectively, the experimental data lead to the formulation of a model delineating Trib3’s

mechanism in the neuron (Fig. 2-15). During NGF stimulation of TrkA receptors, Akt is

phosphorylated and inhibits its substrate FoxO via phosphorylation (A). NGF deprivation results

in an initial decrease in the level of phospho-Akt that leads to dephosphorylation of FoxO

transcription factors, leading to its nuclear localization (B). In the nucleus FoxOs transactivate

Trib3 and upregulated Trib3 binds to Akt, leading to further dephosphorylation and deactivation

of Akt, thus amplifying the effects of NGF deprivation (C). Due to the further inactivation of

Akt, activated FoxOs may reach a critical level at which they can induce other pro-apoptotic

genes, such as Bim that can play a more direct role in the mitochondrial intrinsic pathway,

followed by caspase activation and death (D).

88

Normal NGF signaling

During NGF Deprivation

A

B

Figure 2-15

A Model of How Trib3 May Mediate Apoptosis in Sympathetic Neurons Deprived of NGF

89

APOPTOSIS

Trib3 is induced and amplifies Akt deactivation

Downstream apoptotic genes activated

C

D

90

Thus, we see from the above model that there is a self-propelled pathway that amplifies

the initial stress caused by the absence of NGF. But why would such a self-amplification loop be

necessary? In the developing embryo, NGF is released in limited quantity by targets as the

immature SCG neurons begin to innervate them [39]. The SCG neurons become dependent on

NGF for survival and compete for its limited supply, which selects for the correct number of

neurons to match the size of their innervating target organ [8]. As we have discussed in chapter

1, NGF signaling closely regulates numerous intracellular events in the neuron via the PI3K/Akt

pathway in order to ensure survival and maturation, placing Akt at the helm of the survival

mechanism [23, 42, 43]. It is then logical that when a neuron fails to compete for its target-

derived NGF support, the quickest and most effective way to trigger the apoptotic event would

be to deactivate Akt. The model presented here describes the mechanism of Trib3 that is very

effective in rapidly amplifying Akt deactivation shortly after a loss in NGF signaling is detected

by the neuron, upsetting its homeostatic balance and inducing transcriptional mechanisms

necessary for the induction of downstream pro-apoptotic factors and apoptosis itself.

91

Chapter 3

Neuron Death in the Trib3 KO Mouse SCG

Introduction

A number of researchers have found that the Trib3 protein interferes with insulin

signaling by negatively regulating Akt phosphorylation and activation, leading to glucose

intolerance and insulin resistance [130, 151-153]. Under normal conditions, Akt is activated as

a result of insulin binding to its receptor and leads to Akt mediated phosphorylation and

suppression of gluconeogenic enzymes, PEPCK1 (phosphoenopyruvate) and G6P (glucose-6-

phosphatase) [40]. Akt also inhibits glycogen synthesis by phosphorylating and deactivating the

kinase GSK3β (glycogen synthase kinase-3 β). To understand the role of Trib3 in vivo,

Okamoto et al created Trib3 deletion mutant mice by substituting in a LacZ/neomycin cassette as

shown below (Fig. 3-1) [191].

When examined for body composition, insulin signaling, glucose and lipid metabolism, the

Trib3-/- mice showed no differences compared to their WT littermates [191].

Figure 3-1

Generation of Trib3-/- mice. Schematic diagram of the murine wild-type (WT) Trib3 allele and the targeting vector used to generate a null Trib3 allele by precise substitution of the lacZ reporter gene as well as a neo-selectable marker. Yellow boxes, homology boxes, homology boxes; red boxes, coding exons.

Okamoto et al. 2007

92

The group also showed that the glucose and glycogen levels after 24 hours of fasting

were normal and that administration of an insulin bolus resulted in a comparable increase in the

basal levels of phospho-Akt between the two genotypes; no differences in insulin-induced

GSK3β phosphorylation were observed either, indicating that Akt activity was not affected by

Trib3 deletion [191]. Previously, Trib3 overexpression was linked with the development of

glucose intolerance and a reduction in liver glycogen content [130]. Interestingly, a comparison

between WT and Trib3-/- mice revealed that under insulin fasted conditions, no differential

expression pattern in genes involved in hepatic glucose production can be observed; the genes

that were examined here include Pepck, G6p, and Pgc1α [191]. Liver glycogen levels were also

found to be comparable between these two genotypes, suggesting normal glucose metabolism

[191]. A link between Trib3 expression and lipid metabolism was described earlier, where Trib3

mediated degradation of ACC, an enzyme necessary for biosynthesis of fatty acids [149]. In

Okamoto el al., ACC levels were the comparable between the WT and mutant mice; moreover an

examination of the expression levels of genes involved in regulation of fatty acid oxidation, such

as Pparα, Pgc1α and Ucp1, failed to reveal any dissimilarities [191]. Because they did not

observe any deviation in Akt phosphorylation, activity and in glucose or energy homeostasis in

these Trib3-/- mice compared to the WT littermates, the authors concluded that loss of Trib3 was

insufficient to modify glucose and lipid metabolism; however, they maintained that it may still

be possible that Trib3 is important in other contexts and proposed that Trib3-/- mice be utilized

in examining the consequences of Trib3 ablation in various stress conditions [191]. This was of

interest for two reasons: one, the group did not examine the effects of Trib3 deletion in the

nervous system, or at least did not report any observations regarding the nervous system and two,

developmental PCD in SCG does result from stress conditions arising from trophic factor

93

deprivation. Since my experimental data so far have demonstrated that Trib3 is necessary for

developmental neuron death in cell culture models, it was important to ask what effect Trib3

deletion would have on the level of apoptosis in SCG neurons in vivo. Unlike what had been

observed in caspase-3 and -9 knockout mice, sometimes deleting a proapoptotic gene can have

subtle effects that are not readily discernible. For example, Bax deletion did not produce any

grossly abnormal phenotype in mice; however, a close examination revealed that the SCG

contained supernumerary neurons that underwent apoptosis at a slower rate in culture without

NGF; moreover, their soma were half the size of WT neurons [101]. Therefore, it is possible that

the rate or extent of apoptosis in Trib3 knockout SCG neurons will deviate significantly from

that of the WT neurons.

Hypothesis

If Trib3 is necessary for inducing death in cell cultures after NGF deprivation,

developmental death in Trib3 knockout sympathetic neurons may be aberrant or proceed

at a slower rate. Neuron death is delayed in sympathetic neurons from Bim, Dp5, SM20 and

Bax knockout mice without resulting in gross deformities [85, 87, 97, 101]. Therefore, Trib3-/-

can potentially affect the rate or level of developmental PCD in these neurons in vivo without

giving rise to any noticeably abnormal phenotype. My experimental data show that the loss of

Trib3 does not appear to alter the extent of developmental PCD in mouse SCG neurons in vivo.

94

Results

Trib3 deletion does not appear to alter the extent of apoptosis in developing SCG neurons.

In mice and rats, SCG neurons become exclusively dependent on NGF for their survival

beginning at approximately ages E15 and E12-13, respectively and this dependency on NGF

reaches its peak during the neonatal stages of life [39, 192, 193]. PCD occurs in the neonatal

mice and rats as the neurons compete for a limited supply of target derived NGF [194, 195]. In

order to examine whether Trib3 deletion would alter this normal course of development, SCG

neurons from both WT and mutant mice were analyzed at age P1 (postnatal) and P7. DNA

strand breaks occur during the final stages of apoptosis and results in phosphorylation of

histone2A; using anti-sera against phospho-H2AX gives positive staining in neurons that are

undergoing apoptosis and therefore, serves as an effective marker for identifying apoptotic

neurons [196]. 5 µm thick sections of the right and left superior cervical ganglia were

immunostained against phospho-H2AX protein (Fig. 3-2A, B). The densities of apoptotic

(pH2AX positive) neuron population were determined and plotted (Fig. 3-2E). When compared

with WT mice, the Trib3-/- SCG displayed no significant differences in the density of apoptotic

sympathetic neurons at both ages (Fig. 3-2E). These observations suggest that Trib3-/- SCG

neurons are able to undergo developmental apoptosis just as well as the WT SCG neurons.

95

WT Trib3 KO

pH2AX Staining

H & E Staining

B.

C. D.

A.

Figure 3-2:

0

50

100

Dens

ity o

f Apo

ptot

ic N

euro

ns

Null P7

WT P7

Null P3

WT P3

E.

96

Figure 3-2: Trib3 deletion does not affect the extent of apoptosis in developing SCG

neurons. Both the right and left SCG from neonatal (P3 and P7) mice were sliced into 5 µm

thick sections. 25 such sections were made obtained from each ganglion and every 5th section

was stained with hematoxylin and eosin. The remaining 20 sections were immunostained with

an antibody against phosphophorylated H2AX protein in order to identify sympathetic neurons

undergoing apoptosis. All pH2AX positive neurons were counted in each section, excluding any

neurons that appeared in the previous section and already counted in order to avoid counting

them twice. The sum of pH2AX positive neurons from all 20 sections of a single ganglion was

then divided by the sum of the area of all 20 sections in order to normalize to the area and

determine the density of pH2AX stained neurons. Panel (E) represents mean density values ±

S.E. n=8 for P3 and n=3 for P7 animals.

97

Discussion

An examination of superior sympathetic ganglionic sections of WT and Trib3-/- mice failed

to show any differences in the numbers of apoptotic neurons at ages P3 and P7. These in vivo

results are in contrast with the in vitro data presented in Chapter 2, where cultured WT rat SCG

neurons required Trib3 in order to undergo apoptosis in the absence of NGF. This apparent

discrepancy could be due to compensatory mechanisms. Compensation in gene function is not

uncommon in biological systems and a good example of this phenomenon is caspase-2. RNAi

knockdown of caspase-2 protected SCG neurons from NGF deprivation, whereas a genetic

deletion did not [109]. The caspase-2 null neurons underwent apoptosis as usual, employing a

compensatory mechanism, in which the caspase-9/caspase-3 pathway was activated [109]. The

Trib3-/- sympathetic neurons appeared to undergo apoptosis as well as the WT neurons, but what

may account for it? Though I have not examined the levels of phospho-Akt in these neurons,

Okamoto et al. have in liver cells after insulin injection and reported no alterations [191]. It is

highly probable that Akt phosphorylation and dephosphorylation events are taking place in the

mutant neurons just as well as in the WT neurons. Therefore, a limited supply of NGF is

effectively triggering the apoptotic cascade in the neonatal SCG neurons most likely via Akt

dephosphorylation as one would expect. In the absence of Trib3, this may be being

accomplished by other proteins. As discussed in Chapter 1, Akt activation is regulated by a

number of proteins and kinases that can enhance or suppress Akt by either binding to Akt or by

post-translationally modifying it. One such protein is CTMP (carboxy-terminal modulator

protein). It is a 27 kDa protein that has been shown to bind Akt at its c-terminus region, which

include the HM (hydrophobic motif) and c-term phosphorylation site [40, 197]. CTMP’s

98

interaction with Akt resulted in dephosphorylation of both the T308 and S473 residues and

sensitized HeLa and HEK293 cells to apoptosis even in the presence of insulin or IGF-1 [197].

Thus, CTMP could potentially replace Trib3 in the mutant sympathetic neurons and mediate

apoptosis.

Aside from showing that Trib3 can bind with Akt and promote its dephosphorylation, Du et

al. reported that a second member of the mammalian Tribbles family, Trib2, can bind Akt and

result in its dephosphorylation, as well [130]. Trib2 was never reported by anyone as being

involved in cell death and has been shown to be involved in cancer cell metastasis [118]. In any

case, it is also possible that Trib2 is compensating for Trib3 deletion in the neurons.

Another source of compensation could involve factors that normally play an auxiliary role in

regulating Akt. Non-receptor tyrosine kinases, such as Ack1 and Src, can phosphorylate various

tyrosine residues on Akt, which are thought to induce a conformational change in Akt and

enhance its phosphorylation at the T308 and S473 residues [59]. There are also a number of

serine/threonine kinases, such as IKBE, TBK1 and DNA-PK, that can phosphorylate Akt on

various threonine and serine residues including the all-important T308 and S473 residues directly

in a PI3K-independent manner [59].

Figure 3-3

Schematic representation of multiple phosphorylation sites in AKT targeted by various kinases.

Mahajan 2012

99

Under normal conditions, some of these kinases are thought to work as backups in their abilities

to directly phosphorylate the T308 and S473 sites independently of PI3K; nonetheless they

provide additional controlling mechanisms for Akt activation and deactivation. In a mutant cell

lacking a necessary gene for Akt deactivation, such as Trib3, these kinases can potentially play a

more prominent role as they respond to lack of trophic support by being deactivated themselves

and failing to promote Akt phosphorylation and activation, leading to apoptosis.

Kinases are not the only molecules to regulate Akt activation; phosphatases also play a

key role. A well-defined phosphatase that dephosphorylates Akt is PP2A (protein phosphatase

2A) [43, 198]. PP2A consists of a catalytic, a regulatory and an array of substrate specificity

subunits known as subunits B [43]. Together, these subunits form trimeric holoenzymes that can

be of 75 different types, depending on the type of B subunit that participates in the complex;

thus, enabling PP2A to target a wide variety of substrates under various conditions [43]. Akt is

targeted by PP2A usually as a result of p75NTR stimulation and dephosphorylates the T308 and

S473 residues [43]. It is a possibility that PP2A molecules are playing an important role in

dephosphorylating Akt in Trib3-/- sympathetic neurons in vivo when they fail to compete for

NGF.

Finally, there is also the possibility that Trib3 does not play a role in neuron death in vivo.

Neurons grown in the artificial environment of cell-culture dishes may not behave the same way

as in the natural environment within a biological system and Trib3 may play an important role in

vitro only. The aforementioned molecules may compensate for Trib3 in vivo because Trib3 is

truly necessary but absent, or they may function in vivo as they normally do regardless of Trib3’s

involvement. An alternate method can be utilized, one that may provide little opportunity for

100

compensation, in order to clarify whether or not Trib3 is truly necessary in vivo. This will be

discussed in chapter 5.

101

Chapter 4

Preliminary Evidence that Trib3 is Involved in Neurodegenerative Diseases

Introduction

Parkinson’s disease (PD) and Alzheimer’s disease (AD) are progressive

neurodegenerative diseases consisting of both sporadic and familial forms [21, 188]. In PD there

is a progressive loss of midbrain dopaminergic (DA) neurons from the substantia nigra pars

compacta (SNpc) with an accumulation of intracellular inclusions called Lewy bodies [188].

Neurons in other structures of the PD brain, such as the locus coeruleus, cerebral cortex, and

amygdala and the peripheral sympathetic ganglia also exhibit Lewy bodies [188, 199]. In

patients, PD manifests itself as impaired motor function due to resting tremor, rigidity,

bradykinesia, abnormal posture and gait, symptoms known as cardinal motor symptoms [200].

In advanced stages of PD, patients may develop non-motor symptoms, such as sleep

disturbances, anxiety, depression and cognitive decline [200]. While specific gene mutations

that are associated with familial PD are in process of being characterized, the most common

form, sporadic PD, has no proven etiology [164, 201]. However, environmental factors such as

pesticide exposure, rural living and well water consumption have been identified by

epidemiological studies to be risk factors for developing sporadic PD [164]. In laboratories,

sporadic PD is studied using toxin-based animal and cell culture models. These toxins included

MPTP (1-methyl-4-phenyl-12,3,6-tetrahydropyridine) and 6OHDA (6-OHDA) both of which

cause almost complete destruction of SNpc and catecholaminergic neurons and Parkinsonian

symptoms in animal models [164, 199, 201, 202]. These molecules induce apoptosis by

102

respiratory poisoning in that they disrupt complex I and other components of the ETC (electron

transport chain) of mitochondria, resulting in oxidative stress [164, 201, 202]. The relevance of

toxin-based cell culture models, which also include neuronal PC12 cells, to PD are supported by

biochemical and histological studies of post mortem PD brain, where there is evidence of

decreased complex I activity and oxidative stress in the SNpc neurons [55, 202]. In one such

toxin-based study, SAGE (serial analysis of gene expression) procedure revealed there was an

induction in Trib3 mRNA levels in PC12 cells after treatment with 6OHDA, suggesting Trib3

may be involved in Parkinsonian neurodegeneration [164].

AD is characterized by formation of neurofibrillary tangles and Aβ (amyloid-β) plaques,

resulting in death of the cholinergic neurons of the basal forebrain and in development of

cognitive impairments [21, 24]. Aβ plaques are evident in both familial and sporadic forms of

the disease and the principal constituents of amyloid deposits are Aβ1-42, which is derived from an

abnormal processing of the amyloid precursor protein (APP) that is normally present in the

neuron [24]. Aβ1-42 production causes the formation of fibril aggregates that increase in size,

ultimately forming plaque-like deposits that lead to apoptosis. The cellular mechanisms leading

to neuron loss in the AD brain can be reproduced in laboratory settings by treating neuronal

PC12 cells or primary cultures of cortical or hippocampal neurons with Aβ1-42 preparations [203].

As discussed in Chapter 1, pro-apoptotic molecules and their associated pathways that lead to

pathological death are often conserved in developmental neuron death. The pro-apoptotic Bim

plays a significant role in both NGF deprivation-related death and is elevated in neurons from

AD brain and in AD culture models [85, 168]. Another pro-apoptotic molecule, Hrk/DP5

promotes death after motor neuron injury and in ALS (Amyotropic Lateral Sclerosis) well as in

103

response to NGF deprivation and requires the JNK pathway for activation [88, 169, 204].

Similarly, since Trib3 has been proven to be an integral part of the apoptotic cascade in the NGF-

deprivation model of developmental death and is induced in a PD toxin model, it may possibly

play a role in the Aβ model, as well. Therefore, I proceeded to explore, in preliminary

experiments, the role of Trib3 in two pathological neuron death paradigms.

Hypothesis

Trib3 plays a role in apoptosis resulting from 6OHDA and Amyloid β toxicity. Trib3

mRNA levels are upregulated in response to 6OHDA treatment in neuronal PC12 cells as

revealed by SAGE [164] . Many factors that are involved in NGF deprivation-related death are

involved in pathological neuron death, as well. Therefore, it is also possible that Trib3 is

involved in both developmental and pathological neuron death. My preliminary findings support

this idea by showing that Trib3 is induced in cellular models of PD and AD and is necessary for

mediating death in these models.

Results

Trib3 is involved in pathological neuron death

This hypothesis was tested in the following manner: neuronal PC12 cells were treated

with various concentrations of 6OHDA for 10 hours (Fig. 4-1A) or amyloid β for 20 hours (Fig.

4-1B). Quantitative PCR revealed that Trib3 transcript levels increase by approximately 4 fold

with 6OHDA treatment and about 2.5 fold following amyloid β treatment. In order to determine

whether Trib3 was necessary for inducing apoptosis in these cell death paradigms, endogenous

104

Trib3 was knocked down in neuronal PC12 cells prior to treatment with 6OHDA or an Aβ

dodecamer preparation (Fig. 4-1 C, D). Knocking down Trib3 conferred significant protection

from death in these cells: the number of apoptotic cells resulting from 6OHDA toxicity was

greatly reduced (Fig. 4-1C) and the number of viable cells in cultures treated with amyloid β

dodecamer remained plentiful (Fig. 4-1D). Thus, Trib3 plays a necessary role in pathological

neuron death in cellular models of Parkinson’s and Alzheimer’s diseases.

105

Figure 4-1

0

1

2

3

4

Untreated 50μM 6OHDA

75μM 6OHDA

100μM 6OHDA

Rela

tive

Leve

ls o

f Trib

3 m

RNA

A.

0

1

2

3

Vehicle 10μM Aβ

Rela

tive

Leve

ls o

f Trib

3 m

RNA

B.

*

Ctl shTrib3 0

25

50

% A

popt

otic

nuc

lei

C.

0

50

100

150

Num

ber o

f Via

ble

Cells

Vehicle Ctl

10μM Aβ Ctl

10μM Aβ

shTrib3

*

Untreated Ctl

D.

106

Figure 4-1: Trib3 is involved in pathological neuron death. (A, B) Trib3 is induced in AD

and PD toxin models. Neuronal PC12 cells were treated with indicated concentrations of

6OHDA for 10 hours (A) or 10 µM Aβ dodecamer for 6 hours (B). Total mRNA was isolated

and subjected to reverse transcription followed by quantitative PCR using Trib3 primers. Rat

GAPDH and alpha-tubulin mRNA levels were used to normalize input cDNA. The data are

reported as relative increase in mRNA levels normalized to NGF control in a single experiment.

(C, D) Trib3 is necessary for death induced by 6OHDA and Aβ toxicity. Neuronal PC12 cells

were transfected with either control shRNA (sh_dsRed) or shRNA against Trib3 for 48 hours

followed by treatment with 100 µM 6OHDA for 18 hours while maintaining them in NGF. Cells

were then fixed with 3.7% formaldehyde and stained with Hoechst 33342 dye. Transfected

(GFP+) cells with pyknotic nuclei were counted in random fields under an epi-fluorescent

microscope and the percentage of apoptotic cells determined. (C) Mean values of three

independent experiments done in triplicate are plotted ± S.E.; *p<0.05. Neuronal PC12 cells

were infected with lentivirus expressing either control shRNA (sh_dsRed) or shRNA against

Trib3 for 72 hours followed by treatment with 10 µM Aβ dodecamer preparation or vehicle for

48 hours while maintaining them in NGF. Cells were then lysed and the numbers of intact nuclei

were counted and percentage of viable cells determined. (D) Mean values of three independent

experiments done in triplicates are plotted ± S.E.; *p<0.05.

107

Discussion

Administration of the PD toxin 6OHDA or Aβ1-42 fibrils to neuronal PC12 cells resulted

in an appreciable increase in the Trib3 transcript levels as predicted, and confirms the

upregulation of Trib3 mRNA in the 6OHDA toxin model as reported in Ryu et al. [164].

Furthermore, it is presented here that Trib3 is indeed necessary for inducing apoptosis in both the

PD and AD models of neuron death. In the SAGE study, there are reports of several other genes

becoming induced, including ATF4 and CHOP, two well-established transcriptional inducers of

Trib3 [131, 133, 134, 164]. This is not surprising since 6OHDA toxicity also leads to ER stress

and elicits the UPR [205]. As discussed in Chapter 1, numerous researchers have already

reported that both CHOP and ATF4 act together to induce Trib3 during ER stress in various non-

neuronal cells [131, 133, 134]; therefore the data presented here are in agreement with previous

findings and appear to suggest that Trib3’s induction in response to 6OHDA may be

transcriptionally regulated by ATF4 and CHOP. It is possible that, similarly to what I observed

with NGF deprivation, Trib3, ATF4, and CHOP are acting in a self-regulatory manner in

neuronal cells treated with 6OHDA [131, 133, 134].

Trib3 is induced and appears to be necessary for death in Aβ1-42 in vitro model of AD,

providing support for Trib3’s possible involvement in Alzheimer’s disease and warrant further

investigation. That Trib3 should be involved in neuron death both during development and

Alzheimer’s disease is not unusual because Bim, an intensively studied pro-apoptotic protein,

has been reported to induce apoptosis in both paradigms, as well [168]. Furthermore, the

apoptotic cell-cycle pathway that appears to regulate Trib3 during NGF deprivation and may do

so in AD model, as well since the pathway has been shown to transactivate Bim in response to

108

Aβ1-42 treatment [168]. This chapter presented preliminary experimental findings that show that

Trib3 is involved in cell culture models of neurodegenerative disease. These preliminary results

have prompted other collaborating researchers to pursue this line of investigation, which will be

discussed briefly in Chapter 5.

109

Chapter 5

Conclusions and Future Directions

Trib3’s Involvement in Developmental Death of SCG Neurons

Developmental death resulting from a limited supply of NGF is a necessary process by

which superfluous neurons are eliminated, allowing formation of precise and functional target

innervation [8, 9]. The apoptotic process leading up to this neuron death is complex and requires

de novo transcription and translation of numerous genes and activation of various pathways [1].

Using the in vitro NGF-model, which has been instrumental in identifying and elucidating

various pro-apoptotic proteins and their associated pathways, the experimental data presented

here demonstrate that Trib3 is a novel neuronal pro-apoptotic gene. It employs a mechanism

involving Akt and FoxO, in which the initial apoptotic signal is rapidly amplified, leading to

death. In targeting Akt, Trib3 deregulates and activates its effector FoxO, which in turn results

in further upregulation of Trib3, Akt deactivation and FoxO activation, leading to FoxO-

dependent induction of downstream pro-apoptotic genes and apoptosis. This model would

explain how suboptimal levels of NGF during development would be detected by the neuron and

readily initiate the apoptotic cascade. The data also raise a number of questions and possibilities

for future experiments. First, simultaneous knockdown of Trib3 and Bim did not afford

significantly greater protection from death than Trib3 knockdown alone and therefore it was

concluded that they may be working along the same pathway. Also, since FoxOs can induce

Bim when NGF is withdrawn [63, 64], my data regarding Trib3’s ability to mediate FoxO1a

activation support the idea that Trib3 and Bim may be functioning along the same pathway. Bim

110

is transcriptionally regulated by FoxO and Trib3 activates FoxO and induces its nuclear

localization [63]; therefore it appears that Trib3 is functioning, at least in part, upstream of Bim

induction. This hypothesis can be tested by knocking down endogenous Trib3 in neuronal PC12

cells or SCG neurons, withdrawing NGF and examining what happens to Bim protein levels.

Bim is highly induced in response to NGF withdrawal [85] and if Bim is indeed being indirectly

regulated by Trib3, then the increases in its transcript and protein levels that occur after NGF

deprivation should be suppressed.

NGF deprivation for 16 to 18 hours causes approximately 50 percent of neuronal PC12

cells and SCG neurons to undergo apoptotic death in culture [101]. It has been shown here that

Trib3 is required for this apoptosis. Curiously, it was observed that 6 days of Trib3

overexpression was required to reach a 50 percent decrease in viability of SCG neurons. This

delay is also observed in the rate of Akt and FoxO1a dephosphorylation (Fig 7 and 10) by Trib3

in the presence of NGF and no doubt correlates with the rate of death. The question that is raised

is why is there a delay? A potential explanation may be that as NGF deprivation brings about a

significant change in neurons by activating certain genes and pathways while suppressing others,

the conditions lead to some sort of modification of Trib3 protein. This could be either a post-

translational modification or an enhanced interaction with a binding partner of some sort, leading

to increased activity. The physiologic conditions during NGF deprivation may be more

permissive for Trib3 to become modified in a way that affects its activity and this may lead to the

deactivation of Akt with increased efficacy. Trib3 has been reported to become post-

translationally modified in muscle cells subjected to chronic exposure to ethanol. These cells

displayed hypoacetylated Trib3, reduced levels of Akt dephosphorylation and insulin resistance

111

[153]. Whether or not Trib3 is post-transnationally modified in the absence of NGF can be

tested by subjecting the cell lysates of NGF deprived SCG neurons to two-dimensional protein

electrophoresis followed by immunoblotting with anti-Trib3. Trib3 also has quite a few binding

partners and it is speculated that it functions as an adaptor or scaffolding protein in that it utilizes

its trb domain to bind and recruit various proteins to form a functional complex (Boudeau 2006)

[206]. Thus, it is also possible that Trib3 recruits factors that are induced or become available

following NGF deprivation and that formation of such a multimeric complex effectively leads to

Akt dephosphorylation. In the presence of NGF, such a permissive environment may be slow to

be achieved and an excess level of exogenous Trib3 is not as efficient. Therefore, ectopic

expression of Trib3 is sufficient in recapitulating apoptotic events in SCG neurons albeit at a

slower pace. The nature of any possible binding partners for Trib3 other than Akt would be a

worthwhile topic for future investigations and can be performed by utilizing a yeast-two hybrid

assay using cDNA library of NGF-deprived neuronal PC12 cells and/or SCG neurons.

As discussed in Chapters 1 and 2, one of the hallmarks of trophic factor deprivation-

related apoptosis is the activation of various transcriptional pathways and blocking these

pathways protects neurons from death [1]. This point has also been demonstrated in this body of

work by showing that Trib3 induction requires FoxO and appears to be regulated by the JNK and

the apoptotic cell-cycle pathways. This investigation was also initiated in part because an

examination of a 3kb region upstream of the +1 site of Trib3, showed that the regions contains

putative binding sites for FoxO, AP-1, and mybs, some of which are conserved in mice and

humans. One way to pursue this topic further would be to examine whether or not the

transcription factors do indeed bind to Trib3’s promoter. This can be done using chromatin-

112

immunoprecipitation assays. Furthermore, the roles of the newly emerging transcription

pathways, NF-Y and p53/p63/p73 [66, 68, 81], in inducing Trib3 should also be examined,

which can be accomplished by knocking down the transcription factors associated with these

pathways, namely NF-Y, p53 and p63, and observing the effect on Trib3 transcription in the

absence of NGF. A luciferase reporter (Renilla luciferase cDNA spliced at the 3’ end of the

Trib3 promoter) assay, which was instrumental in understanding Bim regulation [64], would be

very effective in examining the direct actions of the transcription factors under physiologic

conditions in NGF-starved neuronal PC12 cells.

Trib3 Deletion and its Effect in Developmental Death in vivo

An examination of neuron death in the superior cervical ganglia of Trib3-/- mouse [191]

was included in this study because it provided an opportunity to examine the role of Trib3 in

developmental death in vivo. No apparent differences in the extent of apoptosis could be

observed in the SCG neurons of the mutant versus the WT mice. There may be two

explanations for this: one, the Trib3 gene is not necessary in vivo in mice for inducing NGF

deprivation-related developmental death or two, Trib3 may be necessary, but a genetic

compensation of some sort has occurred. At present, it cannot be concluded with certainty that

Trib3 is not necessary for mediating developmental death in vivo. An alternate method should be

employed in examining the significance of Trib3 in vivo. Conditional knockouts would be an

ideal method in that the gene can be deleted with ease during the neonatal stage of natural PCD

and the effects can be observed shortly after the deletion, leaving little opportunity for the system

to compensate. For this, transgenic mice with loxP-Trib3 and tamoxifen induced Cre

recombinase can be constructed. Trib3 can be deleted specifically in adrenergic neurons, such as

113

those in the SCG, by placing the expression of the Cre recombinase under the control of the

DBH promoter (dopamine β-hydroxylase) [207].

Trib3’s Potential Involvement in Neurodegenerative Diseases

Developmental apoptotic processes are often recapitulated in neurodegenerative diseases

and I have presented data showing that Trib3 is required in the 6OHDA and Aβ models of

neuron degeneration. My collaborators, Drs. Pascaline Aime and Paulette Bernd, have found

that Trib3 protein is upregulated in primary ventral midbrain (VM) DA neuron cultures after

treatment with lethal concentrations of MPP+ and 6OHDA toxins and after α-synuclein fibril

treatment; α-synuclein protein is a major constituent of Lewy bodies in PD neurons and use of

their fibril in cell culture makes an effective PD model [208]. Furthermore, there is elevated

Trib3 staining in DA neurons of the SNpc in patients with PD. Dr. Aime’s data have also

extended my findings that Trib3 shRNA protects in PD toxin models. In preliminary studies, Dr.

Bernd has also found that Trib3 staining is evident in the CA1, frontal cortex and choroid plexus

of human control and AD brains, suggesting that elevated Trib3 expression may correlate to

susceptibility to neuron death in AD. Another collaborating scientist, Dr. Subhas C. Biswas, has

recently confirmed my findings by showing that shRNA against Trib3 can protect cortical

neurons from Aβ1-42 toxicity. Additionally, I have shown in chapter 2 that Trib3 knockdown is

very effective in protecting neuron morphology and processes even after a week of NGF

deprivation. This may have very important implications for neurodegenerative diseases. In PD,

for example, axon degeneration precedes death of the soma; and therefore, it is widely

acknowledged that halting axon degeneration may be a more effective method for preventing

neuron death [188]. Taken together the data presented in this thesis and the preliminary findings

114

of my collaborators are very encouraging and the role of Trib3 in PD and AD warrants further

examination.

As for the mechanism that may be employed by Trib3 in these death paradigms, Akt may

prove to be a target. 6OHDA toxicity has been shown to result in Akt dephosphorylation in both

neuronal PC12 cells and SCG neurons [55]. In AD, NGF deprivation is considered to be an

etiological factor for the sporadic form as researchers have shown that there is increased

amyloidogenic processing of APP and Tau phosphorylation in the absence of NGF [24]. In cell

culture models consisting of PC12 cells and Hippocampal and cortical neurons, NGF signaling is

protective against Aβ1-42 induced neurodegeneration [209].

Furthermore, attenuated insulin and/or IGF-1 signaling has been linked to development of AD

pathology in cell-culture models, laboratory animals and AD patients [210-212]. It has been

shown that insulin resistance and activated GSK3β leads to increased Tau phosphorylation,

neurofibrillary tangles and Aβ plaque formation. Because of these effects, AD has also been

referred to as brain specific type III diabetes [213]. As discussed in chapter 1, GSK3β is a

substrate of Akt and Akt activity inhibits GSK3β via phosphorylation. Insulin, IGF-1 and NGF

signaling all require the canonical signal transduction pathway involving PI3K/Akt; therefore,

Akt phosphorylation and activation may play an important role in AD pathogenesis. Research

has revealed that hippocampal neurons of PS1xAPP transgenic mice display show low levels of

phosphorylated Akt and GSK3β as disease progresses and is accompanied by elevated levels of

Bim and Bad [212]. Aβ1-42 in cell-culture can block insulin/IGF-1 receptor mediated activation of

PI3K/Akt, inhibit NGF stimulation of TrkA signaling and result in GSK3β dephosphorylation

and activation (Jimenez 2011). On the other hand, researchers have reported increased levels of

115

phospho-Akt in AD neurons as a result of Aβ1-42 dependent stimulation of insulin and IGF-1

receptors (O, Neil 2012). One study revealed that neurofibrillary tangle harboring neurons of

AD brains also display increased levels of phospho-Akt and phospho-GSK3 β; this is thought be

a response elicited by neurons in order to reduce GSK3 β activity (Pei 2003). Thus the

regulation and consequences of Akt activation appears to be a complex matter in AD models and

AD brain and it should be investigated whether or not Trib3 plays any role in this.

Another potential future endeavor would be to examine the transcriptional pathways by which

Trib3 may be regulated during neurodegeneration. ATF4 and CHOP are activated following PD

toxin administration and the apoptotic cell-cycle pathway regulates gene induction in response to

Aβ toxicity [164, 168, 205]. It can be explored whether Trib3 upregulation in PD is mediated by

ATF4-CHOP and whether the apoptotic cell-cycle pathways may also contribute to inducing

Trib3 in AD models. Since Trib3 appears to play a significant role in in vitro models of

neurodegenerative diseases, namely PD and AD, understanding how it is regulated

transcriptionally may provide targets for therapeutic interventions.

116

Final Remarks

The ongoing search for additional pro-apoptotic genes has led researchers to take notice of the

serine-threonine-like pseudokinase Trib3. The protein has a remarkably wide range of functions

that are cell-type and context specific. These functions of Trib3 include regulating energy

metabolism and mediating cell death or promoting survival in non-neuronal cells depending on

the type of stress. To this list of activities we can now include its ability to induce neuronal

apoptosis that is evident during development and in neurodegeneration. The findings regarding

Trib3’s role in neuron death have enabled us to gained additional insight into the mechanism of

developmental apoptosis and have inspired other researchers to launch investigations that will

contribute to understanding the process of pathological neuron death and may aid in developing

methods for arresting or delaying neurodegeneration.

117

Chapter 6

Materials and Methods

Cell Culture: PC12 cells were grown as previously described [214] on plates (Nunclone) coated

with rat tail collagen (Roche). Undifferentiated, naïve PC12 cells are maintained in complete

medium (RPMI 1640 medium (Cellgro) supplemented with 10% heat inactivated horse serum

and 5% fetal bovine serum (Sigma). Neuronal differentiation was induced in RPMI medium

supplemented with 1% horse serum and 100 ɳg/ml hNGF (kind gift of Genentech, Inc). Rat

superior cervical ganglionic (SCG) neuron cultures were generated and maintained as previously

described [215] and can be found in the Appendix. NGF withdrawal was carried out by

washing the cultures with serum-free RPMI medium three to four times and then maintaining

them in serum free RPMI plus 10 µg/ml anti-NGF antibody (R&D System, Cat# MAB2561)

HEK293T/17 cells were cultured in uncoated polystyrene plates (Corning) with DMEM cell

culture medium supplemented with 10% fetal bovine serum. Embryonic cortical neuronal

cultures were generous gifts from Dr. Jin Liu in the Lloyd Greene laboratory. They were

cultured as described previously [216], grown on plates coated with poly-D-Lysine and

maintained in neurobasal medium.

Antibodies: Anti-Trib3 antibodies were purchased from Santa Cruz Biotechnology, Inc

(SC67122 for Western blotting and SC314214 for immunostaining) and EMD Millipore

(ST1032) and used at either 1:200 for immunostaining or at 1:1000 for immunoblotting.

Monoclonal antibodies against total AKT, phospho-AKT (Ser473 and Thr308) and total FoxO1a

and polyclonal antiserum against phospho-FoxO1a (Ser256) were from Cell Signaling

118

Technology and used at 1:1000 for immunoblotting. A second polyclonal antiserum against total

FoxO1a was also obtained from AbCam. Both FoxO1a antibodies were used at 1:200 for

immunostaining. Monoclonal antibodies against beta-tubulin III (1:1000 for immunostaining)

and GFP (1:1000 for immunostaining) were from Sigma-Aldrich and Invitrogen, respectively.

A monoclonal antibody against phospho-Histone2AX (Cell Signaling #9718) was used at 1:200

for immunohistochemistry.

Plasmids: Primers used for PCR amplification of rat Trib3 were: Fwd 5’

ACCATGCGAGCCACATCTCTG 3’ and Rvrs 5’CTAGCCATACAGCCCCACCTC3’. PCR

products were gel purified and cloned into PmeI digested vector pWPI

(AddGene/http://tronolab.epfl.ch). Primers used for shTrib3 were based on the following Trib3

sequences: shTrib3#1 5’GAGTGAGAGATGAGCCTG3’, shTrib3#2

5’CTGGAGGATGCCTGTGTG3’ and shTrib3#3 5’TGCTCGATTTGTCTTCAGCAA3’.

Forward and reverse oligonucleotides were 5’ phosphorylated, annealed and cloned into Hpa1-

Xho1-digested pLL 3.7 vector [217]. Primers used for pan shFoxO were based on the sequence

5’GGATAAGGGCGACAGCAA3’ [178]. Primers used for shBim were based on the following

sequences: shBim#1 5’GACAGAGAAGGTGGACAATTG3’ [168] and shBim#2

5’TTCGATTACCGAGAGGCGGAA3’.

Lentiviral Preparation: HEK293T/17 cells (ATCC) were co-transfected with pLL3.7

containing the desired shRNA construct and third generation lentiviral packaging plasmids,

RRE, Rsv/Rev and VSV-G (AddGene), using the Ca-phosphate method [218]. For

overexpression, cells were co-transfected with pWPI plasmid containing the Trib3 cDNA and

second generation lentiviral packaging plasmids, pSPAX2 and VSV-G (AddGene). 4 hours later

119

medium containing Ca-phosphate was replaced by fresh DMEM supplemented with 10% FBS.

Lentiviral medium was collected 72 hours later and replaced \with fresh DMEM supplemented

with 10% FBS. A second lentiviral medium was collected 24 hours later. All lentiviral

supernatants were pooled, filtered through a 0.45 micron membrane (Nalgene) and subjected to

ultracentrifugation in clear tubes (Beckman Scientific) at 25,000 rpm using Beckman SW28

rotor in a Beckman Coulter ultracentrifuge for 1.5 hours. Supernatants were discarded and viral

pellets were incubated in PBS without MgCl2 or CaCl2 overnight. The dissolved pellets were

triturated 20 times, centrifuged briefly to discard any remaining cell debris, aliquoted in small

volumes and stored at -80ºC. Viral titration was performed as described [218].

Lentiviral Infection: A predetermined volume (approximate viral MOI between 10 and 15 as

determined by viral titration) of lentivirus was added to the medium, which was then added to

cultures of neuronal PC12 cells and SCG neurons. The medium was exchanged for one without

virus between 72 hours to 5 days later.

Transfections: DNA was prepared with a Plasmid Maxi kit (Qiagen or Sigma-Aldrich). PC12

cells were transfected with 1 to 2 µg of plasmid in 48-well dishes using LipofectAMINE 2000. 4

hours later, medium with LipofectAMINE 2000 was supplemented with fresh RPMI medium

supplemented with 1% horse serum and 100 ɳg/mL NGF. Transfected GFP or mCherry positive

cells were visualized under a Nikon TE300 epi-fluorescent microscope.

Western Immunoblotting: Neuronal PC12 cells and SCG neurons were lysed with Laemmli

Sample Buffer supplemented with 2-mercaptoethanol (BioRad), sonicated and subjected to

electrophoresis using pre-cast Bis-Tris 10% or 4-12% SDS gels (Invitrogen). Protein was then

120

transferred to HyBond PVDF membrane (GE Amersham Biosciences). 5% non-fat dry milk in

TBS-Tween20 buffer was used as blocking agent and diluent for secondary antibody against

total ERK. 5% bovine serum albumin dissolved in TBS-Tween20 buffer was used as diluent for

primary antibodies. Detection was carried out using either ECL or ECL+ chemiluminescence

according to the manufacturer’s instructions (GE Amersham Biosciences).

Immunostaining: Neuronal PC12 cells and SCG neurons were cultured in 8-chambered

borosilicate coverglass devices (Nunc LabTek cat# 155411) and fixed with 4%

paraformaldehyde for 10 min. Cells were then washed three times with PBS and blocked in

SuperBlock buffer (Pierce) in PBS for 2 hours. The cultures were then incubated with the

appropriate antibodies or antisera diluted in blocking buffer overnight. Cultures were washed

with PBS the next day and this was followed by incubation with the appropriate secondary

antibody for 2 hours in room temperature. Finally, cultures were labeled with the nuclear stain

ToproIII at 1/2000 dilution in PBS (Molecular Probes). Immunostained cells were visualized

and photographed using a spinning disk confocal microscope.

Harvest and immunohistochemistry of mouse superior cervical ganglia: WT and Trib3-/-

mice pups at ages P3 and P7 were collected and sacrificed. A disk-shaped section of the neck

area containing the superior cervical ganglia was obtained from each animal and drop-fixed in

4% paraformaldehyde for at least 48 hours. The neck pieces were given to Columbia

University’s resident histology service. They embedded the pieces in paraffin and made 5μm

thick sections. 25 such sections were obtained for each neck pieces, which contained both the

right and left ganglia. 4 sections were mounted on a single glass slide and every 5th section was

stained with hematoxylin and eosin by the histology service providers. The remaining sections

121

were immunostained with antibody against pH2AX protein by me using the following method.

For immunohistochemistry, the sections were deparafinized by serial incubations for 5 min each

in 2x100% xylene, 1:1 xylene:ethanol solution, 2x100% ethanol/water solution, 95%, 70% and

50% ethanol/water solution following by tap water rinse for 10 min. The sections were then

submerged in sodium citrate buffer (2.94g tri-sodium citrate dihydrate + 1000mL dH2O+ 0.5 mL

Tween 20) pH 6.0 and placed in a steamer for 45 minutes for antigen retrieval. After cooling

down to room temperature, sections were blocked in blocking reagent provided by the

Vectastatin Elite ABC Kit (Vector Laboratories) for 20 min and then incubated in primary

antibody (anti-pH2AX) for overnight at 4ºC. The next day, sections were washed in a sodium-

phosphate buffer and incubated in biotinylated secondary-antibody from the Vectastatin Elite

ABC Kit for 30 min. After a brief rinse in sodium-phosphate buffer, they were incubated in

ABC-AP reagent (Vector Laboratories) for 30 min. This was followed by another brief rinse and

incubation in peroxidase substrate for approximately 5 min. The sections were counterstained

with Nuclear Fast Red (Vector Laboratories) for 7 minutes, dehydrated by serial incubation

going from water to ethanol to xylene and mounted with coverslips. They were visualized and

photographed under a microscope.

Reverse transcription and quantitative PCR: Cells were lysed and total mRNA was isolated

using TRI reagent (Molecular Research Center, Cincinnati, OH) following manufacturer’s

instruction. cDNA was transcribed from total RNA with a cDNA synthesis kit (Marligen)

following manufacturer’s instruction. The primers used for PCR amplification of rat Trib3 were

Fwd 5’GTTGCGTCGATTTGTCTTCA3’ and Rvrs: 5’CGGGAGCTGAGTATCTCTGG3’, Bim

forward 5’GCCCCTACCTCCCTACAGAC3’ and reverse

122

5’CCTTATGGAAGCCATTGCAC3’, GAPDH forward 5’AAGTGGACATTGTTGCCATC3’

and reverse 5’CATACTCAGCACCAGCATCA3’ and α-tubulin Fwd

5’TACACCATTGGCAAGGAGAT3’ and reverse 5’GGCTGGGTAAATGGAGAACT3’. An

equal amount of cDNA template was used for each PCR reaction. An OmniMix PCR kit

(Cephaid) and a SYBR green/DNA polymerase PCR kit was used (Roche) and quantitative PCR

reactions were carried out using a Cephaid SmartCycler and an Eppendorf Realplex

thermocycler following the manufacturers’ specifications. Values obtained from SYBR green

count were recorded and transcript levels were normalized against rat GAPDH and alpha-tubulin

signals and results were reported as times fold increase in reference to control values as

described previously [219].

Neurodegeneration reagents: 6OHDA (Tocris Bioscience) stock solutions were prepared as

described in [220]. Appropriate volumes were added to the neuronal PC12 cells cultures during

feeding to obtain the final desirable concentration. Aβ1-42 dodecamer (R-Peptide, cat#: A-1163-

2) preparations were made as described previously in DMSO [203] and added to culture medium

during feeding.

Statistics: The statistical significance of differences between means was evaluated by Student’s t

test and was performed as paired, two-tailed distribution of arrays and presented as p values.

123

Reference:

1. Martin, D.P., et al., Inhibitors of protein synthesis and RNA synthesis prevent neuronal death caused by nerve growth factor deprivation. J Cell Biol, 1988. 106(3): p. 829-44.

2. Jana, S. and J. Paliwal, Apoptosis: potential therapeutic targets for new drug discovery. Curr Med Chem, 2007. 14(22): p. 2369-79.

3. Stromhaug, P.E. and D.J. Klionsky, Approaching the molecular mechanism of autophagy. Traffic, 2001. 2(8): p. 524-31.

4. Kundu, M. and C.B. Thompson, Autophagy: basic principles and relevance to disease. Annu Rev Pathol, 2008. 3: p. 427-55.

5. Wu, W., P. Liu, and J. Li, Necroptosis: an emerging form of programmed cell death. Crit Rev Oncol Hematol, 2012. 82(3): p. 249-58.

6. Baehrecke, E.H., How death shapes life during development. Nat Rev Mol Cell Biol, 2002. 3(10): p. 779-87.

7. Yeo, W. and J. Gautier, Early neural cell death: dying to become neurons. Dev Biol, 2004. 274(2): p. 233-44.

8. Cowan, W.M., et al., Regressive events in neurogenesis. Science, 1984. 225(4668): p. 1258-65.

9. Buss, R.R., W. Sun, and R.W. Oppenheim, Adaptive roles of programmed cell death during nervous system development. Annu Rev Neurosci, 2006. 29: p. 1-35.

10. Boya, P. and E.J. de la Rosa, Cell death in early neural life. Birth Defects Res C Embryo Today, 2005. 75(4): p. 281-93.

11. Cecconi, F., et al., Apaf1 (CED-4 homolog) regulates programmed cell death in mammalian development. Cell, 1998. 94(6): p. 727-37.

12. Kuida, K., et al., Decreased apoptosis in the brain and premature lethality in CPP32-deficient mice. Nature, 1996. 384(6607): p. 368-72.

13. Oppenheim, R.W., Cell death during development of the nervous system. Annu Rev Neurosci, 1991. 14: p. 453-501.

14. Ichim, G., S. Tauszig-Delamasure, and P. Mehlen, Neurotrophins and cell death. Exp Cell Res, 2012. 318(11): p. 1221-8.

15. Hamburger, V., J.K. Brunso-Bechtold, and J.W. Yip, Neuronal death in the spinal ganglia of the chick embryo and its reduction by nerve growth factor. J Neurosci, 1981. 1(1): p. 60-71.

124

16. Burke, R.E., Ontogenic cell death in the nigrostriatal system. Cell Tissue Res, 2004. 318(1): p. 63-72.

17. Macklis, J.D., Human adult olfactory bulb neurogenesis? Novelty is the best policy. Neuron, 2012. 74(4): p. 595-6.

18. Fuentealba, L.C., K. Obernier, and A. Alvarez-Buylla, Adult neural stem cells bridge their niche. Cell Stem Cell, 2012. 10(6): p. 698-708.

19. Cameron, H.A. and R.D. McKay, Adult neurogenesis produces a large pool of new granule cells in the dentate gyrus. J Comp Neurol, 2001. 435(4): p. 406-17.

20. Sun, W., et al., Programmed cell death of adult-generated hippocampal neurons is mediated by the proapoptotic gene Bax. J Neurosci, 2004. 24(49): p. 11205-13.

21. Capsoni, S. and A. Cattaneo, On the molecular basis linking Nerve Growth Factor (NGF) to Alzheimer's disease. Cell Mol Neurobiol, 2006. 26(4-6): p. 619-33.

22. Hefti, F., Nerve growth factor promotes survival of septal cholinergic neurons after fimbrial transections. J Neurosci, 1986. 6(8): p. 2155-62.

23. Chao, M.V., R. Rajagopal, and F.S. Lee, Neurotrophin signalling in health and disease. Clin Sci (Lond), 2006. 110(2): p. 167-73.

24. Schindowski, K., K. Belarbi, and L. Buee, Neurotrophic factors in Alzheimer's disease: role of axonal transport. Genes Brain Behav, 2008. 7 Suppl 1: p. 43-56.

25. Tasset, I., et al., NGF and nitrosative stress in patients with Huntington's disease. J Neurol Sci, 2012. 315(1-2): p. 133-6.

26. Bartkowska, K., K. Turlejski, and R.L. Djavadian, Neurotrophins and their receptors in early development of the mammalian nervous system. Acta Neurobiol Exp (Wars), 2010. 70(4): p. 454-67.

27. Tessarollo, L., Pleiotropic functions of neurotrophins in development. Cytokine Growth Factor Rev, 1998. 9(2): p. 125-37.

28. Friedman, W.J. and L.A. Greene, Neurotrophin signaling via Trks and p75. Exp Cell Res, 1999. 253(1): p. 131-42.

29. Al-Shawi, R., et al., ProNGF, sortilin, and age-related neurodegeneration. Ann N Y Acad Sci, 2007. 1119: p. 208-15.

30. Greene, L.A., et al., Genomic and non-genomic actions of nerve growth factor in development. Prog Brain Res, 1983. 58: p. 347-57.

125

31. Levi-Montalcini, R. and P.U. Angeletti, Nerve growth factor. Physiol Rev, 1968. 48(3): p. 534-69.

32. Greene, L.A. and E.M. Shooter, The nerve growth factor: biochemistry, synthesis, and mechanism of action. Annu Rev Neurosci, 1980. 3: p. 353-402.

33. Miller, F.D. and D.R. Kaplan, On Trk for retrograde signaling. Neuron, 2001. 32(5): p. 767-70.

34. Klesse, L.J. and L.F. Parada, Trks: signal transduction and intracellular pathways. Microsc Res Tech, 1999. 45(4-5): p. 210-6.

35. Chen, J.Y., et al., A two-dimensional ERK-AKT signaling code for an NGF-triggered cell-fate decision. Mol Cell, 2012. 45(2): p. 196-209.

36. Kaplan, D.R. and F.D. Miller, Neurotrophin signal transduction in the nervous system. Curr Opin Neurobiol, 2000. 10(3): p. 381-91.

37. Read, D.E. and A.M. Gorman, Involvement of Akt in neurite outgrowth. Cell Mol Life Sci, 2009. 66(18): p. 2975-84.

38. Zweifel, L.S., R. Kuruvilla, and D.D. Ginty, Functions and mechanisms of retrograde neurotrophin signalling. Nat Rev Neurosci, 2005. 6(8): p. 615-25.

39. Korsching, S. and H. Thoenen, Developmental changes of nerve growth factor levels in sympathetic ganglia and their target organs. Dev Biol, 1988. 126(1): p. 40-6.

40. Franke, T.F., et al., PI3K/Akt and apoptosis: size matters. Oncogene, 2003. 22(56): p. 8983-98.

41. Hay, N., The Akt-mTOR tango and its relevance to cancer. Cancer Cell, 2005. 8(3): p. 179-83.

42. Hers, I., E.E. Vincent, and J.M. Tavare, Akt signalling in health and disease. Cell Signal, 2011. 23(10): p. 1515-27.

43. Liao, Y. and M.C. Hung, Physiological regulation of Akt activity and stability. Am J Transl Res, 2010. 2(1): p. 19-42.

44. Runeberg-Roos, P. and M. Saarma, Neurotrophic factor receptor RET: structure, cell biology, and inherited diseases. Ann Med, 2007. 39(8): p. 572-80.

45. Russell, J.W. and E.L. Feldman, Insulin-like growth factor-I prevents apoptosis in sympathetic neurons exposed to high glucose. Horm Metab Res, 1999. 31(2-3): p. 90-6.

46. Thompson, J., et al., HGF promotes survival and growth of maturing sympathetic neurons by PI-3 kinase- and MAP kinase-dependent mechanisms. Mol Cell Neurosci, 2004. 27(4): p. 441-52.

47. Franke, T.F., PI3K/Akt: getting it right matters. Oncogene, 2008. 27(50): p. 6473-88.

126

48. Sundaresan, N.R., et al., The deacetylase SIRT1 promotes membrane localization and activation of Akt and PDK1 during tumorigenesis and cardiac hypertrophy. Sci Signal, 2011. 4(182): p. ra46.

49. Scheid, M.P., P.A. Marignani, and J.R. Woodgett, Multiple phosphoinositide 3-kinase-dependent steps in activation of protein kinase B. Mol Cell Biol, 2002. 22(17): p. 6247-60.

50. Alessi, D.R., et al., Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase Balpha. Curr Biol, 1997. 7(4): p. 261-9.

51. Sarbassov, D.D., et al., Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science, 2005. 307(5712): p. 1098-101.

52. Jacinto, E., et al., SIN1/MIP1 maintains rictor-mTOR complex integrity and regulates Akt phosphorylation and substrate specificity. Cell, 2006. 127(1): p. 125-37.

53. Brunet, A., S.R. Datta, and M.E. Greenberg, Transcription-dependent and -independent control of neuronal survival by the PI3K-Akt signaling pathway. Curr Opin Neurobiol, 2001. 11(3): p. 297-305.

54. Crowder, R.J. and R.S. Freeman, Phosphatidylinositol 3-kinase and Akt protein kinase are necessary and sufficient for the survival of nerve growth factor-dependent sympathetic neurons. J Neurosci, 1998. 18(8): p. 2933-43.

55. Malagelada, C., Z.H. Jin, and L.A. Greene, RTP801 is induced in Parkinson's disease and mediates neuron death by inhibiting Akt phosphorylation/activation. J Neurosci, 2008. 28(53): p. 14363-71.

56. Zhang, X., et al., Akt, FoxO and regulation of apoptosis. Biochim Biophys Acta, 2011. 1813(11): p. 1978-86.

57. Datta, S.R., et al., Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell, 1997. 91(2): p. 231-41.

58. Brunet, A., et al., Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell, 1999. 96(6): p. 857-68.

59. Mahajan, K. and N.P. Mahajan, PI3K-independent AKT activation in cancers: A treasure trove for novel therapeutics. J Cell Physiol, 2012. 227(9): p. 3178-84.

60. Dobrowsky, R.T. and Y.A. Hannun, Ceramide stimulates a cytosolic protein phosphatase. J Biol Chem, 1992. 267(8): p. 5048-51.

61. Kaplan, D.R. and F.D. Miller, Signal transduction by the neurotrophin receptors. Curr Opin Cell Biol, 1997. 9(2): p. 213-21.

127

62. Song, W., et al., ProNGF induces PTEN via p75NTR to suppress Trk-mediated survival signaling in brain neurons. J Neurosci, 2010. 30(46): p. 15608-15.

63. Gilley, J., P.J. Coffer, and J. Ham, FOXO transcription factors directly activate bim gene expression and promote apoptosis in sympathetic neurons. J Cell Biol, 2003. 162(4): p. 613-22.

64. Biswas, S.C., et al., Pro-apoptotic Bim induction in response to nerve growth factor deprivation requires simultaneous activation of three different death signaling pathways. J Biol Chem, 2007. 282(40): p. 29368-74.

65. Ham, J., et al., c-Jun and the transcriptional control of neuronal apoptosis. Biochem Pharmacol, 2000. 60(8): p. 1015-21.

66. Jacobs, W.B., D.R. Kaplan, and F.D. Miller, The p53 family in nervous system development and disease. J Neurochem, 2006. 97(6): p. 1571-84.

67. Greene, L.A., et al., Cell cycle molecules define a pathway required for neuron death in development and disease. Biochim Biophys Acta, 2007. 1772(4): p. 392-401.

68. Hughes, R., et al., NF-Y is essential for expression of the proapoptotic bim gene in sympathetic neurons. Cell Death Differ, 2011. 18(6): p. 937-47.

69. Greene, L.A., S.C. Biswas, and D.X. Liu, Cell cycle molecules and vertebrate neuron death: E2F at the hub. Cell Death Differ, 2004. 11(1): p. 49-60.

70. Biswas, S.C., et al., Sertad1 plays an essential role in developmental and pathological neuron death. J Neurosci, 2010. 30(11): p. 3973-82.

71. Sugimoto, M., et al., Regulation of CDK4 activity by a novel CDK4-binding protein, p34(SEI-1). Genes Dev, 1999. 13(22): p. 3027-33.

72. Liu, D.X. and L.A. Greene, Regulation of neuronal survival and death by E2F-dependent gene repression and derepression. Neuron, 2001. 32(3): p. 425-38.

73. Liu, D.X., S.C. Biswas, and L.A. Greene, B-myb and C-myb play required roles in neuronal apoptosis evoked by nerve growth factor deprivation and DNA damage. J Neurosci, 2004. 24(40): p. 8720-5.

74. Biswas, S.C., D.X. Liu, and L.A. Greene, Bim is a direct target of a neuronal E2F-dependent apoptotic pathway. J Neurosci, 2005. 25(37): p. 8349-58.

75. Leppa, S. and D. Bohmann, Diverse functions of JNK signaling and c-Jun in stress response and apoptosis. Oncogene, 1999. 18(45): p. 6158-62.

76. Xu, Z., et al., The MLK family mediates c-Jun N-terminal kinase activation in neuronal apoptosis. Mol Cell Biol, 2001. 21(14): p. 4713-24.

128

77. Kukekov, N.V., Z. Xu, and L.A. Greene, Direct interaction of the molecular scaffolds POSH and JIP is required for apoptotic activation of JNKs. J Biol Chem, 2006. 281(22): p. 15517-24.

78. Towers, E., et al., The proapoptotic dp5 gene is a direct target of the MLK-JNK-c-Jun pathway in sympathetic neurons. Nucleic Acids Res, 2009. 37(9): p. 3044-60.

79. Whitfield, J., et al., Dominant-negative c-Jun promotes neuronal survival by reducing BIM expression and inhibiting mitochondrial cytochrome c release. Neuron, 2001. 29(3): p. 629-43.

80. Barone, M.C., L.A. Desouza, and R.S. Freeman, Pin1 promotes cell death in NGF-dependent neurons through a mechanism requiring c-Jun activity. J Neurochem, 2008. 106(2): p. 734-45.

81. Jacobs, W.B., G.S. Walsh, and F.D. Miller, Neuronal survival and p73/p63/p53: a family affair. Neuroscientist, 2004. 10(5): p. 443-55.

82. Ham, J., et al., BH3-only proteins: key regulators of neuronal apoptosis. Cell Death Differ, 2005. 12(8): p. 1015-20.

83. Hughes, P., P. Bouillet, and A. Strasser, Role of Bim and other Bcl-2 family members in autoimmune and degenerative diseases. Curr Dir Autoimmun, 2006. 9: p. 74-94.

84. Obexer, P., et al., FKHRL1-mediated expression of Noxa and Bim induces apoptosis via the mitochondria in neuroblastoma cells. Cell Death Differ, 2007. 14(3): p. 534-47.

85. Putcha, G.V., et al., Induction of BIM, a proapoptotic BH3-only BCL-2 family member, is critical for neuronal apoptosis. Neuron, 2001. 29(3): p. 615-28.

86. Ramjaun, A.R., et al., Upregulation of two BH3-only proteins, Bmf and Bim, during TGF beta-induced apoptosis. Oncogene, 2007. 26(7): p. 970-81.

87. Coultas, L., et al., Hrk/DP5 contributes to the apoptosis of select neuronal populations but is dispensable for haematopoietic cell apoptosis. J Cell Sci, 2007. 120(Pt 12): p. 2044-52.

88. Imaizumi, K., et al., Molecular cloning of a novel polypeptide, DP5, induced during programmed neuronal death. J Biol Chem, 1997. 272(30): p. 18842-8.

89. Hershko, T. and D. Ginsberg, Up-regulation of Bcl-2 homology 3 (BH3)-only proteins by E2F1 mediates apoptosis. J Biol Chem, 2004. 279(10): p. 8627-34.

90. Putcha, G.V., et al., JNK-mediated BIM phosphorylation potentiates BAX-dependent apoptosis. Neuron, 2003. 38(6): p. 899-914.

91. Becker, E.B., et al., Characterization of the c-Jun N-terminal kinase-BimEL signaling pathway in neuronal apoptosis. J Neurosci, 2004. 24(40): p. 8762-70.

129

92. Biswas, S.C. and L.A. Greene, Nerve growth factor (NGF) down-regulates the Bcl-2 homology 3 (BH3) domain-only protein Bim and suppresses its proapoptotic activity by phosphorylation. J Biol Chem, 2002. 277(51): p. 49511-6.

93. Ley, R., et al., Extracellular signal-regulated kinases 1/2 are serum-stimulated "Bim(EL) kinases" that bind to the BH3-only protein Bim(EL) causing its phosphorylation and turnover. J Biol Chem, 2004. 279(10): p. 8837-47.

94. Lipscomb, E.A., P.D. Sarmiere, and R.S. Freeman, SM-20 is a novel mitochondrial protein that causes caspase-dependent cell death in nerve growth factor-dependent neurons. J Biol Chem, 2001. 276(7): p. 5085-92.

95. Straub, J.A., et al., Induction of SM-20 in PC12 cells leads to increased cytochrome c levels, accumulation of cytochrome c in the cytosol, and caspase-dependent cell death. J Neurochem, 2003. 85(2): p. 318-28.

96. Lee, S., et al., Neuronal apoptosis linked to EglN3 prolyl hydroxylase and familial pheochromocytoma genes: developmental culling and cancer. Cancer Cell, 2005. 8(2): p. 155-67.

97. Bishop, T., et al., Abnormal sympathoadrenal development and systemic hypotension in PHD3-/- mice. Mol Cell Biol, 2008. 28(10): p. 3386-400.

98. Willis, S.N. and J.M. Adams, Life in the balance: how BH3-only proteins induce apoptosis. Curr Opin Cell Biol, 2005. 17(6): p. 617-25.

99. Czabotar, P.E., P.M. Colman, and D.C. Huang, Bax activation by Bim? Cell Death Differ, 2009. 16(9): p. 1187-91.

100. Wilfling, F., et al., BH3-only proteins are tail-anchored in the outer mitochondrial membrane and can initiate the activation of Bax. Cell Death Differ, 2012. 19(8): p. 1328-36.

101. Deckwerth, T.L., et al., BAX is required for neuronal death after trophic factor deprivation and during development. Neuron, 1996. 17(3): p. 401-11.

102. Neame, S.J., L.L. Rubin, and K.L. Philpott, Blocking cytochrome c activity within intact neurons inhibits apoptosis. J Cell Biol, 1998. 142(6): p. 1583-93.

103. Thornberry, N.A. and Y. Lazebnik, Caspases: enemies within. Science, 1998. 281(5381): p. 1312-6.

104. Troy, C.M. and G.S. Salvesen, Caspases on the brain. J Neurosci Res, 2002. 69(2): p. 145-50.

105. Yuan, S., et al., The holo-apoptosome: activation of procaspase-9 and interactions with caspase-3. Structure, 2011. 19(8): p. 1084-96.

130

106. Li, P., et al., Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell, 1997. 91(4): p. 479-89.

107. Kuida, K., et al., Reduced apoptosis and cytochrome c-mediated caspase activation in mice lacking caspase 9. Cell, 1998. 94(3): p. 325-37.

108. Stefanis, L., et al., Caspase-2 (Nedd-2) processing and death of trophic factor-deprived PC12 cells and sympathetic neurons occur independently of caspase-3 (CPP32)-like activity. J Neurosci, 1998. 18(22): p. 9204-15.

109. Troy, C.M., et al., Death in the balance: alternative participation of the caspase-2 and -9 pathways in neuronal death induced by nerve growth factor deprivation. J Neurosci, 2001. 21(14): p. 5007-16.

110. Troy, C.M. and E.M. Ribe, Caspase-2: vestigial remnant or master regulator? Sci Signal, 2008. 1(38): p. pe42.

111. Chang, H.Y. and X. Yang, Proteases for cell suicide: functions and regulation of caspases. Microbiol Mol Biol Rev, 2000. 64(4): p. 821-46.

112. Zimmermann, K.C. and D.R. Green, How cells die: apoptosis pathways. J Allergy Clin Immunol, 2001. 108(4 Suppl): p. S99-103.

113. Mayumi-Matsuda, K., et al., Identification of a novel kinase-like gene induced during neuronal cell death. Biochem Biophys Res Commun, 1999. 258(2): p. 260-4.

114. Seher, T.C. and M. Leptin, Tribbles, a cell-cycle brake that coordinates proliferation and morphogenesis during Drosophila gastrulation. Curr Biol, 2000. 10(11): p. 623-9.

115. Grosshans, J. and E. Wieschaus, A genetic link between morphogenesis and cell division during formation of the ventral furrow in Drosophila. Cell, 2000. 101(5): p. 523-31.

116. Rorth, P., K. Szabo, and G. Texido, The level of C/EBP protein is critical for cell migration during Drosophila oogenesis and is tightly controlled by regulated degradation. Mol Cell, 2000. 6(1): p. 23-30.

117. Mata, J., et al., Tribbles coordinates mitosis and morphogenesis in Drosophila by regulating string/CDC25 proteolysis. Cell, 2000. 101(5): p. 511-22.

118. Hegedus, Z., A. Czibula, and E. Kiss-Toth, Tribbles: novel regulators of cell function; evolutionary aspects. Cell Mol Life Sci, 2006. 63(14): p. 1632-41.

119. Hegedus, Z., A. Czibula, and E. Kiss-Toth, Tribbles: a family of kinase-like proteins with potent signalling regulatory function. Cell Signal, 2007. 19(2): p. 238-50.

131

120. Dobens, L.L., Jr. and S. Bouyain, Developmental roles of tribbles protein family members. Dev Dyn, 2012. 241(8): p. 1239-48.

121. Sung, H.Y., et al., Regulation of expression and signalling modulator function of mammalian tribbles is cell-type specific. Immunol Lett, 2006. 104(1-2): p. 171-7.

122. Keeshan, K., et al., Transformation by Tribbles homolog 2 (Trib2) requires both the Trib2 kinase domain and COP1 binding. Blood, 2010. 116(23): p. 4948-57.

123. Zanella, F., et al., Human TRIB2 is a repressor of FOXO that contributes to the malignant phenotype of melanoma cells. Oncogene, 2010. 29(20): p. 2973-82.

124. Yokoyama, T., et al., Trib1 links the MEK1/ERK pathway in myeloid leukemogenesis. Blood, 2010. 116(15): p. 2768-75.

125. Bowers, A.J., S. Scully, and J.F. Boylan, SKIP3, a novel Drosophila tribbles ortholog, is overexpressed in human tumors and is regulated by hypoxia. Oncogene, 2003. 22(18): p. 2823-35.

126. Park, M.H., et al., Gene expression profile related to prognosis of acute myeloid leukemia. Oncol Rep, 2007. 18(6): p. 1395-402.

127. Wennemers, M., et al., TRIB3 protein denotes a good prognosis in breast cancer patients and is associated with hypoxia sensitivity. Radiother Oncol, 2011. 101(1): p. 198-202.

128. Kiss-Toth, E., et al., Human tribbles, a protein family controlling mitogen-activated protein kinase cascades. J Biol Chem, 2004. 279(41): p. 42703-8.

129. Saka, Y. and J.C. Smith, A Xenopus tribbles orthologue is required for the progression of mitosis and for development of the nervous system. Dev Biol, 2004. 273(2): p. 210-25.

130. Du, K., et al., TRB3: a tribbles homolog that inhibits Akt/PKB activation by insulin in liver. Science, 2003. 300(5625): p. 1574-7.

131. Ord, D. and T. Ord, Characterization of human NIPK (TRB3, SKIP3) gene activation in stressful conditions. Biochem Biophys Res Commun, 2005. 330(1): p. 210-8.

132. Olsson, P.A., S.H. Burleigh, and I.M. van Aarle, The influence of external nitrogen on carbon allocation to Glomus intraradices in monoxenic arbuscular mycorrhiza. New Phytol, 2005. 168(3): p. 677-86.

133. Ord, D. and T. Ord, Mouse NIPK interacts with ATF4 and affects its transcriptional activity. Exp Cell Res, 2003. 286(2): p. 308-20.

134. Ohoka, N., et al., TRB3, a novel ER stress-inducible gene, is induced via ATF4-CHOP pathway and is involved in cell death. EMBO J, 2005. 24(6): p. 1243-55.

132

135. Zinszner, H., et al., CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes Dev, 1998. 12(7): p. 982-95.

136. Su, N. and M.S. Kilberg, C/EBP homology protein (CHOP) interacts with activating transcription factor 4 (ATF4) and negatively regulates the stress-dependent induction of the asparagine synthetase gene. J Biol Chem, 2008. 283(50): p. 35106-17.

137. Corcoran, C.A., et al., Genotoxic and endoplasmic reticulum stresses differentially regulate TRB3 expression. Cancer Biol Ther, 2005. 4(10): p. 1063-7.

138. Zou, C.G., et al., The molecular mechanism of endoplasmic reticulum stress-induced apoptosis in PC-12 neuronal cells: the protective effect of insulin-like growth factor I. Endocrinology, 2009. 150(1): p. 277-85.

139. Wu, M., et al., SINK is a p65-interacting negative regulator of NF-kappaB-dependent transcription. J Biol Chem, 2003. 278(29): p. 27072-9.

140. Sarmiere, P.D. and R.S. Freeman, Analysis of the NF-kappa B and PI 3-kinase/Akt survival pathways in nerve growth factor-dependent neurons. Mol Cell Neurosci, 2001. 18(3): p. 320-31.

141. Maggirwar, S.B., et al., Nerve growth factor-dependent activation of NF-kappaB contributes to survival of sympathetic neurons. J Neurosci, 1998. 18(24): p. 10356-65.

142. Xu, J., et al., TRB3 interacts with CtIP and is overexpressed in certain cancers. Biochim Biophys Acta, 2007. 1770(2): p. 273-8.

143. Miyoshi, N., et al., Abnormal expression of TRIB3 in colorectal cancer: a novel marker for prognosis. Br J Cancer, 2009. 101(10): p. 1664-70.

144. Schwarzer, R., et al., TRB3 is a PI 3-kinase dependent indicator for nutrient starvation. Cell Signal, 2006. 18(6): p. 899-909.

145. Hua, F., et al., TRB3 interacts with SMAD3 promoting tumor cell migration and invasion. J Cell Sci, 2011. 124(Pt 19): p. 3235-46.

146. Rzymski, T., et al., Multiple pathways are involved in the anoxia response of SKIP3 including HuR-regulated RNA stability, NF-kappaB and ATF4. Oncogene, 2008. 27(33): p. 4532-43.

147. Kamphuis, W., et al., Global gene expression profiling of ischemic preconditioning in the rat retina. Mol Vis, 2007. 13: p. 1020-30.

148. Zhou, Y., et al., E3 ubiquitin ligase SIAH1 mediates ubiquitination and degradation of TRB3. Cell Signal, 2008. 20(5): p. 942-8.

149. Qi, L., et al., TRB3 links the E3 ubiquitin ligase COP1 to lipid metabolism. Science, 2006. 312(5781): p. 1763-6.

133

150. Wang, Y.G., et al., Signal transduction mechanism of TRB3 in rats with non-alcoholic fatty liver disease. World J Gastroenterol, 2009. 15(19): p. 2329-35.

151. He, L., et al., Chronic ethanol intake impairs insulin signaling in rats by disrupting Akt association with the cell membrane. Role of TRB3 in inhibition of Akt/protein kinase B activation. J Biol Chem, 2006. 281(16): p. 11126-34.

152. Yao, X.H. and B.L. Gregoire Nyomba, Abnormal glucose homeostasis in adult female rat offspring after intrauterine ethanol exposure. Am J Physiol Regul Integr Comp Physiol, 2007. 292(5): p. R1926-33.

153. Yao, X.H. and B.L. Nyomba, Hepatic insulin resistance induced by prenatal alcohol exposure is associated with reduced PTEN and TRB3 acetylation in adult rat offspring. Am J Physiol Regul Integr Comp Physiol, 2008. 294(6): p. R1797-806.

154. Bromati, C.R., et al., UPR induces transient burst of apoptosis in islets of early lactating rats through reduced AKT phosphorylation via ATF4/CHOP stimulation of TRB3 expression. Am J Physiol Regul Integr Comp Physiol, 2011. 300(1): p. R92-100.

155. Saltiel, A.R., Putting the brakes on insulin signaling. N Engl J Med, 2003. 349(26): p. 2560-2.

156. Fleming, I., Double tribble: two TRIB3 variants, insulin, Akt, and eNOS. Arterioscler Thromb Vasc Biol, 2008. 28(7): p. 1216-8.

157. Andreozzi, F., et al., TRIB3 R84 variant is associated with impaired insulin-mediated nitric oxide production in human endothelial cells. Arterioscler Thromb Vasc Biol, 2008. 28(7): p. 1355-60.

158. Prudente, S., et al., The functional Q84R polymorphism of mammalian Tribbles homolog TRB3 is associated with insulin resistance and related cardiovascular risk in Caucasians from Italy. Diabetes, 2005. 54(9): p. 2807-11.

159. Prudente, S., et al., The TRIB3 Q84R polymorphism and risk of early-onset type 2 diabetes. J Clin Endocrinol Metab, 2009. 94(1): p. 190-6.

160. Prudente, S., et al., The Mammalian Tribbles Homolog TRIB3, Glucose Homeostasis, and Cardiovascular Diseases. Endocr Rev, 2012. 33(4): p. 526-46.

161. Gong, H.P., et al., TRIB3 functional Q84R polymorphism is a risk factor for metabolic syndrome and carotid atherosclerosis. Diabetes Care, 2009. 32(7): p. 1311-3.

162. Shi, Z., et al., Association of TRB3 gene Q84R polymorphism with type 2 diabetes mellitus in Chinese population. Endocrine, 2009. 35(3): p. 414-9.

163. Kristiansen, M., et al., Global analysis of gene expression in NGF-deprived sympathetic neurons identifies molecular pathways associated with cell death. BMC Genomics, 2011. 12: p. 551.

134

164. Ryu, E.J., J.M. Angelastro, and L.A. Greene, Analysis of gene expression changes in a cellular model of Parkinson disease. Neurobiol Dis, 2005. 18(1): p. 54-74.

165. Greene, L.A. and A.S. Tischler, Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc Natl Acad Sci U S A, 1976. 73(7): p. 2424-8.

166. Greene, L.A., Nerve growth factor prevents the death and stimulates the neuronal differentiation of clonal PC12 pheochromocytoma cells in serum-free medium. J Cell Biol, 1978. 78(3): p. 747-55.

167. Troy, C.M., et al., Caspase-2 mediates neuronal cell death induced by beta-amyloid. J Neurosci, 2000. 20(4): p. 1386-92.

168. Biswas, S.C., et al., Bim is elevated in Alzheimer's disease neurons and is required for beta-amyloid-induced neuronal apoptosis. J Neurosci, 2007. 27(4): p. 893-900.

169. Imaizumi, K., et al., Critical role for DP5/Harakiri, a Bcl-2 homology domain 3-only Bcl-2 family member, in axotomy-induced neuronal cell death. J Neurosci, 2004. 24(15): p. 3721-5.

170. Ma, C., et al., dp5/HRK is a c-Jun target gene and required for apoptosis induced by potassium deprivation in cerebellar granule neurons. J Biol Chem, 2007. 282(42): p. 30901-9.

171. Amadoro, G., et al., Endogenous Abeta causes cell death via early tau hyperphosphorylation. Neurobiol Aging, 2011. 32(6): p. 969-90.

172. Matrone, C., et al., NGF and BDNF signaling control amyloidogenic route and Abeta production in hippocampal neurons. Proc Natl Acad Sci U S A, 2008. 105(35): p. 13139-44.

173. Matrone, C., et al., Activation of the amyloidogenic route by NGF deprivation induces apoptotic death in PC12 cells. J Alzheimers Dis, 2008. 13(1): p. 81-96.

174. Cravero, J.D., et al., Increased expression of the Akt/PKB inhibitor TRB3 in osteoarthritic chondrocytes inhibits insulin-like growth factor 1-mediated cell survival and proteoglycan synthesis. Arthritis Rheum, 2009. 60(2): p. 492-500.

175. Zheng, W.H., S. Kar, and R. Quirion, FKHRL1 and its homologs are new targets of nerve growth factor Trk receptor signaling. J Neurochem, 2002. 80(6): p. 1049-61.

176. Lee, T.Y., et al., GPMiner: an integrated system for mining combinatorial cis-regulatory elements in mammalian gene group. BMC Genomics, 2012. 13 Suppl 1: p. S3.

177. Calnan, D.R. and A. Brunet, The FoxO code. Oncogene, 2008. 27(16): p. 2276-88.

178. Hribal, M.L., et al., Regulation of insulin-like growth factor-dependent myoblast differentiation by Foxo forkhead transcription factors. J Cell Biol, 2003. 162(4): p. 535-41.

135

179. Yang, L., et al., Akt/protein kinase B signaling inhibitor-2, a selective small molecule inhibitor of Akt signaling with antitumor activity in cancer cells overexpressing Akt. Cancer Res, 2004. 64(13): p. 4394-9.

180. Barve, V., et al., Synthesis, molecular characterization, and biological activity of novel synthetic derivatives of chromen-4-one in human cancer cells. J Med Chem, 2006. 49(13): p. 3800-8.

181. Eilers, A., et al., Direct inhibition of c-Jun N-terminal kinase in sympathetic neurones prevents c-jun promoter activation and NGF withdrawal-induced death. J Neurochem, 2001. 76(5): p. 1439-54.

182. Li, M., et al., c-Jun binding site identification in K562 cells. J Genet Genomics, 2011. 38(6): p. 235-42.

183. Rosinski, J.A. and W.R. Atchley, Molecular evolution of the Myb family of transcription factors: evidence for polyphyletic origin. J Mol Evol, 1998. 46(1): p. 74-83.

184. Shin, M., C. Yan, and D. Boyd, An inhibitor of c-jun aminoterminal kinase (SP600125) represses c-Jun activation, DNA-binding and PMA-inducible 92-kDa type IV collagenase expression. Biochim Biophys Acta, 2002. 1589(3): p. 311-6.

185. Borsello, T., et al., A peptide inhibitor of c-Jun N-terminal kinase protects against excitotoxicity and cerebral ischemia. Nat Med, 2003. 9(9): p. 1180-6.

186. Park, D.S., S.E. Farinelli, and L.A. Greene, Inhibitors of cyclin-dependent kinases promote survival of post-mitotic neuronally differentiated PC12 cells and sympathetic neurons. J Biol Chem, 1996. 271(14): p. 8161-9.

187. Padmanabhan, J., et al., Role of cell cycle regulatory proteins in cerebellar granule neuron apoptosis. J Neurosci, 1999. 19(20): p. 8747-56.

188. Burke, R.E. and K. O'Malley, Axon degeneration in Parkinson's disease. Exp Neurol, 2012.

189. Kole, A.J., et al., miR-29b is activated during neuronal maturation and targets BH3-only genes to restrict apoptosis. Genes Dev, 2011. 25(2): p. 125-30.

190. Lipscomb, E.A., et al., Expression of the SM-20 gene promotes death in nerve growth factor-dependent sympathetic neurons. J Neurochem, 1999. 73(1): p. 429-32.

191. Okamoto, H., et al., Genetic deletion of Trb3, the mammalian Drosophila tribbles homolog, displays normal hepatic insulin signaling and glucose homeostasis. Diabetes, 2007. 56(5): p. 1350-6.

192. Coughlin, M.D., D.M. Boyer, and I.B. Black, Embryologic development of a mouse sympathetic ganglion in vivo and in vitro. Proc Natl Acad Sci U S A, 1977. 74(8): p. 3438-42.

136

193. Coughlin, M.D. and M.B. Collins, Nerve growth factor-independent development of embryonic mouse sympathetic neurons in dissociated cell culture. Dev Biol, 1985. 110(2): p. 392-401.

194. Wright, L.L., T.J. Cunningham, and A.J. Smolen, Developmental neuron death in the rat superior cervical sympathetic ganglion: cell counts and ultrastructure. J Neurocytol, 1983. 12(5): p. 727-38.

195. Davis, B.M., et al., Effects of NGF overexpression on anatomical and physiological properties of sympathetic postganglionic neurons. Brain Res, 1996. 724(1): p. 47-54.

196. Rogakou, E.P., et al., DNA double-stranded breaks induce histone H2AX phosphorylation on serine 139. J Biol Chem, 1998. 273(10): p. 5858-68.

197. Maira, S.M., et al., Carboxyl-terminal modulator protein (CTMP), a negative regulator of PKB/Akt and v-Akt at the plasma membrane. Science, 2001. 294(5541): p. 374-80.

198. Andjelkovic, M., et al., Activation and phosphorylation of a pleckstrin homology domain containing protein kinase (RAC-PK/PKB) promoted by serum and protein phosphatase inhibitors. Proc Natl Acad Sci U S A, 1996. 93(12): p. 5699-704.

199. Bove, J., et al., Toxin-induced models of Parkinson's disease. NeuroRx, 2005. 2(3): p. 484-94.

200. Xia, R. and Z.H. Mao, Progression of motor symptoms in Parkinson's disease. Neurosci Bull, 2012. 28(1): p. 39-48.

201. Malagelada, C., et al., RTP801 is elevated in Parkinson brain substantia nigral neurons and mediates death in cellular models of Parkinson's disease by a mechanism involving mammalian target of rapamycin inactivation. J Neurosci, 2006. 26(39): p. 9996-10005.

202. Terzioglu, M. and D. Galter, Parkinson's disease: genetic versus toxin-induced rodent models. FEBS J, 2008. 275(7): p. 1384-91.

203. Barghorn, S., et al., Globular amyloid beta-peptide oligomer - a homogenous and stable neuropathological protein in Alzheimer's disease. J Neurochem, 2005. 95(3): p. 834-47.

204. Inohara, N., et al., harakiri, a novel regulator of cell death, encodes a protein that activates apoptosis and interacts selectively with survival-promoting proteins Bcl-2 and Bcl-X(L). EMBO J, 1997. 16(7): p. 1686-94.

205. Silva, R.M., et al., CHOP/GADD153 is a mediator of apoptotic death in substantia nigra dopamine neurons in an in vivo neurotoxin model of parkinsonism. J Neurochem, 2005. 95(4): p. 974-86.

206. Boudeau, J., et al., Emerging roles of pseudokinases. Trends Cell Biol, 2006. 16(9): p. 443-52.

137

207. Parlato, R., et al., Specific ablation of the transcription factor CREB in sympathetic neurons surprisingly protects against developmentally regulated apoptosis. Development, 2007. 134(9): p. 1663-70.

208. Volpicelli-Daley, L.A., et al., Exogenous alpha-synuclein fibrils induce Lewy body pathology leading to synaptic dysfunction and neuron death. Neuron, 2011. 72(1): p. 57-71.

209. Calissano, P., C. Matrone, and G. Amadoro, Apoptosis and in vitro Alzheimer disease neuronal models. Commun Integr Biol, 2009. 2(2): p. 163-9.

210. Pei, J.J., et al., Role of protein kinase B in Alzheimer's neurofibrillary pathology. Acta Neuropathol, 2003. 105(4): p. 381-92.

211. O'Neill, C., et al., Insulin and IGF-1 signalling: longevity, protein homoeostasis and Alzheimer's disease. Biochem Soc Trans, 2012. 40(4): p. 721-7.

212. Jimenez, S., et al., Age-dependent accumulation of soluble amyloid beta (Abeta) oligomers reverses the neuroprotective effect of soluble amyloid precursor protein-alpha (sAPP(alpha)) by modulating phosphatidylinositol 3-kinase (PI3K)/Akt-GSK-3beta pathway in Alzheimer mouse model. J Biol Chem, 2011. 286(21): p. 18414-25.

213. Steen, E., et al., Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer's disease--is this type 3 diabetes? J Alzheimers Dis, 2005. 7(1): p. 63-80.

214. Greene, L.A., Farinelli, S.E., Cunnigngham, M.E. and Park, D.S., Culture and experimental use of the PC12 rat pheochromocytoma cell line. . 2nd Edition ed, ed. G.B.a.K. Goslin. 1998, Cuturing Nerve Cells, 2nd Edition: MIT Press, cambridge MA. 161-187.

215. Zareen, N. and L.A. Greene, Protocol for culturing sympathetic neurons from rat superior cervical ganglia (SCG). J Vis Exp, 2009(23).

216. Park, D.S., et al., Cyclin-dependent kinases participate in death of neurons evoked by DNA-damaging agents. J Cell Biol, 1998. 143(2): p. 457-67.

217. Rubinson, D.A., et al., A lentivirus-based system to functionally silence genes in primary mammalian cells, stem cells and transgenic mice by RNA interference. Nat Genet, 2003. 33(3): p. 401-6.

218. Tiscornia, G., O. Singer, and I.M. Verma, Production and purification of lentiviral vectors. Nat Protoc, 2006. 1(1): p. 241-5.

219. Pfaffl, M.W., A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res, 2001. 29(9): p. e45.

138

220. Ryu, E.J., et al., Endoplasmic reticulum stress and the unfolded protein response in cellular models of Parkinson's disease. J Neurosci, 2002. 22(24): p. 10690-8.

139

Appendix

Neela Zareen and Lloyd Greene. Protocol for culturing sympathetic neurons from rat superior cervical ganglia (SCG). Journal of Visual Experiments (2009) Jan 30 (23). http://www.jove.com/video/988/protocol-for-culturing-sympathetic-neurons-from-rat-superior-cervical-ganglia-scg