Determining the Role of Cin85 and CD2AP in Septin ...€¦ · Determining the Role of Cin85 and...
80
Determining the Role of Cin85 and CD2AP in Septin- Mediated Cytokinesis by Karen Yin Yue Fung A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Biochemistry University of Toronto © Copyright by Karen Yin Yue Fung 2014
Transcript of Determining the Role of Cin85 and CD2AP in Septin ...€¦ · Determining the Role of Cin85 and...
Determining the Role of Cin85 and CD2AP in Septin-Mediated Cytokinesis
by
Karen Yin Yue Fung
A thesis submitted in conformity with the requirements for the degree of Master of Science
Department of Biochemistry University of Toronto
© Copyright by Karen Yin Yue Fung 2014
ii
Determining the Role of Cin85 and CD2AP in Septin-Mediated
Cytokinesis
Karen Yin Yue Fung
Master of Science
Department of Biochemistry
University of Toronto
2014
Abstract
Septins are a family of GTP-binding proteins implicated in mammalian cytokinesis. Our lab has
shown that the N-terminal region of SEPT9 is critical during the later stage of cytokinesis -
abscission. The N-terminal region of SEPT9 contains two atypical proline-rich motifs targeted by
certain SH3 containing proteins such as adaptor proteins Cin85 and CD2AP. Therefore it is
possible that Cin85/CD2AP interacts with SEPT9 to complete cytokinesis. I have presented
immunofluorescence microscopy images and abscission defect quantification data which
strongly suggest that Cin85 and CD2AP function during cytokinesis. Through biochemical
means, I have shown that the first three SH3 domains of Cin85 and CD2AP are required for their
interaction with SEPT9 in vitro and in vivo. Lastly, the SEPT9 mutant that can not bind
Cin85/CD2AP failed to rescue the abscission defect observed when SEPT9 is depleted. These
results suggest that the interaction between Cin85/CD2AP and SEPT9 is required for abscission.
iii
Acknowledgments
Firstly, I would like to thank my supervisor, Dr. Bill Trimble for giving me the opportunity to
work on this interesting project. Thank you for your patience, guidance and encouragement,
which were needed especially during the difficult times of my study. Your ideas and enthusiasm
for science are inspirational.
I would also like to thank my committee members: Dr. Julie Brill and Dr. James Rini for their
guidance, and helpful suggestions throughout this project.
I am forever grateful to have had the privilege to work with the members of the Kahr lab and the
amazing Trimblets who not only aided in my growth as a scientist but also as a person. Thank
you Dr. Carol Froese for your exceptional guidance, mentorship and encouraging feedback
which always motivated me to continue on. Thank you Hong Xie for making sure that I have all
the reagents I needed and for your insightful advices. Thank you Dr. Mathew Estey for sharing
your expertise and reagents during the short time that we worked together. Thank you Ceilidh
Cunningham and Jess DiCiccio for always listening to my frustrations and in turn providing
moral support and encouragement. Lastly, thank you Theodore Pham for your constant aid and
invaluable input throughout my project. Your dedication and enthusiasm for science is what
drives me to become a better scientist.
iv
Table of Contents
Acknowledgments .......................................................................................................................... iii
Table of Contents ........................................................................................................................... iv
List of Tables ............................................................................................................................... viii
List of Figures ................................................................................................................................ ix
List of Abbreviations ...................................................................................................................... x
Chapter 1 Introduction .................................................................................................................... 1
1.1 Septins - the GTPase family ............................................................................................... 1
1.1.1 Discovery of septins ................................................................................................ 1
1.1.2 General features of the septin family ...................................................................... 2
1.1.3 Septin-septin interactions and high order organization .......................................... 2
1.2 Septin functions .................................................................................................................. 4
1.2.1 Septins in diffusion barrier ...................................................................................... 4
1.2.2 Septins contribute to cortical rigidity ...................................................................... 5
1.2.3 Septins in membrane trafficking ............................................................................. 5
1.2.4 Septins as scaffolds ................................................................................................. 6
1.3 Cin85 and CD2AP adaptor family ...................................................................................... 6
1.3.1 Functions of Cbl-interacting protein of 85kDa - Cin85 .......................................... 7
1.3.1.1 Cin85 in the endosomal regulation of receptors ...................................... 7
1.3.1.2 Cin85 in actin-related functions: cell migration and invasion ................. 8
1.3.2 Functions of CD2 associated protein - CD2AP ...................................................... 9
1.3.2.1 CD2AP in T-cell Polarization .................................................................. 9
1.3.2.2 CD2AP in building the kidney architecture ............................................. 9
1.3.2.3 CD2AP in the endosomal regulation of receptors .................................. 10
1.3.3 Drosophila orthologue cindr ................................................................................. 10
v
1.4 Cytokinesis ........................................................................................................................ 11
1.4.1 Overview of mammalian cytokinesis .................................................................... 11
1.4.1.1 Early stages of cytokinesis - actomyosin ring assembly and
contraction .............................................................................................. 12
1.4.1.2 Late stages of cytokinesis - abscission ................................................... 12
1.4.2 Involvement of septins in mammalian cytokinesis ............................................... 15
1.4.2.1 Role of septins in the early stages of cytokinesis ................................... 15
1.4.2.2 Role of septins in the late stages of cytokinesis ..................................... 16
1.4.3 Role of anillin in cytokinesis ................................................................................ 17
1.4.4 Involvement of CD2AP and cindr in cytokinesis ................................................. 18
1.5 Hypothesis and Rationale ................................................................................................. 19
Chapter 2 Methods and Materials ................................................................................................. 20
2.1 Cell Culture ....................................................................................................................... 20
2.2 Western Blot ..................................................................................................................... 20
2.3 Constructs ......................................................................................................................... 21
2.3.1 SEPT9 Constructs ................................................................................................. 21
2.3.1.1 Generating SEPT9 T73/130A constructs ............................................... 21
2.3.2 Cin85 Constructs ................................................................................................... 21
2.3.3 CD2AP Constructs ................................................................................................ 22
2.3 siRNA Treatment .............................................................................................................. 23
2.4 Transfection ...................................................................................................................... 24
2.5 Generation of the Stable Cell Line .................................................................................... 24
2.6 Immunofluorescence ......................................................................................................... 25
2.7 Fluorescence Microscopy ................................................................................................. 26
2.8 Immunoprecipitation ......................................................................................................... 26
2.9 Protein Purification from Bacteria .................................................................................... 27
vi
2.10 Pull-down Assay ............................................................................................................... 27
2.11 Statistical Analysis ............................................................................................................ 28
Chapter 3 Results .......................................................................................................................... 29
3.1 Localization of Cin85 and CD2AP during late telophase ................................................. 29
3.2 Depletion of SEPT9, Cin85 or CD2AP led to an abscission defect ................................. 32
3.3 Localization of CD2AP is not dependent on Cin85 or SEPT9 ......................................... 34
3.4 The interaction between SEPT9 and Cin85/CD2AP is mediated through the SH3
domain on the adaptor proteins and the proline-rich motif on SEPT9 ............................. 34
3.5 The first three SH3 domains of Cin85 but not full-length Cin85 co-immunoprecipitate
SEPT9 ............................................................................................................................... 37
3.6 The first three SH3 domains of CD2AP and full length CD2AP can weakly co-
immunoprecipitate SEPT9 ................................................................................................ 37
3.7 Full-length Cin85 can co-immunoprecipitate itself .......................................................... 39
3.8 Overexpression of the of SEPT9-N-termR T73/130A did not lead to the dominant
negative abscission defect ................................................................................................. 41
3.9 SEPT9 R73+130A was not able to rescue the abscission defect caused by the
depletion of SEPT9 ........................................................................................................... 43
Chapter 4 Discussion .................................................................................................................... 45
4.1 The role of the adaptor proteins Cin85 and CD2AP in cytokinesis .................................. 45
4.1.1 The role of Cin85 in cytokinesis ........................................................................... 45
4.1.2 The role of CD2AP in cytokinesis ........................................................................ 46
4.1.3 At what point do CD2AP and SEPT9 participate in cytokinesis? ........................ 47
4.1.4 At what point do Cin85 and CD2AP participate in cytokinesis? .......................... 48
4.2 The SH3 domains of Cin85 and CD2AP can interact with SEPT9 .................................. 49
4.2.1 Preferential binding of one SH3 domain over the other in Cin85 ........................ 49
4.2.2 Preferential binding of Cin85 over CD2AP to SEPT9 ......................................... 50
4.3 Cin85 can associate with itself .......................................................................................... 51
4.4 Interaction between Cin85 and CD2AP with SEPT9 is needed for cytokinesis ............... 52
vii
4.5 The SEPT9-Cin85-CD2AP relationship during cytokinesis .............................................. 53
Chapter 5 Conclusions and Future Directions .............................................................................. 54
References ..................................................................................................................................... 59
viii
List of Tables
Table 1: Categorization of mammalian septin family members along with their structural features
and their yeast equivalents.............................................................................................................. 1
ix
List of Figures
Figure 1: The basic features of the septin members....................................................................... 2
Figure 2: Illustration of the septin hexamer and octamer............................................................... 3
Figure 3: The higher - order structure of septins............................................................................ 4
Figure 4: The general features of the Cin85/CD2AP adaptor proteins.......................................... 7
Figure 5: Overview of cytokinesis in animals.............................................................................. 13
Figure 6: The five N-terminal isoforms of SEPT9....................................................................... 17
Figure 7: Endogenous Cin85 is enriched in the midbody of telophase HeLa cells...................... 30
Figure 8: CD2AP enrichment at the midbody is independent of SEPT9 and Cin85.................... 31
Figure 9: Knockdown of SEPT9, CD2AP, Cin85 or CD2AP and Cin85 led to an abscission
defect............................................................................................................................................. 33
Figure 10: Mapping the binding interface between Cin85/CD2AP and SEPT9........................... 36
Figure 11: Cin85 and CD2AP can co-immunoprecipitate full-length SEPT9 through their SH3
domains......................................................................................................................................... 38
Figure 12: The different ways that the first three SH3 domains of Cin85 can be masked........... 39
Figure 13: Full-length Cin85 can associate with itself via the C-terminal coiled-coil domain.... 40
Figure 14: Overexpression of wild-type SEPT9 N-termR led to an increase in telophase cells
while the SEPT9 mutant unable to associate with Cin85 or CD2AP did not............................... 42
Figure 15: Full-length SEPT9 mutant R73+130 is not able to rescue the abscission defect
observed when all SEPT9 isoforms are knocked down................................................................ 44
Figure 16: Proposed models of the role of Cin85/CD2AP in septin mediated cytokinesis.......... 56
x
List of Abbreviations
AcTub Acetylated tubulin
AIP1 Apoptosis-linked gene-2-interacting protein 1
Alix Apoptosis-linked gene-2-interacting protein X
ARF6 ADP-ribosylation factor 6
ATP Adenosine-5'-triphosphate
BSA Bovine Serum Albumin
CD2AP CD2-associated protein
Cep55 Centrosomal protein of 55kDa
Cdc Cell division control
CHMP1B Charged multivesicular body protein 1B
Cin85 Cbl-interacting protein of 85kDa
DMEM Dulbecco's Modified Eagle's Medium
DNA deoxyribonucleic acid
EDTA Ethlenediaminetetraacetic acid
EGFR Epidermal Growth Factor Receptor
EM Electron Microscopy
ESCRT Endosomal sorting complex required for transport
FBS Fetal bovine serum
GAPDH Glyceraldehyde 3-phsophate dehydrogenase
GST Glutathione S-transferase
GFP Green fluorescent protein
GTP Guanosine triphosphate
HBS Hank's Buffered Salt Solution
HeLa Henrietta Lacks cervical cancer cells
xi
TBS Tris buffered saline
TBS-T Tris buffered saline with 0.05% Tween-20
PCR Polymerase chain reaction
SEM Standard error of the mean
SH3 Src homology 3
siRNA Small interfering ribonucleic acid
SNAREs Soluable N-ethylmalemide-sensitive factor attachment protein
receptors
Tsg101 Tumor Susceptibility gene 101
1
Chapter 1 Introduction
1.1 Septins - the GTPase family
1.1.1 Discovery of septins
Septins are a family of conserved GTPases that are able to form filaments. They were first
discovered in temperature sensitive screens to identify genes involved in Saccharomyces
cerevisiae cell division (Hartwell 1971). Four septin genes, Cdc3, Cdc10, Cdc11 and Cdc12,
were discovered. A closer look at these budding yeast using electron microscopy (EM) and
immunofluorescence microscopy, revealed the localization of septins as a filamentous collar
encircling the bud neck (Byers and Goetsch 1976; Haarer and Pringle 1987).
Phylogenetic analysis of the septin family unveiled their existence in fungi, animals, protists but
not in plants (Pan et al. 2007; Nishihama et al. 2011). Interestingly, the number of septin genes
varies between organisms. For example, Caenorhabditis elegans has two genes encoding septins
Unc-59 and Unc-61, S. cerevisiae has seven genes (Cdc10, Cdc3, Cdc11, Cdc12 and Shs1 are
expressed during vegetative growth while Spr3 and Spr28 are sporulation specific), Drosophila
melanogaster have five genes (Pnut, Sep1, Sep2, Sep4, and Sep5). Specifically, the mammalian
septin family is encoded by 13 genes (septins 1-12 and 14; hereafter designated SEPT1-
SEPT14). Most of these genes undergo alternative splicing to give rise to multiple isoforms,
where some isoforms show distinct expression profiles (Hall et al. 2005). Septins can also be
grouped into four different categories based on structural similarities (Table 1).
Septin Group Members Features Yeast Equivalent
Septin 2 SEPT1, SEPT2, SEPT4 and
SEPT5
Two coiled-coil
domains Cdc11
Septin 3 SEPT3, SEPT9 and SEPT12 No coiled-coil domain Cdc10
Septin 6 SEPT6, SEPT8, SEPT10,
SEPT11 and SEPT14 One coiled-coil domain Cdc3
Septin 7 SEPT7, SEPT13* One coiled-coil domain Cdc12
Table 1. Categorization of mammalian septin family members along with their structural
features and their yeast equivalents. *Denotes a pseudogene.
2
1.1.2 General features of the septin family
Septins belong to a family of P-loop containing GTP-binding proteins whose structural features
are illustrated in Fig. 1. All septin members contain a core GTP-binding domain, while the N-
terminus and C-terminus are highly variable. Adjacent to the N-terminus is a polybasic region
that binds to phosphoinositides, allowing septins to associate with the plasma membrane. Next is
the GTP-binding domain which binds to and hydrolyzes GTP. The purpose of the hydrolysis is
unclear although it is suspected to be required for certain septin-septin interactions. The septin
unique element is located at the end of the GTP-binding domain and distinguishes septins from
other P-loop containing GTPases. Lastly, the C-terminus can contain zero, one or two coiled-coil
domains; this dictates the subclass that the septin member belongs to (Table 1). The coiled-coil
domain has also been proposed to facilitate a septin-septin or a septin-substrate interaction
(Casamayor and Snyder 2003; Versele and Thorner 2005).
Figure 1. The basic features of the septin members. The domains common to all septins are
illustrated. The regions of the GTP binding domain, amino- and carboxy- termini involved in
septin-septin interactions are shown in blue.
1.1.3 Septin-septin interactions and high order organization
Characterization of septins from different organisms has shown that septins exist in a complex.
In Drosophila, a septin hexamer composed of two copies of Pnut, Sep1 and Sept2 was observed
(Field et al. 1996) and in C. elegans, a heterotetramer composed of two copies of Unc-59 and
Unc-61 was also seen (John et al. 2007). There are thirteen members in the mammalian septin
family, potentially giving rise to a combination of septin complexes. Indeed, septin complexes
isolated from different cell types contain different septins. For example, primary hippocampal
neurons contain complexes of SEPT3, SEPT5, SEPT6, SEPT7 and SEPT11 (Tsang et al. 2011),
3
while Henrietta Lacks (HeLa) cells consists of complexes of SEPT2, SEPT6, SEPT7, SEPT9 and
SEPT11 (Estey et al. 2010).
A significant advance in septin biology was achieved when it was discovered that the septin
complex is ordered. EM studies in S. cerevisiae revealed a septin rod-like octamer and using
tagged septins, the order of this octamer was revealed to be Cdc11-Cdc12-Cdc3-Cdc10-Cdc10-
Cdc3-Cdc12-Cdc11 (Frazier et al. 1998; Bertin et al. 2008).
Later, the molecular structure of the mammalian septin complex containing recombinant SEPT2,
SEPT6 and SEPT7 expressed in E. coli was solved through X-ray crystallography (Sirajuddin et
al. 2007). The mammalian septin hexamer also formed a non-polar rod with the order: SEPT7-
SEPT6-SEPT2-SEPT2-SEPT6-SEPT7 (Sirajuddin et al. 2007). This study also showed the
binding interface between the septins in the complex (Fig. 2A). There is an alternate arrangement
of the two faces of the septins, the amino-carboxy face (NC-NC interface) and the nucleotide
binding face (G-G interface) (Sirajuddin et al. 2007). Biochemical studies have more recently
shown that mammalian septins also exist in an octamer with a SEPT9 associated via the G
interface of SEPT7 (Fig. 2B) (Kim et al. 2011; Sellin et al. 2011).
Figure 2. Illustration of the septin hexamer and octamer. A. The order of the hexamer was
determined through x-ray crystallography. B. The order of the octamer was solved through
biochemical means. Each jellybean represents a septin, image adapted from (Estey et al. 2011).
A.
B.
4
These rod- shaped septin complexes can join end-on-end to form filaments. The lateral
interaction between single complex/filament can also generate bundles. These bundled filaments
can then form higher order structures such as rings and gauzes (Fig. 3).
Figure 3. The higher - order structure of septins. Septins can form filaments through end-on-
end connections of multiple septin complexes and oligomers. These can then be bundled to form
thicker filaments or alternately overlaid to form gauzes or 'meshes'. Septin rings have been
observed, yet the orientation of septin oligomers in the ring (parallel or perpendicular to the ring
axis) remains to be determined. The illustration of the septin ring here is one possible orientation
of septins in that structure.
1.2 Septin functions
1.2.1 Septins in diffusion barrier
Compartmentalization gathers a distinct set of proteins to perform specific tasks. Large protein
complexes can restrict movement of proteins by acting as a physical barrier to prevent diffusion.
Given that septins are filamentous and associate with the plasma membrane (Zhang et al. 1999),
5
it has been proposed that they serve as protein barriers (Luedeke et al. 2005). Recent work
suggested that the role of septins is solely to promote the assembly of the diffusion barrier (Clay
et al. 2014). It is clear that greater effort is needed to determine the exact roles of septins in
diffusion barriers.
1.2.2 Septins contribute to cortical rigidity
The cortex is the portion of the cell immediately underlying the plasma membrane, consisting of
elements of the plasma membrane and the cytoskeleton that work together to maintain the shape
of the cell. In eukaryotes, the cortex regulates the contact between the plasma membrane of one
cell with its neighbour or substrate and controls cell shape, motility and signalling. Septins are
characterized as members of the cytoskeleton due to their fibrous nature and their ability to
associate with phospholipids (Zhang et al. 1999), actin and myosin. Thus they may also play a
role in the regulation of the cell cortex (Tooley et al. 2009; Gilden et al. 2012).
1.2.3 Septins in membrane trafficking
Membrane trafficking is required for cargo or membrane delivery in many processes. In the
mammalian nervous system, exocytic vesicles are released from one neuron to the next to relay
signalling. Vesicles are tethered to the fusion site by the exocyst complex (TerBush et al. 1996).
The fusion event is mediated by the interaction between the soluble N-ethylmalemide-sensitive
factor attachment protein receptors (SNAREs) found on the vesicle (v-SNARE) and those found
at the plasma membrane (t-SNARE). There is a zippering interaction between the v-SNAREs
VAMP/synaptobrevin and the t-SNAREs syntaxin and SNAP-25 (Rizo and Sudhof 2012).
Septins have been linked to the exocyst complex since partial colocalization was observed in
cultured hippocampal neurons (Hsu et al. 1998). Sec8, a component of the exocyst complex, co-
immunoprecipitated SEPT2, SEPT4, SEPT6 and SEPT7 from a rat brain lysate (Hsu et al. 1998).
Furthermore, SEPT2 and SEPT5 were shown to directly interact with the C-terminal region of
syntaxin1a, the same C-terminal region that also binds SNAP-25 and VAMP (Beites et al. 1999),
suggesting that septins are regulators of SNARE interactions. Inhibition of SEPT5 through
depletion or mutation led to a potentiation of exocytosis (Beites et al. 1999; Yang et al.
2010).This potentiation was upstream of the SNARE interaction since introduction of tetanus
6
toxin, which cleaves VAMP, abolished exocytosis (Beites et al. 1999). These results suggest that
SEPT5 may act as a physical barrier to regulate exocytosis.
1.2.4 Septins as scaffolds
Scaffolds facilitate the recruitment of proteins to a specific location through protein-protein
interactions. Since septins can form stable filaments and interact with many different proteins,
they have been proposed to be a molecular scaffold. This is particularly well established in
budding yeast, where septins act as a scaffold during asymmetric cytokinesis. In yeast, a
chitinous cell wall structure, referred to as the primary septum, is generated and required for the
separation of the membrane between the mother and the daughter bud (Schmidt et al. 2003a).
Prior to bud emergence, septins form a ring structure at the bud site (Kim et al. 1991), where
they recruit downstream signalling molecules (DeMarini et al. 1997) such as regulators of actin
organization (Chant and Herskowitz 1991; Fujita et al. 1994; Chant and Pringle 1995; Halme et
al. 1996; Roemer et al. 1996; Sanders and Herskowitz 1996; Drees et al. 2001). Chitin synthase
III, responsible for generating the primary septum, is recruited to the base of the bud by septins
to deposit chitin in the cell wall (DeMarini et al. 1997). Upon cytokinesis, the septin ring
rearranges into a collar encircling the bud neck to recruit the actomyosin ring component Myo1
to assemble the actomyosin ring. The septin collar also recruits subunits of chitin synthase III, as
well as approximately 100 other proteins needed for cytokinesis, to the bud neck (Gladfelter et
al. 2001; McMurray and Thorner 2009).
1.3 Cin85 and CD2AP adaptor family
Cin85 and CD2AP (or CMS) belong to the CMS/Cin85 family of adaptor proteins found in
mammals. Like scaffolds, adaptors also mediate protein-protein or protein-lipid interactions.
Although Cin85 and CD2AP differ in their amino acid sequence, they are structurally similar
(Fig. 4). There are three amino-terminal Src Homology 3 (SH3) domains (referred to as SH3A,
SH3B and SH3C), which bind to proline-rich motifs to mediate signal transduction. These SH3
domains specifically bind to atypical proline-rich motifs that contain the sequence PX(P/A)XXR
(Kurakin et al. 2003; Moncalian et al. 2006). Downstream of the SH3 domains is an internal
7
proline-rich motif which binds to other SH3-containing proteins. Lastly, the C-terminal coiled-
coil domain mediates homotypic and heterotypic protein interactions (Kirsch et al. 1999;
Borinstein et al. 2000; Gaidos et al. 2007).
Both Cin85 and CD2AP show an interaction with actin in vitro. However, the interaction
between Cin85 and actin is weaker. The proline-rich motif and the coiled-coil domain of Cin85
and CD2AP were required for this in vitro interaction and were responsible for bundling actin in
vitro (Gaidos et al. 2007). Given the ability of Cin85 and CD2AP to interact with actin through
their C-terminal ends, and their protein-protein interacting N-terminal ends, both proteins are
thought to act as linkers between cellular signalling and actin dynamics.
Figure 4. The general features of the Cin85/CD2AP adaptor proteins. Cin85 and CD2AP
have the general features depicted above. The three SH3 domains bind to atypical proline-rich
motifs, the internal proline-rich motif binds to other SH3-containing proteins while the coiled-
coil domain mediates oligomerization.
1.3.1 Functions of Cbl-interacting protein of 85kDa - Cin85
The binding partners of Cin85 are mostly involved in the regulation of receptor tyrosine kinases.
Specifically, Cin85 appears to be required for proper signalling as well as linking said signalling
to actin remodelling. The functions of Cin85 will be explained below.
1.3.1.1 Cin85 in the endosomal regulation of receptors
Cin85 was first identified as an interactor of the ubiquitin ligase Cbl which tags activated
receptor tyrosine kinases with ubiquitin for degradation. Receptors normally undergo
endocytosis and the presence of the ubiquitin tag targets the receptor to the lysosome for
degradation. Due to its interaction with Cbl, it is not surprising that Cin85 also functions in
receptor degradation. Indeed, this is seen in the degradation of the epidermal growth factor
receptor (EGFR) (Ettenberg et al. 2001; Huang et al. 2007). Specifically, Cin85 may be involved
in both the initial stages of receptor internalization and during receptor trafficking degradation.
8
After EGFR stimulation, Cin85 forms a complex with Cbl and endophilins, which are involved
in membrane bending necessary for receptor internalization (Kjaerulff et al. 2011). Thus Cin85
bridges two separate events: tagging targeted receptors and facilitating their internalization
(Petrelli et al. 2002; Soubeyran et al. 2002). Another function of the Cin85-Cbl interaction is to
drive local clustering of Cbl molecules by the presence of multiple SH3 domains (Kowanetz et
al. 2003a). The Cin85-Cbl interaction is negatively regulated by the direct binding of
endocytosis related proteins: Dab2, AIP1/Alix and Sprouty to Cin85 (Chen et al. 2000;
Kowanetz et al. 2003b; Schmidt et al. 2004; Haglund et al. 2005), suggesting that there may be
negative feedback loops to control receptor degradation. Moreover, Dab2 links Cin85 to EGFR
sorting in the endosomal pathway. Cin85 also interacts with dynamin2, a GTPase that deforms
lipid bilayers and is needed for vesiculation of late endosomes and EGFR degradation
(Schroeder et al. 2010). Cin85 is also localized at the multivesicular body, a cellular structure
which is responsible for the sorting of internalized cargo (Zhang et al. 2009b). These results
suggest that Cin85 functions at several stages of activated receptor degradation.
1.3.1.2 Cin85 in actin-related functions: cell migration and invasion
In addition to binding to actin, Cin85 also interacts with many proteins involved in actin
remodeling during specific functions. The involvement of Cin85 in these functions is highly
speculative as evidence largely stems from Cin85 colocalization with specific structures and the
identification of proteins interacting with Cin85 that are involved in these function. This is seen
in cell migration and invasion, where Cin85 is localized at actin rich lamellipodia (Havrylov et
al. 2008), focal adhesions (Schmidt et al. 2003b) and invadopodia (Nam et al. 2007). There is a
regulated interaction between Cin85 and the focal adhesion kinases FAK and Pyk2, which are
required for the generation of focal adhesions (Schmidt et al. 2003b), suggesting that Cin85
plays a role in cell migration. Additionally, Cin85 associates with the effectors ASAP/AMAP1
that initiate invadopodia biogenesis (Nam et al. 2007). Disruption of this interaction led to a
reduction in the invasive behaviour of cancer cells, suggesting that Cin85 is involved in cell
invasion and possibly cancer metastasis. In support of this idea, high levels of Cin85 expression
were detected in invasive breast cancer cells.
9
1.3.2 Functions of CD2 associated protein - CD2AP
The SH3 domains of CD2AP interact with a variety of proteins, most of which are involved in
proper formation of the kidney. Like Cin85, CD2AP is also required for proper signalling as well
as linking said signalling to actin remodelling. The specific functions of CD2AP will be
explained below.
1.3.2.1 CD2AP in T-cell Polarization
CD2AP was first identified as an interactor of the CD2 receptor in T-cells. T-cells initially
recognize peptides from the antigen presenting cell (APC), which leads to T-cell activation.
Later, strong cell-cell contacts are generated between T-cells and APC to ensure successful
antigen presentation. To achieve this, the interaction of adhesive molecules such as the binding
of CD2 to CD58 receptors is required in the junction between the T-cell and the APC.
The interaction between CD2AP and the CD2 receptor has been shown to be required for the
local clustering of CD2 receptors (Dustin et al. 1998) needed to maintain a strong interaction
between T cells and APCs. Specifically, the T-cell needs to be activated in order for CD2AP to
interact with the cytoplasmic portion of the CD2 receptor (Dustin et al. 1998). After presenting
the antigen, the T-cell undergoes cytoskeletal polarization to allow for direct delivery of
cytotoxic agents and cytokines to the contact cell. The interaction between CD2AP and the CD2
receptor also seems to regulate cytoskeletal reorganization as overexpression of a dominant
negative form of CD2AP disrupted cell polarization (Dustin et al. 1998). Together this indicates
that CD2AP acts as a scaffold to cluster CD2 receptors and to mediate cytoskeletal
rearrangements, yet how T-cell activation leads to these events remains to be determined.
1.3.2.2 CD2AP in building the kidney architecture
The kidney filters blood to remove waste and excess water and relies on podocytes (epithelial
cells) that line the capilleries around the glomerulus. Podocytes form foot processes generated by
actin mediated membrane protrusions at the base of the glomerular membrane. Blood is filtered
through the tiny slits (slit diaphragms) formed at the junctions where these foot processes meet.
Adhesion proteins such as nephrin are needed to maintain contact between foot processes.
10
Depletion of CD2AP in mice led to death at weeks 6-7 from renal failure suggesting that CD2AP
is involved in kidney function. Indeed, EM examination of the CD2AP depleted kidneys showed
that the defect began in the podocytes (Shih et al. 1999) and a closer look at the podocytes
showed that the absence of CD2AP led to a reduction of adhesion and proliferation as well as
decreased expression of nephrin (Zhang et al. 2009a). CD2AP has been found to localize to the
slit diaphragm (Shih et al. 2001), where it forms a large protein complex consisting of adhesion
proteins P-cadherin, nephrin and ZO-1 (Lehtonen et al. 2004). CD2AP has been proposed to
mediate actin dynamics at the slit diaphragm, which is not surprising given its association with
actin (Welsch et al. 2005) and the actin regulators synaptopodin (Huber et al. 2006), and
cortactin (Welsch et al. 2005). CD2AP appears to have a role linking cell-cell adhesion to the
maintenance of structural integrity at the slit diaphragm.
1.3.2.3 CD2AP in the endosomal regulation of receptors
Like Cin85, CD2AP has also been shown to interact with Cbl in vitro and in vivo in a
phosphorylation dependent manner (Kirsch et al. 2001) suggesting a role for CD2AP in the
down regulation of receptors. Indeed, CD2AP has been linked to the down regulation of EGFR
(Lynch et al. 2003; Konishi et al. 2006). CD2AP associates with endophilins (Lynch et al. 2003)
and may also play an additional role in endosomal trafficking as it was found to interact with
active Rab4 through its C-terminal end in vitro (Cormont et al. 2003). Consequently,
overexpression of CD2AP with Rab4 or CD2AP with Cbl led to enlargement of early endosomes
(Cormont et al. 2003). Although the exact mechanisms are unknown, this indicates a functional
interaction of CD2AP with Rab4 in endocytosis.
1.3.3 Drosophila orthologue cindr
Cin85 and CD2AP have a single Drosophila othologue called Cindr which has the same domain
features as Cin85 and CD2AP (Fig. 4). Cindr also functions similarly to its human orthologue
counterparts. Genetic studies on Cindr have suggested a role for Cindr in cytokinesis, which will
be elaborated in section 1.4.4. In addition, Cindr appears to be involved in cell migration and the
development of cell-cell contacts.
11
Studies looking at the involvement of Cindr in cell migration and cell-cell contacts utilize the
development of the Drosophila pupal eye as the model system. The process of eye formation
requires highly ordered cell patterning of repeating cone, precursor and support cells into a
honeycomb-like structure. Such cell patterning demands cell mobility and cell-cell adhesion.
Throughout this process, adhesion molecules such as DE-cadherin, the Drosophila homolog of
nephrin - Rst - and its binding partner Hbs are required.
Improper positioning of support cells and unstable cell-cell contacts were observed in the
absence of Cindr in vivo (Johnson et al. 2008). Specifically, Cindr seems to be involved in the
localization of DE-cadherins and in the dynamic localization of Rst (Johnson et al. 2012).
Additionally, lower levels of Cindr led to decreased actin polymerization at tight junctions
(Johnson et al. 2008), suggesting that Cindr regulates actin polymerization for structural support.
The regulation of actin polymerization may be through the GTPase Arf6 (Johnson et al. 2011),
although the exact mechanism is still unclear. Thus, it seems that the ability of Cindr to bind to
adhesion proteins DE-cadherin, Hbs and Rst, and actin regulators is required to facilitate and
maintain proper cell-cell contacts during the development of the pupal eye.
1.4 Cytokinesis
1.4.1 Overview of mammalian cytokinesis
To ensure proper development and proliferation of organisms, tissue growth is required. In
mammals, tissue growth is achieved by cell division whereby two daughter cells are generated
from a single mother cell. This complex process involves several temporally and spatially co-
ordinated events. In the mother cell, DNA is replicated and segregated through the process of
mitosis. At the same time, the rest of the cellular contents are also equally divided between the
daughter cells. The daughters are then physically separated by cytokinesis. To avoid improper
partitioning of DNA and cellular content, both mitosis and cytokinesis must be coupled properly
and be error-free. Cytokinesis can be described in two parts: the early and the late stages.
12
1.4.1.1 Early stages of cytokinesis - actomyosin ring assembly and contraction
Cytokinesis begins shortly after segregation of replicated DNA into the daughter cells during
anaphase (Fig. 5). Between the divided DNA lies the spindle midzone, which consists of
overlapping microtubules that help keep the separated DNA apart. The microtubules in the
spindle midzone are further overlapped and cross-linked with the aid of kinesins such as PRC1
and are then associate with the centralspindlin complex and the chromosomal passenger complex
to become the central spindle (Green et al. 2012). The central spindle serves as a scaffold to
recruit the GTPase RhoA, which is needed to assemble the machine that drives cytokinesis - the
actomyosin ring (Green et al. 2012). The actomyosin ring is made up of non-muscle myosin II
and filamentous actin. The assembly of the actomyosin ring is mediated by temporal and spatial
recruitment and activation of myosin II regulating kinases and actin regulators (Sellers et al.
1981; Amano et al. 1996; Kimura et al. 1996; Madaule et al. 1998; Kosako et al. 2000;
Poperechnaya et al. 2000; Yamashiro et al. 2003; Watanabe et al. 2008).
How the actomyosin ring constricts on the local and global scale remains to be determined given
that the exact orientation of actin filaments and myosin II in the actomyosin ring is still under
debate. Nonetheless, ring constriction pulls the membrane inward and creates indentations
towards the center of the cell referred to as the cleavage furrow (Fig.5). Once the actomyosin
ring completely closes in late telophase, the bundled microtubules are compacted to form the
intercellular bridge, the sole structure connecting the daughter cells. The actomyosin ring itself
transforms into a protein dense structure at the center of the intercellular bridge called the
midbody. Many proteins involved in the assembly of the actomyosin ring and components of the
actomyosin ring such as septins, anillin and MgcRacGAP remain in the newly formed midbody.
Additionally, proteins involved in the severing of the intercellular bridge are also recruited to the
midbody
1.4.1.2 Late stages of cytokinesis - abscission
Abscission is the last stage of cytokinesis, where the intercellular bridge is severed. This involves
breaking of the continuous membrane that connects the two daughter cells at the abscission site,
usually located at one side of the midbody. Abscission is driven by the secondary ingression
13
event, where by the intercellular bridge immediately flanking the midbody is further compacted
(Schiel et al. 2011). Much work has been dedicated to identifying the mechanism of abscission
and several non-exclusive models have been proposed.
Figure 5. Overview of cytokinesis in animals. The two stages of cytokinesis indicated on the
right. DNA is shown in blue, microtubules are shown in grey and the contractile ring and
midbody are shown in pink. Image adapted from (Green et al. 2012).
14
1.4.1.2.1 Vesicle fusion model
The first model proposes that abscission is mediated by vesicle fusion. Vesicle fusion is
dependent on the exocyst complex, which tethers the vesicle to the docking site, while SNAREs
catalyze fusion of the vesicle to the plasma membrane. This model is supported by the finding
that approximately one third of the midbody proteome is composed of proteins involved in
vesicle tethering and fusion (Skop et al. 2004) and depletion of several of these components
resulted in an abscission defect (Gromley et al. 2005). In addition, abscission occurs about ten
minutes after vesicle fusion can be seen at the midbody (Gromley et al. 2005; Guizetti et al.
2011).
Vesicles from recycling endosomes and the Golgi have been shown to accumulate to the
midbody. The GTPases Rab11 and Rab35 are commonly found on endosomes and are required
for membrane trafficking between endosomes and the plasma membrane. Depletion of either
Rab protein led to normal cleavage furrow ingression and midbody formation, but the midbody
eventually collapsed giving rise to binucleated cells (Wilson et al. 2005; Kouranti et al. 2006;
Chesneau et al. 2012). Similarly, treatment with brefeldin A, which disrupts the Golgi, also
impaired abscission (Skop et al. 2001; Gromley et al. 2005). While vesicle delivery to the
midbody appears to be needed for abscission, it is not clear exactly what role these vesicles play
in abscission. They may provide additional membrane needed for the daughters to separate or
they may deliver factors needed for abscission. Whether vesicle fusion-mediated membrane
scission is the mechanism of abscission remains controversial due to recent observations that
Golgi vesicles may not be necessary for abscission (Guizetti et al. 2011). Another possibility is
that endosomal vesicle fusion is required during secondary ingression where it is needed to
narrow the intercellular bridge and deliver factors that drive abscission (Schiel et al. 2011).
1.4.1.2.2 Membrane fission model
High resolution live and fixed images show that part of the endosomal sorting complex required
for transport (ESCRT) machinery is localized at both sides of the intercellular bridge adjacent to
the midbody as rings (Elia et al. 2011; Guizetti et al. 2011). The ESCRT machinery is known to
be involved in the membrane scission needed for viral budding and the formation of
multivesicular bodies (Wollert et al. 2009; Henne et al. 2011). This membrane scission event is
15
topologically similar to the membrane fission required for abscission. Deletion of ESCRT
components such as Tsg101 and ESCRT associated protein Alix led to impaired abscission
(Carlton and Martin-Serrano 2007; Morita et al. 2007), which supports the more popular model
that ESCRT-mediated membrane fission is the mechanism of abscission.
1.4.1.2.3 Mechanical rupture
The tension generated by the daughter cells migrating away from each other may be sufficient to
break the intercellular bridge. Here, the machinery involved in vesicle fusion and membrane
fission are not required. Given the variable migratory and invasive behaviour among different
cell types, it seems likely that some cells may utilize this method of separation, while others may
require mechanisms described in previous sections.
1.4.2 Involvement of septins in mammalian cytokinesis
Septins were first identified as genes involved in yeast cytokinesis. Since then, there has been a
great deal of work elucidating the role of septins in mammalian cytokinesis. It seems clear that
septins function in steps during both early and late cytokinesis.
1.4.2.1 Role of septins in the early stages of cytokinesis
Early work investigating the role of septins in cytokinesis was done in the embryos as well as
dividing cells of Drosophila where the septin Pnut was found at the furrow canal and cleavage
furrow (Neufeld and Rubin 1994; Oegema et al. 2000; Field et al. 2005). Additionally, septins
are recruited to the actomyosin ring by an important cytokinetic protein called Anillin (D'Avino
et al. 2008; Goldbach et al. 2010; Piekny and Maddox 2010; Mostowy and Cossart 2012).
Immunofluorescence of cultured cells in anaphase also showed that SEPT2, SEPT6, SEPT7,
SEPT9 and SEPT11 localized to the cleavage furrow (Joo et al. 2007; Estey et al. 2010). In the
study by Estey et al., HeLa cells depleted of each individual septin by siRNA were followed by
time-lapse microscopy. This led to the conclusion that SEPT2 and SEPT11 are involved in the
early stages of cytokinesis as their absences led to abnormal cleavage furrow constriction where
ingression occurred at one end of the two segregated DNA molecules instead of in between the
segregated DNA molecules (Estey et al. 2010). Indeed, the specific role of SEPT2 may be linked
16
to myosin II as inhibiting this interaction led to unstable cleavage furrows and binucleation (Joo
et al. 2007).
1.4.2.2 Role of septins in the late stages of cytokinesis
In addition to the cleavage furrow, SEPT2, SEPT6, SEPT7, SEPT9 and SEPT11 were also
localized to either side of the intercellular bridge and at the midbody in telophase cells (Joo et al.
2007; Estey et al. 2010). Exogenously expressed SEPT1 co-localized with the chromosomal
passenger complex component Aurora B kinase at the midbody of HeLa cells and is a substrate
of Aurora B phosphorylation in vitro (Qi et al. 2005).
Although SEPT2 and SEPT11 were found to be involved in the early stages of cytokinesis,
SEPT9 is not involved in this step, as its depletion allowed normal cleavage furrow ingression.
Instead, only 70% of the SEPT9 depleted cells completed severing of the midbody within 9
hours after initiation of cytokinesis compared to 100% of the control cells, which abscised in an
average of 3.9 hours. Of the 30% that failed to abscise, 20% of the cells were joined by
midbodies that persisted into the next round of mitosis or did not break even 40 hours later. The
remaining 10% either became binucleated due to midbody regression or went through apoptosis
(Estey et al. 2010). Interestingly, SEPT9 is required for recruitment of the exocyst machinery
component Sec8 to the midbody (Estey et al. 2010) and for recruitment of the ESCRT machinery
component Chmp4B to the abscission site (Renshaw et al. 2014).
SEPT9 has many splice variants. Of these, there are five N-terminal variants with a common C-
terminal end (McIlhatton et al. 2001), as depicted in Fig. 6. There is a region of approximately
140 amino acids at the N-terminus (termed N-terminal region) that is present in SEPT9_i1,
SEPT9_i2 and SEPT9_i3 and absent in SEPT9_i4 and SEPT9_i5. This structural difference
alters the function of septins. Exogenous SEPT9_i1 and SEPT9_i3 are able to rescue an
abscission defect seen from depletion of all SEPT9 isoforms, while expression of exogenous
SEPT9_i4 failed to rescue the defect (Estey et al. 2010). This highlights the importance of the N-
terminal region for cytokinesis. Additionally, over-expression this N-terminal region also led to
an abscission defect (unpublished M. Estey). This dominant negative result suggests that other
factors that bind to the SEPT9 N-terminal fragment may be needed for cytokinesis, as these
17
factors may be titrated by the excess N-terminal fragment. Analysis of the SEPT9 N-terminus
revealed two atypical proline-rich motif sequences which contain the atypical sequence
PX(P/A)XXR.
Figure 6. The five N-terminal isoforms of SEPT9. The region highlighted in green is the N-
terminal region present in SEPT9_i1, -_i2 and -_i3.
1.4.3 Role of anillin in cytokinesis
Another protein shown to be necessary for cytokinesis is anillin. Much work has been spent on
investigating the role of anillin in Drosophila, and like septins, anillin is needed throughout early
and late cytokinesis.
In the early stages of cytokinesis, depletion of anillin led to an increase in binucleated cells
(Straight et al. 2005; Liu et al. 2012). This may be because anillin interacts with important
factors involved in actomyosin ring formation (Field and Alberts 1995; Straight et al. 2005;
D'Avino et al. 2008; Piekny and Glotzer 2008; Goldbach et al. 2010; Watanabe et al. 2010).
Interestingly, anillin has also been shown to interact with phosphatidylinositol phosphate,
specifically PI(4,5)P2 (Liu et al. 2012), which is enriched at the cleavage furrow (Emoto et al.
2005). This suggests that anillin may be involved in holding the actomyosin ring in the correct
place (Straight et al. 2005; Piekny and Glotzer 2008; Goldbach et al. 2010; Kechad et al. 2012;
Liu et al. 2012). Furthermore, anillin has also been shown to be needed for closure of the
actomyosin ring (Kechad et al. 2012).
18
During the late stages of cytokinesis, the anillin-septin interaction is needed for maturation of the
intercellular bridge. Using a mutant form of anillin that doesn't bind septins, it was found that the
length of the intercellular bridge was smaller (Renshaw et al. 2014). Anillin also scaffolds the
newly formed midbody. Using time lapse- microscopy and C- and N-terminal truncations of
anillin, it was discovered that anillin mediates a septin-dependent membrane anchor at the
midbody (Kechad et al. 2012).
1.4.4 Involvement of CD2AP and cindr in cytokinesis
Cindr has been implicated in Drosophila cytokinesis. It colocalizes with anillin at the cleavage
furrow, intercellular bridge and the midbody during complete (Haglund et al. 2010) and
incomplete cytokinesis (Eikenes et al. 2013). Additional studies showed that the C-terminal end
of Cindr is responsible for its recruitment to ring canals (Eikenes et al. 2013). Partial depletion of
Cindr in Drosophila embryos led to a small increase in binucleated cells within the embryo
(Eikenes et al. 2013). This was similarly seen in cultured Drosophila cells where there was a
three-fold increase in binucleation, while time-lapse microscopy showed that there was a delay in
abscission and cleavage furrow regression (Haglund et al. 2010). Cindr was also shown to
interact with anillin in vitro through the binding of the SH3 domains of Cindr and the atypical
proline-rich motif of anillin (Haglund et al. 2010). Most of these results implicate Cindr in
cytokinesis but further work will be needed to determine the exact mechanism.
Similar to Cindr, CD2AP has been previously implicated in cytokinesis (Monzo et al. 2005).
Specifically, CD2AP was found at the midbody during telophase in HeLa cells. Overexpression
of either the full-length or the first two SH3 domains of CD2AP led to an increase in the
population of cells that are binucleated. This indicates the possibility that the first two SH3
domains of CD2AP might be titrating out important factors required for the completion of
cytokinesis. Depletion of CD2AP using siRNA led to an approximate seven-fold increase in the
percentage of cells connected by a midbody, indicative of a defect in abscission. CD2AP also
interacts with anillin in vitro through the binding of the first two SH3 domain of CD2AP to the
proline-rich motif of anillin (Monzo et al. 2005). These results suggest that CD2AP does
function in cytokinesis, although the exact mechanism remains to be determined.
19
1.5 Hypothesis and Rationale
Septins have been implicated in both yeast and mammalian cytokinesis. In budding yeast, septins
act as scaffolds to recruit specific proteins needed for the progression of cytokinesis. Despite
extensive work in the field, the exact mechanism of septins in cytokinesis is not well understood,
but it is likely that their functions are conserved. Interestingly, depletion of SEPT9 in HeLa cells
led to an abscission defect (Estey et al. 2010) and this was rescued by the introduction of
SEPT9_i1 and SEPT9_i3 but not SEPT9_i4. Moreover, overexpression of the N-terminal region,
that is present in SEPT9_i1 and SEPT9_i3 but not SEPT9_i4, led to an abscission defect in HeLa
cells, suggesting the possibility that it may have titrated out other cytokinetic factors. In this
region of SEPT9, there are two atypical proline-rich motifs and these motif sequences have been
shown to be targets of SH3-containing adaptor proteins Cin85 and CD2AP (Moncalian et al.
2006). CD2AP has been previously implicated in mammalian cytokinesis (Monzo et al. 2005),
but its relation to septins has yet to be investigated. This leads to the hypothesis that SEPT9
interacts with Cin85 and/or CD2AP, and that this interaction is required for the completion of
mammalian cytokinesis.
20
Chapter 2 Methods and Materials
2.1 Cell Culture
Henrietta Lacks (HeLa) cervical cancer cells were obtained from ATCC. Cells were grown in a
humidified 37°C incubator with 5% CO2. Cells were cultured in Dulbecco's Modified Eagle's
Medium (DMEM) (Wisent) with 10% fetal bovine serum (FBS) (Wisent).
2.2 Western Blot
Samples were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-
PAGE) for protein separation and transferred to a polyvinylidene fluoride (PVDF) membrane (at
250 mA for 2 hours, 400 mA for 1.5 hours or 40 mA overnight). To detect for successful
transfers, the blot was initially stained with 0.1% Ponceau S (Bioshop) in 5% acetic acid. The
blots were then blocked in Tris buffered saline (TBS) with 0.1% Tween (TBS-T) and 5% milk
for at least one hour, and incubated with the primary antibodies that was diluted into TBS-T with
1% Bovine Serum Albumin (BSA) (Roche). The primary antibodies: Cin85 (mouse monoclonal,
Millipore - clone 179.1 E1), CD2AP (rabbit polyclonal, Santa Cruz - H290), acetylated tubulin
(AcTub) (mouse monoclonal, Sigma), green fluorescent protein (GFP) (rabbit polyclonal,
Invitrogen), SEPT2 (mouse monoclonal, Protein Tech Group), SEPT 9 (Surka et al. 2002),
SEPT6 (rabbit polyclonal, Protein Tech Group), SEPT7 (rabbit polyclonal, a gift from Dr. B.
Zieger), SEPT11 (Huang et al. 2008), Flag (goat polyclonal, Santa Cruz), Glyceral Aldehyde-3-
phosphate Dehydrogenase (GAPDH) (mouse monoclonal, Convance) were incubated overnight
at 4°C. After washing with TBS-T, blots were incubated for approximately one hour with the
appropriate horse radish peroxidase (HRP) - conjugated secondary antibodies (Biorad or
Jackson) diluted in TBS-T. Blots were subsequently washed and incubated with Western
Lighting Chemiluminescence Reagent Plus (PerinElmer), and chemiluminescence was detected
on film.
21
2.3 Constructs
The sequences of all constructs made using polymerase chain reaction (PCR) or site directed
mutagenesis were verified by sequencing (ACTG Corp.)
2.3.1 SEPT9 Constructs
Flag-SEPT9_i1 (accession number AF189713), Flag-SEPT9_i3 (accession number
NM_006640), Flag- SEPT9_i4 (accession number NM_001113494.1), peGFPc1-SEPT9_i3, and
peGFPc1-SEPT9 N-term were prepared by Mark Surka. All SEPT9 constructs contained a silent
point mutation to destroy the EcoR1 site present in all SEPT9 isoforms. SEPT9 N-term Region
spans from amino acid 8 - 146 of SEPT9_i3.
2.3.1.1 Generating SEPT9 T73/130A constructs
Threonine 73 and 130 of SEPT9_i3 were mutated to alanine by site directed mutagenesis
(Stratagene) using peGFPc1-SEPT9 N-term and the peGFPc1-SEPT9_i3 (siRNA resistant) as the
templates with the following primers:
For threonine 73:
5' CCC AAG GCG TCC CTG GCG AGG GTG GAG CTC TCG 3' Forward
5' CGA GAG CTC CAC CCT CGC CAG GGA CGC CTT GGG 3' Reverse
For threonine 130:
5' CCA GAA CCG GCC CCT GCG AGG ACG GAG ATC ACC 3' Forward
5' GGT GAT CTC CGT CCT CGC AGG GGC CGG TTC TGG 3' Reverse
The double mutation was generated through mutation of one threonine, after verification this was
used as the template for the second round of site directed mutagenesis.
2.3.2 Cin85 Constructs
pcDNA3.1-Cin85 was kindly provided by Daniella Rotin. A mutation in this construct (V570A)
was corrected through site directed mutagenesis using the following primers:
5' CCT CTG TCC TCA GCG GCG CCC TCC CCC CTG TCA TC 3' Forward
5' GAT GAC AGG GGG GAG GGC GCC GCT GAG GAC AGA GG 3' Reverse
22
PGEX-6p1-CIN85 SH3A, PGEX-6p1-Cin85 SH3B, PGEX-6p1-Cin85 SH3C, PcDNA3.1-Cin85
SH3ABC constructs were generated by Dr. M. Estey.
2.3.3 CD2AP Constructs
Human CD2AP clone (IMAGE ID: 1352119) was purchased from Thermo Scientific.
Full-length CD2AP was amplified by PCR using the following primers:
5' AAA AAA CAA TTG ATG GTT GAC TAT ATT GTG GAG TAT 3' Forward
5' AAA AAA CTC GAG TCA AGA AGA CAG GAC AGC TTT TTT 3' Reverse
The first SH3 domain (CD2AP SH3A) comprised of amino acids 1- 58 was amplified by PCR
using the following primers:
5' AAA AAA CAA TTG ATG GTT GAC TAT ATT GTG GAG TAT 3' Forward
5' AAA AAA CTC GAG TTT AAT TTC CTT AAC GAA ATT GTC 3' Reverse
The second SH3 domain (CD2AP SH3B) comprised of amino acids 111-166 was amplified by
PCR using the following primers:
5' AAA AAC AAT TGC GTC AGT GTA AAG TTC TTT TTG AG 3' Forward
5' AAA AAA CTC GAG CTC TAA TTC TTT CAC AAA ATT TGA 3' Reverse
The third SH3 domain (CD2AP SH3C) comprised of amino acids 272-329 was amplified by
PCR using the following primers:
5' AAA AAC AAT TGG AAT ATT GTA GAA CAT TAT TTG CC 3' Forward
5' AAA AAA CTC GAG ATT TAT CTG GAC AGC AAA ATT GTC 3' Reverse
The first three SH3 domains (CD2AP SH3ABC) comprised of amino acids 1-329 were amplified
by PCR using the forward primer used to amplify full-length CD2AP and the reverse primer
used to amplify the third SH3 domain:
5' AAA AAA CAA TTG ATG GTT GAC TAT ATT GTG GAG TAT 3' Forward
5' AAA AAA CTC GAG ATT TAT CTG GAC AGC AAA ATT GTC 3' Reverse
23
All the expression constructs in the lab had been previously modified to allow for simpler
subcloning using an in frame EcoRI and XhoI (Moshe Kim). For cloning CD2AP into a
mammalian expression vector, the two internal EcoRI sites located at nucleotide position 184
and 281 were silently mutated through two sequential rounds of site directed mutagenesis using
the following primers:
EcoRI site at nucleotide 184:
5' GGA AAT TAA AAG AGA GAC GGA GTT CAA GGA TGA CAG TTT GCC C 3' Forward
5' GGG CAA ACT GTC ATC CTT GAA CTC CGT CTC TCT TTT AAT TTC C 3' Reverse
EcoRI site at nucleotide 281:
5' GGA CTT CCA GCT GGA GGG ATT CAG CCA CAT CCA C 3' Forward
5' GTG GAT GTG GCT GAA TCC CTC CAG CTG GAA GTC C 3' Reverse
Flag tagged full-length CD2AP and CD2AP SH3ABC were amplified by PCR using the same
respective forward and reverse primers as listed above.
2.3 siRNA Treatment
Double stranded RNAs were ordered from the indicated manufacturer, with dTdT overhangs and
dissolved in siRNA buffer (Thermo Scientific) diluted in sterile water for a final concentration of
40pmol/µL and stored in the -80°C freezer in working aliquots. The sequences of the siRNA
targeted against the protein of interest are the following:
Human SEPT9 (Dharmacon): GCACGATATTGAGGAGAAA
Human CD2AP (Santa Cruz): is a pool of 3 different siRNAs:
A: CCAUCUGUGUACCUUUCAATT
B: CCAGUGCUUCUAAAGCAAATT
C: CCACUAAGCUUCUGUCUUATT
Human Cin85 (Thermoscientific): AAGACTGTTACCATATCCCAA
Control SiRNA: (Dharmacon): D-001206-13-20 siGENOME non-targeting siRNA pool 1
24
The protein of interest was knocked down with the siRNA using Lipofectamine 2000 (Life
Technologies) as per the manufacturer's protocol. Briefly, 25 minutes prior to transfection, fresh
media was replaced for a single well on a six well plate. 120 pmol of double stranded siRNA and
3 μl of Lipofectamine 2000 transfection reagent were each diluted with 100 μl of serum-free
DMEM. These were incubated for 5 minutes at room temperature, after which they were mixed.
The mixture was pipetted up and down to mix and was incubated at room temperature for 20
minutes. This mixture was then added dropwise to the 80-90% confluent six well. Eight hours
post transfection, the cells were then split to an appropriate dilution for the subsequent
experiment. The cells were allowed to grow for two days and eight hours post transfection to
allow for the siRNA to knock down the protein of interest.
2.4 Transfection
Unless stated, HeLa cells were transfected with the construct of interest using Jetprime
(PolyPlus) as per the manufacturer's instructions. Subsequent experiments were performed after
at least 24 hours of protein expression.
2.5 Generation of the Stable Cell Line
Stable cell lines expressing siRNA resistant SEPT9_i3 by induction with doxycycline were
previously generated by Dr. M. Estey. The inducible siRNA resistant SEPT9R73+130A stable
cell lines were generated in a similar manner using the Retro-X-Tet-On Advanced Inducible
Expression System (Clontech). The parent HeLa Tet-On cell line was previously generated by
Dr. M. Estey. This was done by transfecting pRetroX-Tet-On-Advanced into FLYRD18
packaging cells using the calcium phosphate method. 24 hours post transfection, the media was
changed and after an additional 24 hours, the virus containing media was filtered (Pall 0.2 µm
HT Tuffryn filter). Polybrene (Sigma) was added to the filtered virus at a final concentration of
8µg/mL and this was added to wild-type HeLa cells. Four to six hours after infection, the media
was changed back to DMEM with 10% FBS (Wisent) and two days later, Tet-On cells were
selected by G418 (500 µg/mL) . Individual colonies were expanded and screened for the
presence of the Tet-Advanced transactivator. This parent Tet-On cell line was maintained in 500
µg/mL G418. Flag-SEPT9 R73/130A was cloned into the pRetroX Tight Pur (Clonetech) by
25
subcloning from GFP-SEPT9R73/130A using EcoRI and SbfI. This was then transfected into
FLYRD18 by calcium phosphate transfection as described above and the resulting virus was
used to infect the parent Tet-On cell line (at the time maintained at 250 µg/mL G418). Two days
after virus infection, puromycin was added to a final concentration of 1µg/mL for selection.
Individual colonies were expanded and screened by induction with various amounts of
doxycycline and Western blotting with the Flag antibody (mouse monoclonal, Sigma). The
resulting cell line that inducibly expresses Flag-SEPT9R73+130 was then maintained in DMEM
with 10% FBS, 1% penicillin-streptomycin, 500 µg/mL G418 and 1 µg/mL puromycin.
Induction of protein was achieved through the addition of doxycyline approximately 32 hours
prior to the experiment.
2.6 Immunofluorescence
To look at cytokinetic defects, cells were washed with Hanks Balanced Salt Solution (HBSS)
(Wisent) and then fixed with 4% paraformaldehyde in HBSS for 30 minutes at room
temperature. Cells were then incubated with 0.2% Triton X-100 (Bioshop), 25 mM glycine, 25
mM NH4Cl in PBS for 10 minutes and blocked in 5% horse serum (Multicell) in PBS for at least
30 minutes. Cells were incubated with the acetylated tubulin (mouse monoclonal, Sigma)
antibody and the MgcRacGAP (goat polyclonal, Novus Biological) antibody diluted in 1:1000
and 1:500 (respectively) in PBS with 2.5% horse serum for at least an hour. Cells were washed
with PBS and then incubated with donkey anti-mouse Cy3 antibody (Invitrogen) and donkey
anti-goat Cy5 antibody (Invitrogen), both diluted 1:1000 in PBS with 2.5% horse serum for at
least an hour. Cells were then washed and incubated with DAPI (Sigma) in PBS for 10 minutes.
Cells were washed and coverslips were then mounted on slides using DAKO fluorescent
mounting medium.
For analysis of Cin85 and CD2AP localization, cells were fixed in 100% methanol at -20°C for 5
minutes. Cells were washed with PBS and blocked in 5% horse serum in PBS for at least an
hour. Cells were washed with PBS and then incubated with the following antibodies: Cin85
(mouse monoclonal, Millipore - clone 179.1 E1) (1:100), MgcRacGAP (goat polyclonal, Novus
Biological) (1:500), CD2AP (rabbit polyclonal, Santa Cruz - H290) (1:200), or acetylated tubulin
(mouse monoclonal, Sigma) (1:1000). All antibodies were diluted in PBS containing 2.5% horse
26
serum. Cells were washed with PBS and then incubated with the appropriate secondary antibody
(Invitrogen) diluted 1:1000 in PBS with 2.5% horse serum. Cells were washed, stained with
DAPI and mounted as described above.
2.7 Fluorescence Microscopy
Cells were visualized on an epifluorescence microscope (Leica) equipped with a Hamamatsu
camera. Images were acquired using Volocity (PerkinElmer). Images were taken at 63x
magnification for midbody quantification and at 100x magnification for quantifying Cin85 and
CD2AP signal at the midbody. The population of cells arrested in telophase were quantified by
counting the number of cells connected by a microtubule bridge stained by anti-acetylated
tubulin and dividing that by the total population in the sample. Fluorescent signal at the midbody
was measured from the image using Image J. Midbody enrichment is determined by dividing the
signal of the protein of interest at the midbody by the signal found at the nucleus and this is
expressed as the enrichment index.
2.8 Immunoprecipitation
Cells were washed with PBS prior to collecting them by scraping in IP buffer (30 mM HEPES,
pH 7.5, 100 mM NaCl, 1 mM ethylene glycol tetraacetic acid (EGTA), 1% TritonX-100, 20 mM
NaF) supplemented with protease inhibitor tablet (Roche) and phosphatase inhibitors (1 mM
sodium orthovanadate and 100 mM okadaic acid). Lysis was ensured by passing the mixture
through a 27.5-gauge needle three to five times and incubating for 10 minutes with rotation at
4°C. Lysates were cleared by centrifugation at 14,000 rpm for 10 minutes. The supernatant was
precleared with 150 µL of mouse IgG immobilized - agarose beads (Sigma) for at least one hour
at 4°C with rotation. These beads were pelleted by centrifugation at 2,000 rpm for one minute at
4°C. The supernatant was applied to 35 µL of mouse anti-Flag M2 affinity gel (Sigma) and
incubated for at least two hours at 4°C with rotation. The beads were washed four times with IP
buffer, and bound proteins were eluted with 75 µL of IP buffer containing 100 µg/mL 3x Flag
peptide (Sigma). SDS-PAGE loading buffer was added to the elution and the sample was further
subjected to Western blot analysis.
27
2.9 Protein Purification from Bacteria
Bl21 Magic bacteria transfected with the Glutathione S-transferase (GST) fusion proteins of
interest were inoculated in a 5 ml starter culture containing 5 mL LB with 100 µg/mL ampicillin
and 50 µg/mL kanamycin and grown overnight at 37°C with rotation. This was then used to seed
a 250 mL culture of LB with 100 µg/mL ampicillin and 50 µg/mL kanamycin and grown at 37OC
with shaking until the O.D600 reached 0.6-0.9. Protein expression for GST-SH3A, GST-SH3B
and GST-SH3C of Cin85 and CD2AP were induced with the addition of 0.2 mM isopropyl-beta-
D-thiogalactopyranoside (IPTG) for two hours at 37°C. Bacteria were collected by centrifugation
at 6000 g for 10 minutes at 4°C. Typically for individual SH3 domain GST-fusions, a quarter of
the cells were sufficient for subsequent binding assays, the remainder of the pellets were frozen
and stored at -80°C. For the pull down assay, bacterial pellets were suspended and lysed in 10
mL of bacterial resuspension buffer (resuspension buffer BACT) (25 mM HEPES, pH 7.8, 100
mM NaCl, 5 mM MgCl2, 0.05% Tween-20, 1 mM DTT, 1 µg/mL leupeptin, 1 mM
phenylmethylsulfonyl fluoride and 1 µg/mL pepstatin A) supplemented with 1x Fastbreak
detergent (Promega). The soluble fraction was obtained through centrifugation of the lysate at
14,000 rpm for 10 minutes at 4°C and added to 300 µl of glutathione agarose beads (50% slurry
equilibrated in resuspension buffer BACT). This was rotated for at least two hours at 4°C. The
beads were then washed three times with 10 ml of resuspension buffer BACT and stored as a
50% slurry (with resuspension buffer BACT) at 4°C.
2.10 Pull-down Assay
Cells were washed with PBS and collected by scraping into pull-down buffer (20 mM Tris, pH
7.5, 150 mM NaCl, 5 mM EDTA, 5% glycerol, 0.5% Triton X-100) supplemented with protease
inhibitor tablets (Roche), and phosphatase inhibitors (1 mM sodium orthovanadate and 100 nM
okadaic acid). Lysis was ensured by passing the mixture through a 27.5-gauge needle three times
and rotated at 4°C for 15 minutes. Lysates were cleared by centrifugation at 14,000 rpm for 10
minutes. The protein concentration of the cleared lysate was measured using the Bradford
reagent (BioRad). The 40 µg GST-fusion immobilized beads were equilibrated with pull-down
buffer and approximately 0.3 mg - 0.5 mg of lysate was added. This mixture was incubated for
four hours at 4°C with shaking. The beads were washed four times with the pull-down buffer and
resuspended in SDS-PAGE loading buffer for Western blot analysis.
28
2.11 Statistical Analysis
Statistical Significance was determined through two-tailed student's t-tests.
29
Chapter 3 Results
3.1 Localization of Cin85 and CD2AP during late telophase
I hypothesize that Cin85 and/or CD2AP binds to SEPT9 and that this is required for the
completion of cytokinesis. To test this hypothesis, I first wanted to determine whether Cin85 and
CD2AP may play a role in cytokinesis. Their localization during telophase in HeLa cells was
determined by immunofluorescence and fluorescence microscopy.
Under methanol or paraformaldehyde cell fixations, weak signals for endogenous Cin85 were
found at the cytosol and at the midbody during telophase, as it co-localized with Cep55, a
centrosomal protein required to recruit the ESCRT machinery to the midbody. In some instances
Cin85 appeared as a bright punctate structure at the midbody (Fig. 7A). This signal was much
higher compared to that of the cytosol, but this was only seen in a few cells. Due to the
variability of the Cin85 signal at the midbody, I quantified the enrichment of Cin85 at the
midbody by taking the ratio between the Cin85 signal at the midbody and its signal at the
nucleus. The enrichment index of Cin85 at the midbody was found to be approximately 1.37,
indicating that there was about a 30% enrichment of endogenous Cin85 at the midbody
compared to the nucleus. This signal is specific to Cin85 since depletion of Cin85 through
siRNA treatment eliminated the midbody signal (Fig. 7A).
Next, I looked at the localization of endogenous CD2AP using the same method. Following
methanol fixation of the cell, CD2AP staining was also apparent at the cytosol and at the
midbody in late telophase HeLa cells. Unlike Cin85, CD2AP was consistently enriched at the
midbody since it co-localized with the midbody marker MgcRacGAP (Fig. 8A, first row). The
enrichment value of CD2AP at the midbody was measured to be 1.87. When CD2AP was
depleted by transfection of siRNA targeted against CD2AP, the CD2AP signal at the midbody
also disappeared (Fig. 8A, second row). This indicates that the localization and enrichment of the
signal at the midbody is specific to CD2AP.
Collectively, these results suggest that Cin85 and CD2AP may have a functional role during late
cytokinesis since both proteins were found at an important cytokinetic site: the midbody.
30
Figure 7. Endogenous Cin85 is enriched in the midbody of telophase HeLa cells. A.
Representative images of the localization of endogenous Cin85 in HeLa cells during telophase.
Cells were treated with a non-targeting (NTC) or Cin85 siRNA using either standard methanol or
paraformaldehyde fixation. Midbodies were visualized by the Cep55 antibody and DAPI was
used to visualize DNA. The average midbody enrichment index of endogenous Cin85 was 1.37.
This average was measured from three repeats of methanol fixation and three repeats of PFA
fixation where 40 midbodies where looked at for each repeat. Bars, 6 μm. B. Western blot of
Cin85 knockdown or control cell lysate probing for levels of Cin85. GAPDH was used as a
loading control.
B. A.
31
Figure 8. CD2AP enrichment at the midbody is independent of SEPT9 and Cin85. A.
Representative images of CD2AP localization in telophase HeLa cells when treated with a non-
targeting (NTC), SEPT9, Cin85 or CD2AP siRNA. Cells were co-stained with anti-MgcRacGAP
as a midbody marker, anti-acetylated tubulin (AcTub) as the intercellular bridge marker and
DAPI as a DNA marker. Bars, 280 μm. B. The average midbody enrichment indices were 1.87
for the non targeting siRNA, 1.84 for SEPT9 siRNA and 2.01 for Cin85 siRNA. These averages
were measured from four repeats where 50 midbodies where looked at for each repeat. C.
Representative Western blots of knockdown or control cell lysates probing for levels of SEPT9,
CD2AP or Cin85. GAPDH was used as a loading control. The relative expression levels
indicated represents the average of four repeats.
B. A.
C.
32
3.2 Depletion of SEPT9, Cin85 or CD2AP led to an abscission defect
The previous experiment suggests that adaptor proteins Cin85 and CD2AP may be involved in
cytokinesis. To directly test whether Cin85 and CD2AP have a role in cytokinesis, I depleted
Cin85 or CD2AP using siRNA treatment and quantified the proportion of cells connected by a
midbody. SEPT9 was used as a positive control as knockdown of SEPT9 leads to an abscission
defect manifested by an increase proportion of cells arrested in telophase (Estey et al. 2010).
Approximately 6% of the cells transfected with a non-targeting control siRNA were in telophase,
while depletion of SEPT9 led to a 2.0 fold increase in telophase cells to 12% (p<0.01) (Fig. 9).
Interestingly, depletion of either Cin85 or CD2AP showed a similar proportion of cells with an
abscission defect (11.7%, p<0.01 and 12.3%, p<0.05 respectively) (Fig. 9). These results suggest
that Cin85 and CD2AP have roles in cytokinesis, yet how they participate in the pathway
remains unclear. Both adaptors may have redundant roles in separate pathways or both proteins
may participate in the same pathway, where one may act upstream of the other or both may act at
the same point. To address which possibility it may be, both Cin85 and CD2AP were depleted
and the resulting abscission defect was quantified. Depletion of both Cin85 and CD2AP led to a
2.3-fold increase in telophase cells to 13.8% (p<0.01). This was not significantly different from
the percentage of telophase cells observed when SEPT9, Cin85 and CD2AP were individually
depleted (Fig. 9), suggesting that they participate in the same pathway.
Together, these results show that the absence of Cin85 or CD2AP led to an abscission defect
similar to that seen when SEPT9 is depleted, indicating that both proteins function during
cytokinesis. In addition they may participate in the same pathway.
33
Figure 9. Knockdown of SEPT9, CD2AP, Cin85 or CD2AP and Cin85 led to an abscission
defect. A. Quantified percentage of the cell population that are joined by midbodies after
depletion with non-targeting (NTC), SEPT9, Cin85, CD2AP or Cin85+CD2AP siRNA. Data
graphed are the mean ±SEM and represents three repeats. In each repeat, at least 150 cells were
counted, *p<0.05, **p<0.01, ***p<0.005 (t-test). B. Representative Western blot of knockdown
and control lysates showing the indicated protein of interest is knocked down. The relative
expression levels indicated represent the average of three repeats.
A.
B.
34
3.3 Localization of CD2AP is not dependent on Cin85 or SEPT9
Given the ability of septins to act as a scaffold in yeast (Gladfelter et al. 2001; McMurray and
Thorner 2009), the role of SEPT9 in cytokinesis may be to recruit CD2AP to the midbody. To
address this, I examined HeLa cells using immunofluorescence to assess changes in localization
of endogenous CD2AP in the presence and absence of SEPT9. Depletion of SEPT9 did not affect
the localization of CD2AP to the midbody (Fig. 8A, third row). The enrichment index of CD2AP
at the midbody remained the same (non targeting siRNA - 1.87, SEPT9 siRNA - 1.84) when
compared to the non-targeting control siRNA (Fig. 8A, first row and Fig. 8B). Since Cin85 is an
adaptor protein whose function is to support protein-protein interactions and there is evidence
that Cin85 interacts with CD2AP in vitro (Gaidos et al. 2007), it is possible that Cin85 is needed
for the localization of CD2AP to the midbody. When Cin85 was depleted, there was no change
in the CD2AP enrichment at the midbody (Fig. 8A, fourth row and Fig. 8B) compared to a non-
targeting control knockdown (non targeting siRNA - 1.87, Cin85 siRNA - 2.01). Depletion of
these proteins had no effect on the stability of the others, except the depletion of Cin85 did lead
to an increase in the level of endogenous CD2AP (Fig. 8C), but the CD2AP signal at the
midbody was still comparable to the non-targeting control knockdown. Collectively, these data
indicate that neither SEPT9 nor Cin85 serve as scaffolds for the localization of CD2AP at the
midbody.
3.4 The interaction between SEPT9 and Cin85/CD2AP is mediated through the SH3 domain on the adaptor proteins and the proline-rich motif on SEPT9
Although SEPT9 is not required for the midbody localization of CD2AP, it is possible that
SEPT9 interacts with CD2AP after CD2AP is brought to the midbody. To assess whether
Cin85/CD2AP has the potential to interact with SEPT9, I performed in vitro pull-down assays
using HeLa cell lysates. First, the individual SH3 domains from Cin85 and CD2AP were tested
for their interaction with endogenous septins present in HeLa cells. The first two individual SH3
domains (SH3A and SH3B) of both Cin85 and CD2AP were able to pull out the endogenous
SEPT2, SEPT6, SEPT7, SEPT9 and SEPT11 (Fig. 10A). This suggests that Cin85 and CD2AP
are capable of binding to endogenous septins.
35
To determine which SEPT9 isoform interacts with Cin85/CD2AP, I repeated the in vitro pull-
down assay with HeLa cells overexpressing N-terminally Flag-tagged SEPT9_i1, SEPT9_i3 or
SEPT9_i4. The SH3A and SH3B domains of Cin85 and CD2AP were able to strongly pull out
SEPT9_i1 and SEPT9_i3, while SEPT9_i4 was weakly pulled out (Fig. 10B). Since SEPT9_i1
and SEPT9_i3 contain the N-terminal region and SEPT9_i4 does not, this narrows down the
binding region on SEPT9 to the N-terminal region. Surprisingly, SH3B from Cin85 failed to pull
out any SEPT9 isoforms. Since SH3B was able to pull out the endogenous SEPT9 (Fig. 10A),
but failed to pull out the individual SEPT9 isoforms that were overexpressed and tagged, this
suggests that SH3B may interact with SEPT9 indirectly through binding with another septin
family member within the septin complex.
To show that the proline-rich motif on SEPT9 is responsible for its interaction with the adaptors,
the terminal arginine residues of both proline-rich motifs, Arg73 and Arg130, were mutated to
alanine (R73+130A). Mutation of arginine to alanine has been previously shown to abolish the
interaction between SH3 domains and this atypical proline-rich binding motif (Kurakin et al.
2003). The R73+130A mutation was generated in a SEPT9 truncation containing only the N-
terminal region. This construct was also N-terminally GFP tagged (GFP-SEPT9-N-term-
R73+130A). As expected, SH3A of Cin85 and SH3A and SH3B of CD2AP were able to pull out
the non-mutated wild-type SEPT9 N-terminal region (GFP-SEPT9-N-termR), but failed to pull
out the R73+130A mutant of the SEPT9 N-terminal region (Fig. 10C). SH3B of Cin85 had a
weaker interaction with the wild-type SEPT9 N-terminal region compared to the other SH3
domains that were tested (Fig. 10C) and this is similar to the to the results seen in the pull-down
experiments with the different isoforms of SEPT9 where SEPT9 isoforms were pulled out by the
other SH3 domains, but not by the SH3B of Cin85 (Fig. 10B). Together, this clearly indicates
that the interaction between SEPT9 and Cin85/CD2AP requires binding of the SH3 domain of
Cin85/CD2AP to the proline-rich motif of SEPT9.
36
Figure 10. Mapping the binding interface between Cin85/CD2AP and SEPT9. A. Cin85 and
CD2AP interact with endogenous septins through their SH3A and SH3B domain. B. The
interaction between Cin85/CD2AP and SEPT9 is specific to the N-terminal region of SEPT9_i1
and SEPT9_i3, as SEPT9_i4 was weakly pulled out by SH3A of Cin85 and SH3A and SH3B of
CD2AP. C. The interaction between Cin85/CD2AP requires the binding of the proline-rich motif
found in the N-terminal region of SEPT9_i1 and -_i3 to the SH3 domain of Cin85/CD2AP.
Mutating the terminal arginine to alanine of both proline-rich motifs of SEPT9_i1 and SEPT9_i3
abolishes the interaction between the SH3 domains and SEPT9.
A.
B. C.
37
3.5 The first three SH3 domains of Cin85 but not full-length Cin85 co-immunoprecipitate SEPT9
The in vitro pull-down assays indicated that Cin85/CD2AP and SEPT9 can interact. The next
step was to see if this interaction occurs in vivo. I attempted to immunoprecipitate endogenous
SEPT9 and Cin85 from HeLa cells, but even using different sources of antibodies, neither
SEPT9 nor Cin85 were successfully immunoprecipitated. As an alternative approach, N-
terminally Flag-tagged full-length Cin85 (Flag-Cin85-Fl) and N-terminally GFP-tagged
SEPT9_i3 (GFP-SEPT9_i3) were overexpressed and Cin85 was immunoprecipitated using anti-
Flag antibody immobilized on beads. Surprisingly, SEPT9_i3 did not co-immunoprecipitate with
full-length Cin85 but did co-immunoprecipitate with a Cin85 truncation consisting of the three
SH3 domains only (Flag-Cin85-ABC) (Fig. 11). This suggests that when the full-length version
of Cin85 is overexpressed, the N-terminal SH3 domains are hidden, preventing SEPT9 from
binding.
3.6 The first three SH3 domains of CD2AP and full length CD2AP can weakly co-immunoprecipitate SEPT9
To test whether CD2AP interacts with SEPT9 in vivo, I performed co-immunoprecipitations in
HeLa cells with both N-terminally Flag-tagged CD2AP (Flag-CD2AP-Fl) and GFP-SEPT9_i3
overexpressed. Since Cin85 and CD2AP are structurally similar, it was expected that, like Cin85,
only the first three SH3 domains of CD2AP and not full length CD2AP would be able to co-
immunoprecipitate GFP-SEPT9_i3 and this was observed (Fig. 11). The difference in the
amount of GFP-SEPT9_i3 co-immunoprecipitated could be due to fact that there was less Flag-
CD2AP-Fl expressed compared to Flag-CD2AP-SH3ABC. Interestingly, compared to Cin85, the
SH3 domains of CD2AP co-immunoprecipitated less GFP-SEPT9_i3 (Fig. 11), even though the
levels of Flag-Cin85-ABC and Flag-CD2AP-ABC immunoprecipitated were comparable.
38
Figure 11. Cin85 and CD2AP can co-immunoprecipitate full-length SEPT9 through their
SH3 domains. Western blot of the co-immunoprecipitation between Cin85/CD2AP and SEPT9
in vivo. Co-immunoprecipitations were performed in HeLa cells overexpressing GFP-SEPT9_i3
with the following Flag-tagged constructs: Tom70 (negative control), the first three SH3
domains of Cin85 (Cin85-ABC), full-length Cin85 (Cin85-Fl), CD2AP-ABC or CD2AP-Fl.
Proteins that bound to the Flag antibody immobilized on beads were eluted with Flag peptide
then run on SDS PAGE. Anti-flag beads alone were loaded with these samples to identify non-
specific bands as a result of cross-reactivity. The western blot was probed with anti-GFP to
detect GFP-SEPT9. Without stripping, the blot was then re-probed with α-Flag to assess the
immunoprecipitation. The additional bands present in this re-probed blot under the input lanes
may be degradation products of GFP-SEPT9 since this blot was not stripped. Alternatively, these
bands may also be non-specific binders since this blot was exposed longer to detect the presence
of Flag-Cin85/CD2AP-Fl. GFP-SEPT9_i3 co-immunoprecipitated with the SH3 domains of
Cin85 and CD2AP but failed to co-immunoprecipitate with the full-length versions.
39
3.7 Full-length Cin85 can co-immunoprecipitate itself
The interesting results from the co-immunoprecipitation led to further experiments to determine
how the SH3 domains were hidden when full-length Cin85 was overexpressed. The apparent
masking of the SH3 domains of Cin85 can occur in several ways. Masking of the SH3 domains
of Cin85 may occur by binding by another protein (Fig. 12), but since Cin85 oligomerization has
been observed (Gaidos et al. 2007; Zhang et al. 2009b), the SH3 domains may be hidden by the
interaction of Cin85 with itself. Given its domain composition, Cin85 may self-associate through
intermolecular or intramolecular interactions by three different types of contacts as illustrated in
Fig. 12. It is conceivable that Cin85 could fold in such a way that the internal proline-rich motif
interacts with the SH3 domains. Two molecules of Cin85 could also associate through the
binding of the proline-rich motif to the SH3 domains. Alternatively, the C-terminal coiled-coil
domain of Cin85 has been shown to be necessary for oligomerization of Cin85 (Gaidos et al.
2007; Zhang et al. 2009b).
Figure 12. The different ways that the first three SH3 domains of Cin85 can be masked.
The SH3 domains could be hidden in any of the four following manners: A. Binding by another
protein. B. Cin85 may fold up upon itself so that the internal proline-rich motif interacts with the
SH3 domains. C. Two molecules interacting by binding of the SH3 domain to the proline-rich
motif on the other molecule. D. Two molecules interacting by binding of the coiled-coil
domains. Cin85 is depicted as a linear but the structural fold of the protein is unknown.
A.
B.
C.
D.
40
The domain(s) responsible for the self-oligomerization were determined by co-
immunoprecipitating N-terminally GFP tagged full-length Cin85 (GFP-Cin85-Fl) with either
Flag-Cin85-Fl or Flag-Cin85-ABC. GFP-Cin85-Fl was immunoprecipitated with Flag-Cin85-Fl
but not Flag-Cin85-ABC (Fig. 13). This suggests that the C-terminal coiled-coil domain is
required for the self-association of Cin85 and that a SH3-proline-rich intermolecular interaction
did not occur, as Flag-Cin85-ABC did not pull out GFP-Cin85-Fl. The interaction between the
coiled-coil domain and the proline-rich motif remains a possibility and will need to be tested.
These results also rule out a SH3-proline-rich intramolecular interaction as Flag-Cin85-Fl was
able to pull out GFP-Cin85-Fl.
Figure 13. Full-length Cin85 can associate with itself via the C-terminal coiled-coil domain.
To address how the SH3 domains are masked from SEPT9, the ability of Cin85 to self
oligomerize was tested. GFP-Cin85-FL was co-transfected with Flag-Tom70, Flag-Cin85-ABC
or Flag-Cin85-Fl in HeLa cells. Proteins interacting with the Flag fusion proteins were identified
by Western blotting. Full-length Cin85 interacts with itself through the C-terminal coiled-coil
domain as Flag-Cin85ABC lacking the coiled-coil domain was not able to co-immunoprecipitate
full-length Cin85.
41
3.8 Overexpression of the of SEPT9-N-termR T73/130A did not lead to the dominant negative abscission defect
Since my experiments have indicated that Cin85 and CD2AP function during cytokinesis and
have the potential to bind SEPT9, the next step was to look at the functional consequence of
removing this interaction. A former graduate student observed that overexpressing the N-
terminally GFP-tagged truncation of SEPT9 (GFP-SEPT9-N-termR) led to an increase in the
proportion of cells in telophase. This SEPT9 truncation is the N-terminal region present in
SEPT9_i1 and SEPT9_3 but not in SEPT9_i4, which contains the atypical proline-rich motifs
targeted by Cin85 and CD2AP. I compared the ability of the proline-rich mutant of this
truncation, that cannot bind to Cin85/CD2AP (GFP-SEPT9-N-TermR73+130A), to induce an
abscission defect when overexpressed. In addition, I examined a point mutant where threonine at
position 24 is mutated to alanine (GFP-SEPT9-N-termRT24A), this threonine has been shown to
be needed for cytokinesis (Estey et al. 2013).
When GFP alone was expressed, about 6% of the population of cells were joined by a midbody
(Fig. 14). In contrast, overexpression of GFP-SEPT9-N-termR significantly increased the
percentage of midbodies (16.5%, p<0.05), indicating an abscission defect. Neither GFP-SEPT9-
N-termRT24A nor GFP-SEPT9-N-TermR73+130A led to an increase in the proportion of cells
joined by a midbody compared to that of GFP alone (8.6% and 7.2%, respectively). This finding
suggests that Cin85/CD2AP binding to SEPT9 may be required in cytokinesis, as modifying the
amino acids required for this interaction did not lead to the dominant negative effect seen when
wild type SEPT9-N-termR was overexpressed.
42
Figure 14. Overexpression of wild-type SEPT9 N-termR led to an increase in telophase cells
while the SEPT9 mutant unable to associate with Cin85 or CD2AP did not. A.
Representative images of cells transfected with the construct indicated. Cells were co-stained
with anti-MgcRacGAP as a marker of the midbody, anti-acetylated tubulin (AcTub) as a marker
of the intercellular bridge and DAPI as a DNA marker. Arrows point to unresolved midbodies.
Bars, 290 μm. B. Percentage of transfected cells (green) joined by the midbody. Data plotted is
the mean ±SEM and represents four replicates where about 100 transfected cells were counted
for each replicate. C. Representative Western blot of HeLa cell lysates transfected with the
different GFP fusion proteins showing similar expression level for each SEPT9 N-termR variant.
A.
B. C.
43
3.9 SEPT9 R73+130A was not able to rescue the abscission defect caused by the depletion of SEPT9
To test whether the two N-terminal proline-rich motifs of SEPT9 are needed in cytokinesis, the
SEPT9 R73+130A mutant was tested for its ability to rescue the abscission defect observed
when all SEPT9 isoforms are depleted. A stable doxycycline-inducible HeLa cell line expressing
the siRNA resistant SEPT9_i3 was able to rescue the abscission defect when treated with SEPT9
siRNA. Therefore a stable doxycycline-inducible HeLa cell line that can express the full-length
mutant form of SEPT9_i3 (Flag-SEPT9R73+130A), which can not bind Cin85/CD2AP, was
generated. Immunofluorescence was performed to quantify the proportion of cells that were
arrested in telophase. The parent Tet-on HeLa stable cell line (used to generate the SEPT9
mutant stable line) and the stable HeLa cell line expressing Flag-SEPT9_i3 were tested as a
negative and positive control (respectively).
When non-targeting siRNA was transfected into the parent Tet-on stable line, approximately 4%
of the HeLa cell population were joined by midbodies (Fig. 15A). Depletion of SEPT9 increased
this percentage to about 12% (p<0.005), indicating a defect in abscission. With SEPT9 depleted,
the expression of siRNA resistant Flag-SEPT9_i3 decreased the percentage of telophase arrested
cells down to 6%, partially rescuing the abscission defect. More importantly, when siRNA
resistant Flag-SEPT9R73+130A was expressed by the addition of doxycycline in SEPT9
depleted cells, 12.5% of these cells were joined by midbodies (compared to parent Tet-on line
treated with non-targeting siRNA, p>0.05). The exogenous levels of Flag-SEPT9_i3 and Flag-
SEPT9R73+130A were about the same as the endogenous levels of SEPT9 in the parent Tet-on
HeLa cell line (Fig. 15B). Together, this suggests that the SEPT9 mutant that can not bind to
Cin85/CD2AP was unable to rescue the abscission defect caused by the absence of SEPT9.
Without doxycycline, the Flag-SEPT9_i3 stable cell line displayed leaky expression of
exogenous SEPT9_i3. In this stable cell line, an abscission defect was seen when transfected
with a non-targeting siRNA (about 11% of the cells had unresolved midbodies). In contrast, the
Flag-SEPT9R73+130A stable cell line required induction with doxycycline. When this stable
line was transfected with a non-targeting siRNA, approximately 5% of the cells had unresolved
midbodies. Further expression of Flag-SEPT9R73+130A did not lead to an abscission defect as
5.6% of cells had unresolved midbodies. This also showed that treatment with doxycyline did not
44
affect the completion of cytokinesis. The dominant negative abscission defect observed in this
experiment agreed with the results from the SEPT9N-termR overexpression experiment.
This result along with the inability of the SEPT9-N-TermR73+130A to cause an abscission
defect when overexpressed (Fig. 14) suggests that there is a functional interaction between
SEPT9 and CD2AP/Cin85 and that the interaction is, in part, necessary for the completion of
cytokinesis.
Figure 15. Full-length SEPT9 mutant R73+130 is not able to rescue the abscission defect
observed when all SEPT9 isoforms are knocked down. A. Quantification of the percentage of
cells with unresolved midbodies for the indicated stable cell line and under treatments of a non-
targeting (NTC) or SEPT9 siRNA. Data plotted is the mean ±SEM and represents three separate
repeats where about 300 cells were counted per repeat, *p<0.05, **p<0.01, ***p<0.005 (t-test).
Representative western blot showing equal expression of exogenous Flag-SEPT9R73+130A
(with SEPT9 siRNA) compared to exogenous Flag-SEPT9_i3 (with SEPT9 siRNA) and
endogenous SEPT9 (NTC siRNA). The indicated SEPT9 expression levels are the average
values from three experimental repeats.
B.
A.
45
Chapter 4 Discussion
Septins have been implicated in many different processes, one of which is cytokinesis. The many
studies that investigate the involvement of septins in mammalian cytokinesis have not
completely elucidated the function of septins during cell division. In yeast, septins have been
shown to act as a scaffold to temporally and spatially recruit cytokinetic proteins and it is
predicted that septins serve the same purpose during mammalian cytokinesis. One specific study
showed that SEPT9 is only needed during abscission, the last stage of cytokinesis (Estey et al.
2010). Interestingly, overexpression of the N-terminal region of SEPT9 led to a dominant
negative abscission defect. One interpretation of this is that other factors that bind to SEPT9
during cytokinesis were titrated by the overexpressed SEPT9 truncation. Given that adaptor
proteins Cin85 and CD2AP contain SH3 domains that specifically bind to the atypical proline-
rich motifs found in this N-terminal region of SEPT9, it is hypothesized that the adaptor proteins
bind to SEPT9 to promote for successful completion of cytokinesis.
4.1 The role of the adaptor proteins Cin85 and CD2AP in cytokinesis
To test this hypothesis, I examined whether Cin85 and CD2AP played a role in cytokinesis.
Previously, CD2AP has been implicated in cytokinesis (Monzo et al. 2005), but as yet, Cin85
has not been shown to play a role.
4.1.1 The role of Cin85 in cytokinesis
To investigate the role of Cin85 in cytokinesis, I examined its localization in HeLa cells that
were in telophase, and found that endogenous Cin85 was present in both the cytosol and in the
midbody. To account for the variation in the endogenous Cin85 signal at the midbody I
calculated the average midbody enrichment relative to the nucleus of endogenous Cin85 and
found it to be approximately 1.3 (Fig. 7), indicating a small enrichment at the midbody. The
variation of Cin85 signal at the midbody could be attributed to the weak antibody that was used.
A better antibody has yet to be developed and because of this, studies investigating Cin85
46
usually employ overexpressed tagged Cin85. The variability of the signal of endogenous Cin85
also suggests that the enrichment of Cin85 may be dynamic during cytokinesis, and variable
dependent on when I captured a specific time point. Time lapse imaging of tagged Cin85 could
be performed to assess how dynamic the presence of Cin85 is during cytokinesis. Since the
enrichment of Cin85 at the midbody was highly variable, I could not reliably examine whether
SEPT9 or CD2AP is required for its recruitment to the midbody. However, supporting the
observation that Cin85 is transiently localized to the midbody, depletion of Cin85 led to an
abscission defect similar to that seen upon the depletion of SEPT9. This suggests that Cin85 has
a functional role during cytokinesis.
The role of Cin85 in cytokinesis may be linked to the endosomal pathway. The delivery and
fusion of endosomal vesicles are needed for secondary ingression to further compact the
intercellular bridge (Schiel et al. 2011) and are thought to drive abscission. Cin85 has been
linked to endosomes involved in receptor tyrosine kinase degradation (Zhang et al. 2009b;
Schroeder et al. 2010). In addition to its localization to the midbody, Cin85 staining was also
cytosolic. When this was viewed by confocal microscopy, this cytosolic signal resolved as
puncta dispersed throughout the cytosol. These punctate structures may be endosomes, but would
require verification with additional localization experiments using markers of early and late
endosomes such as Rab4 and mannose-6 phosphate receptors (respectively). This may also
explain the dynamic nature of endogenous Cin85 at the midbody; it may be delivered at a
specific step prior to abscission by fusion of recycling endosomes. In due course, it may be
removed from the midbody as the membrane blebs off during intercellular bridge or midbody
maturation as observed with anillin and septins (El Amine et al. 2013; Renshaw et al. 2014).
4.1.2 The role of CD2AP in cytokinesis
In agreement with the findings of Monzo et al., I observed that CD2AP localized to the midbody
in telophase cells and its depletion resulted in an abscission defect. Monzo et al. observed a
seven-fold increase in the proportion of CD2AP depleted cells arrested in telophase, while I
observed a two-fold increase. The difference in the severity of the abscission defect may be due
to the difference in the efficiency of the CD2AP knockdown. I achieved an average of 60%
CD2AP depletion while a nearly 100% CD2AP depletion was achieved by Monzo et al (Monzo
47
et al. 2005). Additionally, I've shown that the signal at the midbody was specific to CD2AP as
depletion of CD2AP led to a disappearance of midbody signal.
4.1.3 At what point do CD2AP and SEPT9 participate in cytokinesis?
Given the nature of SEPT9 as a scaffold during yeast cytokinesis, SEPT9 is expected to function
upstream of CD2AP to promote the recruitment of CD2AP to the midbody during mammalian
cytokinesis. Therefore, CD2AP should mislocalize when SEPT9 is depleted. Nonetheless, in
SEPT9 depleted cells, CD2AP did not mislocalize and there was also a similar cytokinetic defect
seen when CD2AP and SEPT9 were individually depleted, suggesting that the function and
recruitment of CD2AP work through different pathways. While SEPT9 is not needed for the
recruitment of CD2AP at the midbody, it may be needed for the function of CD2AP.
Interestingly, there was a comparable abscission defect seen when SEPT9 and CD2AP were
individually depleted. Given that the about 60% of endogenous CD2AP was depleted compared
to the 80% depletion of SEPT9, the abscission defect may be more severe with a complete
knockdown of CD2AP. Nonetheless, this finding suggests that CD2AP and SEPT9 cannot
functionally compensate for each other and that possibly CD2AP and SEPT9 are required in the
same pathway. This could be examined by knocking down SEPT9 and CD2AP together and
comparing the abscission defect with the single knockdowns. If SEPT9 does not function in the
same pathway as CD2AP, the double knockdown would lead to a more severe abscission defect
compared to the single knockdowns. If SEPT9 functions in the same pathway as CD2AP, either
upstream or downstream of CD2AP, it is expected that the double knockdown would give the
same phenotype as the single knockdown.
Clearly SEPT9 does not recruit CD2AP; however, the association of the proteins, both in vitro
and in vivo, suggests that they are somehow linked. It seems probable, given the interaction of
CD2AP and SEPT9 and the similar phenotype of the individual CD2AP and SEPT9 knockdowns
that both CD2AP and SEPT9 function in the same pathway. There are several possibilities for
how this can occur. SEPT9 may work upstream of CD2AP to activate the adaptor function of
CD2AP. Alternatively, CD2AP could work upstream of SEPT9 where it may function to bring
SEPT9 to the midbody. Furthermore, both CD2AP and SEPT9 may be needed at the same step to
48
scaffold other factors important for cytokinesis. Given that anillin binds to both CD2AP (Monzo
et al. 2005) and septins (Liu et al. 2012), anillin is a likely candidate as a target for scaffolding
by both proteins. Immunoprecipitating CD2AP to see if anillin co-immunoprecipitated in the
presence and absence of SEPT9 would be a way of assessing this possibility.
4.1.4 At what point do Cin85 and CD2AP participate in cytokinesis?
Since Cin85 and CD2AP have been shown to have overlapping functions in EGFR down-
regulation, it is tempting to speculate that these adaptors may have redundant functions in
mammalian cytokinesis. Individually depleting Cin85 and CD2AP led to similar abscission
defects as knocking down both Cin85 and CD2AP, suggesting that CD2AP and Cin85 cannot
functionally compensate for one another. Surprisingly, when Cin85 is depleted, there is about a
50% increase of total CD2AP, but even with the increased CD2AP levels, there was still an
abscission defect observed. This suggests that CD2AP may not functionally compensate for
Cin85 during cytokinesis despite increased levels of CD2AP when Cin85 is depleted, leaving
open the possibility that CD2AP may functionally compensate for other Cin85 functions. It has
been previously observed that full-length Cin85 was also up-regulated in the absence of CD2AP
in podocytes (Tossidou et al. 2012), but this increase was not observed in our studies suggesting
that this behaviour may be cell type specific.
The evidence suggests that Cin85 and CD2AP do not compensate for each other rather they may
work in the same pathway. There are different ways this can occur. Cin85 and CD2AP may be
functionally active at different steps along same pathway. For example if Cin85 works upstream
of CD2AP, it would activate the function of CD2AP, rather than recruit CD2AP to the midbody.
Cin85 and CD2AP may also function at the same step along a pathway and this would occur
under two conditions. First, there may be a threshold for the amount of Cin85/CD2AP needed for
the signal to be relayed. Under this model, there is the assumption that Cin85 and CD2AP do
have a redundant function, but depletion of one does not lead to compensation by the other
because this threshold is not met. As previously mentioned, there was an increase in CD2AP
expression upon Cin85 depletion (Fig 9B), but this did not lead to any rescue in abscission (Fig.
9A) suggesting that higher levels of CD2AP had no functional affect during cytokinesis,
49
therefore this model does not seem likely. Alternatively, the presence of both adaptor proteins
may be required simultaneously to recruit different proteins.
4.2 The SH3 domains of Cin85 and CD2AP can interact with SEPT9
Cin85 has been identified as a potential interactor of SEPT9 through high-throughput screens
(Havrylov et al. 2009; Nakahira et al. 2010), but this was never further investigated. I performed
in vitro pull-down assays which showed that there is a potential interaction between Cin85 and
SEPT9 as well as between CD2AP and SEPT9 (Fig. 10). This in vitro interaction requires the
SH3 domains of Cin85 and CD2AP and the atypical proline-rich motifs of SEPT9. This finding
suggests that Cin85, CD2AP and SEPT9 may work together, as Cin85 and CD2AP can associate
with SEPT9. The next step would be to test for an interaction between Cin85 and CD2AP in vivo
as this interaction has been observed in vitro (Gaidos et al. 2007).
4.2.1 Preferential binding of one SH3 domain over the other in Cin85
Interestingly, the SH3B domain of Cin85 was less efficient at pulling out the SEPT9 variants
when compared to the SH3A domain (Fig. 10B and Fig. 10C). Given that the SH3B domain was
able to pull out endogenous septins, it is possible that Cin85-SH3B indirectly interacts with
SEPT9 by binding to another septin in the complex. After scanning the sequences of the other
septins, an atypical proline-rich motif was identified in SEPT7. The interaction between Cin85
and SEPT7 will require further investigation in support of this idea. Alternatively, Cin85-SH3B
may indirectly bind to SEPT9 through the presence of another protein. Since only Cin85-SH3B
and SEPT9 were overexpressed, the stoichiometry of the third protein would be too low to
mediate the Cin85-SH3B-SEPT9 association in the pull-down. To address if a third protein is
required for the binding of Cin85-SH3 to SEPT9, purified Cin85-SH3A and SEPT9 can be tested
for direct binding in vitro. If purified Cin85-SH3B fails to interact with SEPT9, common
interactors of Cin85 and SEPT9 such as anillin should be introduced in the binding assay to see
if binding occurs.
Preferential binding of substrate by one/two out of the three SH3 domain has been previously
observed for CD2AP, where CD2 receptors showed a stronger interaction with CD2AP-SH3A
than with CD2AP-SH3B (Tibaldi and Reinherz 2003).The idea of each SH3 domain having a
50
specific binding partner is logical since Cin85 and CD2AP are adaptor proteins; they bring
different proteins together to link different signalling pathways. It seems that in addition to the
presence of the proline-rich motif and the coiled-coil domain, the different individual SH3
domains may also permit simultaneous binding of different proteins. Ultimately, this allows the
adaptors to function in linking different processes together.
In SEPT9, there are two proline-rich motifs present and between Cin85 and CD2AP, there
appears to be three SH3 domains involved (Cin85-SH3A, CD2AP-SH3A and CD2AP-SH3B),
leading to the question of how this interaction occurs. Does one SH3 domain from one adaptor
protein target one specific proline-rich motif? Attempts have been made to address this through
pull-down assays using SEPT9 N-terminal region mutants where only one proline-rich motif site
was mutated. It was observed that SH3A of Cin85 pulled out SEPT9R73A, while little or no
interaction with SEPT9R130A was seen, suggesting that the SH3A of Cin85 preferentially binds
to the second proline-rich motif (preliminary data not included). Unfortunately, the binding
preference of the other SH3 domains was not as clear since the specific proline-rich motifs that
the SH3 domains were able to pull out were highly variable. Further work is required to
determine how interactions between the SH3 domains and the proline-rich motifs occur at the
molecular level.
4.2.2 Preferential binding of Cin85 over CD2AP to SEPT9
Given that Cin85 and CD2AP have the potential to interact with SEPT9 in vitro, the next step
was to show that this occurred in vivo. Surprisingly, the full-length versions of Cin85 failed to
bind SEPT9, whereas the truncation consisting of the three SH3 domains was able to bind. This
indicated that the SH3 domains were masked when full-length Cin85 was overexpressed.
Another unexpected finding was that the amount of SEPT9 co-immunoprecipitated with
CD2AP-SH3ABC was less than the amount co-immunoprecipitated with Cin85-SH3ABC
although the level of expression of CD2AP-SH3ABC was comparable to that of Cin85-SH3ABC
(Fig. 11). A contribution to the difference between the two constructs in SEPT9 binding could be
that their locations in the cells may be different. If the sub-cellular localization of CD2AP-
SH3ABC was in an area of the cell that is not readily accessible to SEPT9, it may not bind to
SEPT9.
51
4.3 Cin85 can associate with itself
The co-immunoprecipitation performed between Cin85 and SEPT9 suggests that the SH3
domains are masked when full-length Cin85 is overexpressed. The SH3 domains could have
been masked by the interaction of Cin85 with itself. By performing co-immunoprecipitation of
Cin85 with itself, I've shown that Cin85 can homo-oligomerize and that this was dependent on
the C-terminal coiled-coil domain. Other studies have also reported this, but only with
truncations of Cin85 (Kirsch et al. 1999; Borinstein et al. 2000; Gaidos et al. 2007; Zhang et al.
2009b), therefore the rest of protein was not taken into consideration and/or the coiled coil
domain may not be folded correctly. Here I have shown that full-length Cin85 can indeed
interact with full-length Cin85 in vivo. The Cin85 homo-oligomerization did not occur through
inter- and intramolecular interactions via the SH3 and proline-rich motifs. I have not yet ruled
out that binding by another protein may mask the SH3 domains, but testing this would be very
difficult since there is a long list of proteins that interact with these adaptor proteins.
Self-oligomerization of CD2AP and Cin85 has been reported (Gaidos et al. 2007; Zhang et al.
2009b) and proposed as a means of clustering CD2 receptors (Dustin et al. 1998) or Cbl
molecules (Kowanetz et al. 2003a) for signal transduction. It has also been shown that self-
oligomerization may be needed for cross-linking actin since Cin85 and CD2AP can interact with
actin. In the Cin85-SEPT9 interaction, the self-oligomerization of Cin85 may serve as a means of
inactivating Cin85, which has never been shown before. Additionally, these data indicate that
Cin85 likely has two forms: an active and an inactive form. The active form would have the
protein binding motifs including the SH3 domains available for binding, while the motifs would
be hidden in the inactive form. This opens up several new areas of investigation such as what
mechanism or protein regulates the active/inactive transition of Cin85. One possibility is that
Cin85 and CD2AP activate each other through heterodimerization. Specifically, Cin85 may be
held in its inactive state when it is homo-oligomerized but once it forms a heterodimer with
CD2AP, this may activate Cin85. It would be interesting to see if CD2AP exhibits the same
requirements for activation given the structural similarities between Cin85 and CD2AP.
52
4.4 Interaction between Cin85 and CD2AP with SEPT9 is needed for cytokinesis
Introduction of mutations into the atypical proline-rich motifs in SEPT9 that abolished its
interaction with Cin85 and CD2AP did not rescue the abscission defect observed when
endogenous SEPT9 is depleted. Additionally, no abscission defect was seen when exogenous
Flag-SEPT9R73+130A, which does not bind Cin85 and CD2AP, is expressed along with
endogenous SEPT9, indicating that there wasn't a dominant negative effect. This concurs with
the observation that overexpression of the N-terminal region of SEPT9R73+130A did not induce
an abscission defect (Fig. 14). Therefore the abscission defect seen from the expression of the
exogenous positive control Flag-SEPT9_i3 in addition to endogenous SEPT9 is probably due to
the presence of the proline-rich motifs of Flag-SEPT9_i3. These observations suggest that the
proline-rich motif of SEPT9 is important for completion of cytokinesis, and that therefore its
interaction with Cin85 and CD2AP is also required for cytokinesis.
An interesting observation in the knockdown and rescue experiments was that overexpression of
SEPT9_i3, which was used as a positive control, also led to a cytokinetic defect. This parallels
the abscission defect seen after overexpression of the N-terminal region of SEPT9 (Fig. 14) and
suggests that the overexpression of full-length SEPT9_i3 and the N-terminal region may
sequester factors that bound to the N-terminal region. The abscission defect induced by
overexpression of the full-length SEPT9_i3 in this study was more severe than that previously
observed (Estey et al. 2010) and may be due to a variation in levels of SEPT9. The Western blot
showed that the total SEPT9 signal in the Flag-SEPT9_i3 stable cell line treated with a non-
targeting siRNA is about 50% more than the total endogenous SEPT9 signal in the parent line
(Fig 15B). Although not quantified, the total SEPT9 expressed from the induced Flag-SEPT9_i3
stable cell line used by Estey et al. was not 50% more than the total endogenous SEPT9
expressed in the parent line and was in fact less than 50%. Surprisingly, the same Flag-SEPT9_i3
stable cell line was used in the study by Estey et al. and this study. The difference in the
expression level of Flag-SEPT9_i3 may be due to the difference in the age of the Flag-SEPT9_i3
stable line when it was used in this study compared to when it was used in the study from Estey
et al. Different tissue culture practices may also have contributed to the different levels of
exogenous Flag-SEPT9_i3 being expressed.
53
SEPT9 overexpression and rescue experiments suggest that an interaction between
Cin85/CD2AP and SEPT9 is required for the completion of cytokinesis. This raises the
possibility that Cin85, CD2AP and SEPT9 may function at the same step and that there may be a
large protein complex composed of all three proteins that is required for cytokinesis. This model
is conceivable since the formation of many protein complexes is required throughout cytokinesis.
For example, the assembly of the central spindle involves recruitment of different protein
complexes to the midzone microtubules (Green et al. 2012). Moreover, anchoring of the
actomyosin ring involves a protein complex including anillin (Straight et al. 2005; Piekny and
Glotzer 2008), where anillin has been shown to interact with the components of the actomyosin
ring. Of course, the midbody itself is a large protein complex made up of components of the
actomyosin ring as well as the abscission machinery. Given the findings presented here, and the
fact that Cin85 and CD2AP are characterized as adaptor proteins and are themselves involved in
protein complexes in other cellular functions, it is most likely that they behave the same way in
the case of cytokinesis.
4.5 The SEPT9-Cin85-CD2AP relationship during cytokinesis
Together, the results that I presented suggest that SEPT9, Cin85 and CD2AP act along the same
pathway and, specifically, that the interaction between SEPT9 and Cin85/CD2AP is required for
the completion of cytokinesis. There are different models by which SEPT9, Cin85 and CD2AP
may behave during cytokinesis. It is possible that the interaction of SEPT9 with Cin85 and
SEPT9 with CD2AP may occur at different steps during the same pathway. It is also possible
that SEPT9, Cin85 and CD2AP may all function at the same step and form a protein complex.
Ultimately, Cin85 and CD2AP may recruit different or the same cytokinetic factors needed for
downstream signalling. In either model, the SEPT9-Cin85-CD2AP protein complex is ultimately
assembled and required for the completion of cytokinesis.
54
Chapter 5 Conclusions and Future Directions
In this study, I have presented evidence suggesting that Cin85 and CD2AP work with SEPT9 to
complete cytokinesis. I have shown that Cin85 and CD2AP are found at the midbody, an
important site for cytokinesis. Additionally, single depletion of either Cin85 or CD2AP led to a
failure in abscission similar to that seen when SEPT9 is depleted, while depletion of both Cin85
and CD2AP led to an abscission defect of similar severity compared to the single knockdowns.
Furthermore, I took a biochemical approach and showed that Cin85 and CD2AP bind to SEPT9
in vitro and that this was due to binding of the SH3 domains of Cin85 and CD2AP to the atypical
proline-rich motifs found at the N-terminal end of SEPT9. Surprisingly, full-length Cin85 and
CD2AP failed to interact with SEPT9 in vivo, but truncations of both adaptor proteins consisting
of just the first three SH3 domains were able to interact with SEPT9. This suggested that the SH3
domains were hidden when the full-length protein was expressed. Lastly, the SEPT9 mutant that
does not bind to Cin85 or CD2AP failed to rescue the abscission defect seen when all SEPT9
isoforms are depleted, suggesting that the interaction between Cin85/CD2AP and SEPT9 is
needed for completion of cytokinesis.
The interaction between Cin85, CD2AP and SEPT9 is important to cytokinesis and this
interaction can occur by several potential models: SEPT9 may bind to Cin85 and CD2AP
sequentially and singly (Fig. 16A). It is also possible that the adaptors may bind individually to
SEPT9 at the same step or in different steps, but that Cin85 and CD2AP do not interact with each
other. (Fig. 16B). However, given that Cin85 and CD2AP have been shown to bind to each other
in vitro (Gaidos et al. 2007), it is possible that SEPT9, Cin85 and CD2AP bind to each other to
form a large protein complex (Fig. 16C). In this scenario, Cin85 and CD2AP may bind to SEPT9
at the same step or at different steps in the pathway. Alternatively, CD2AP may bind to Cin85 to
change the folding of Cin85 from the inactive state to the active state, after which SEPT9 binds
to the Cin85-CD2AP heterodimer (Fig. 16D). After the binding of Cin85/CD2AP to SEPT9,
ProteinX/Y may be recruited. In all but the first model, a protein complex consisting of Cin85,
CD2AP and SEPT9 is ultimately formed; therefore, the immediate next step is to test whether
this protein complex exists. By tagging two of the three proteins with different affinity tags, the
complex can be purified through tandem affinity purification against the two affinity tags and the
55
presence of the third un-tagged protein can be detected through western blot. It would also be
worth investigating what other proteins are present in this complex. Other potential components
of the complex can be co-immunoprecipitated by Cin85, CD2AP or SEPT9 and identified by
mass spectrometry. Given that anillin binds to all three proteins, it is very likely that it is also a
component of this complex.
Although I have shown that Cin85 and CD2AP can bind to SEPT9 both in vitro and in vivo,
exactly how this works is unclear since SEPT9 has two atypical proline-rich motifs and there are
three potential SH3 domains (Cin85-SH3A, CD2AP-SH3A and CD2AP-SH3B) that can bind to
these motifs. It remains to be determined whether each proline-rich motif does indeed have a
preference to binding one of the SH3 domains. Preliminary data showed that Cin85-SH3A can
bind to the first proline-rich motif mutant, R73A but not the second proline-rich motif mutant,
R130A in vitro (not presented) suggesting that Cin85-SH3A may preferentially bind to the
second proline-rich motif to mediate the Cin85-SEPT9 interaction. Determining which proline-
rich motif is targeted by the SH3 domains of CD2AP was not as straight forward since there
were inconsistencies observed between repeated experiments. This suggests that the binding of
the SH3 domains of CD2AP is not as straight forward as the simple one SH3 domain to one
proline-rich motif binding between Cin85-SH3A and the second proline-rich motif of SEPT9.
Therefore to gain a better understanding of the binding between the SH3 domains of CD2AP and
the proline-rich motifs of SEPT9, the structure of this complex can be determined through X-ray
crystallography. At the molecular level, we can determine whether the individual SH3 domains
of CD2AP bind to separate atypical proline-rich motifs on SEPT9. The solved structure of the
Cin85-SEPT9 complex can then be compared to the binding between Cin85 and Cbl (Jozic et al.
2005; Moncalian et al. 2006) to study the binding characteristics of these SH3 domains which
target atypical proline-rich motifs. Although the structure of Cin85 bound to Cbl has been solved
by X-ray crystallography (Jozic et al. 2005), the stoichiometry with which they interact remains
debated (Ababou et al. 2008), therefore the solved structure of the Cin85-SEPT9 complex may
also shed some light to this debate.
56
B.
A.
C.
D.
Figure 16. Proposed models of the role of Cin85/CD2AP in septin mediated cytokinesis. A.
SEPT9 may interact with activated Cin85 and CD2AP singly and sequentially. B. Cin85 and
CD2AP may interact with SEPT9 sequentially or simultaneously, but Cin85 and CD2AP do not
interact with each other. C. Cin85, CD2AP and SEPT9 may interact with each other sequentially
or at the same time. D. Cin85 may be activated through dimerization with CD2AP and then bind
to SEPT9. Depicted for sequential binding is CD2AP interacting with SEPT9 first, but Cin85
may interact with SEPT9 first. After SEPT9 binds to Cin85/CD2AP, Protein X/Y, which may be
involved in regulating actin dynamics, are recruited and this is needed for the completion of
abscission. Protein X and Y may be the same protein.
57
Given that previously characterized functions of CD2AP and Cin85 entail the linking of two
separate processes, it is likely that the same occurs here during cytokinesis. Specifically, the
downstream effect of the binding of Cin85/CD2AP to SEPT9 may be linked to the actin
cytoskeleton since Cin85 and CD2AP has been linked to actin dynamics in cell migration and in
the maintenance of the slit diaphragm (respectively) (Schmidt et al. 2003b; Welsch et al. 2005).
Therefore, it is likely that the downstream effect of these adaptors is to bind to actin itself or
recruit actin modifiers for some sort of structural rearrangement of the midbody. This can be
tested by monitoring actin structures in the Flag-SEPT9R73+130A stable cells with SEPT9
depleted as they progress through mitosis and cytokinesis to see if there are any aberrant actin
organizations compared to the Flag-SEPT9_i3 stable line.
Another area worth investigating is how this complex is assembled. It could be that the presence
of one member of this complex recruits the other components. I have shown that the recruitment
of CD2AP to the midbody is independent of Cin85 and SEPT9, but it is possible that Cin85 and
SEPT9 are required simultaneously for CD2AP midbody recruitment. This can be tested by
depleting both Cin85 and SEPT9 to see if this alters the localization of CD2AP. Also CD2AP
may be recruited by other members of the septin complex. Since SEPT7 appears to also contain
the atypical proline-rich motif, SEPT7 can be depleted to test for any mislocalization of CD2AP.
Alternatively, CD2AP may be needed for the recruitment of Cin85 and SEPT9 to the midbody.
There are different permutations of recruitments and all of these can be addressed by performing
immunofluorescence on cells depleted of the protein(s) in question and testing to see if the other
component mislocalizes from the midbody.
When full-length Cin85 is overexpressed, the SH3 domains appear to be hidden since SEPT9
bound to the SH3ABC containing truncation and not full-length Cin85. Also, the Cin85-Cin85
co-immunoprecipitation experiment showed that Cin85 can homo-oligomerize through
interactions of the coiled-coil domain. Therefore the SH3 domains could be hidden due to homo-
oligomerization of Cin85. Although the exact amino acid residues required for this
oligomerization have not yet been identified, amino acids 607 to 635 of CD2AP have been
predicted to be helical (Kirsch et al. 1999). The same analysis can be performed on Cin85 to
predict the region that is responsible for the coiled-coil interaction. Mutagenesis of residues
within the helical region can be performed and then tested to generate a mutant form of Cin85
58
that fails to self-oligomerize. Ultimately, this mutant can be tested for its ability to bind SEPT9
in vivo where the results would provide insight as to whether Cin85 oligomerization is
responsible for failure of the full-length Cin85 to bind SEPT9. It would be interesting to see if
CD2AP also can self oligomerize given that it is structural similar to Cin85.
If the SEPT9 interaction with the adaptors is blocked by the self-oligomerization of Cin85 and
CD2AP, it would suggest that Cin85 and CD2AP both have an active and inactive state. In the
inactive state, the SH3 domains would be hidden, while in the active state the SH3 domains
would be accessible. Therefore, it would be interesting to see how the two states are regulated. If
the inactive state is mediated through self oligomerization by the binding of the coiled-coil
domains, transition between the active and inactive states could be regulated by two means:
through binding by another protein that contains a motif that has a higher affinity for the coiled-
coil domain or any of the protein binding domains of Cin85 or by post translational modification
of Cin85. Endogenous Cin85 and CD2AP have previously been shown to be phosphorylated
(Monzo et al. 2005; Schroeder et al. 2012), where phosphorylation of CD2AP was mitosis
specific (Monzo et al. 2005). However, the significance of this phosphorylation event remains to
be determined. Furthermore, if the SEPT9-Cin85-CD2AP complex does exist, it would be
interesting to see if the mechanism regulating the self-oligomerization of the adaptors also
regulates the assembly of the SEPT9-Cin85-CD2AP complex.
Given that septins have several other functions beyond cytokinesis, it would be interesting to test
whether Cin85 and CD2AP are also involved. For example, since septins provide cellular
structural rigidity, it would be interesting to see if Cin85 and CD2AP are also required for this
function, as Cin85 and CD2AP also interact with actin and proteins responsible for actin
dynamics. Specifically, since both septins and actin were required for cell recovery after swelling
(Gilden et al. 2012), it was suggested that septins work with actin to remodel the cellular
structure. It would be interesting to see if this is mediated through Cin85 or CD2AP. In addition,
our lab is currently studying the exact role of septins in ciliogenesis, so it would be interesting to
see whether these adaptors are also required for this process.
59
References
Ababou, A., M. Pfuhl and J. E. Ladbury (2008). "The binding stoichiometry of CIN85 SH3
domain A and cbl-b." Nat Struct Mol Biol 15(9): 890-891; author reply 891-892.
Amano, M., M. Ito, K. Kimura, Y. Fukata, K. Chihara, T. Nakano, Y. Matsuura and K. Kaibuchi
(1996). "Phosphorylation and activation of myosin by Rho-associated kinase (Rho-
kinase)." J Biol Chem 271(34): 20246-20249.
Beites, C. L., H. Xie, R. Bowser and W. S. Trimble (1999). "The septin CDCrel-1 binds syntaxin
and inhibits exocytosis." Nat Neurosci 2(5): 434-439.
Bertin, A., M. A. McMurray, P. Grob, S. S. Park, G. Garcia, I. Patanwala, H. L. Ng, T. Alber, J.
Thorner and E. Nogales (2008). "Saccharomyces cerevisiae septins: Supramolecular
organization of heterooligomers and the mechanism of filament assembly." Proceedings
of the National Academy of Sciences of the United States of America 105(24): 8274-
8279.
Borinstein, S. C., M. A. Hyatt, V. W. Sykes, R. E. Straub, S. Lipkowitz, J. Boulter and O. Bogler
(2000). "SETA is a multifunctional adapter protein with three SH3 domains that binds
Grb2, Cbl, and the novel SB1 proteins." Cell Signal 12(11-12): 769-779.
Byers, B. and L. Goetsch (1976). "A highly ordered ring of membrane-associated filaments in
budding yeast." J Cell Biol 69(3): 717-721.
Carlton, J. G. and J. Martin-Serrano (2007). "Parallels between cytokinesis and retroviral
budding: a role for the ESCRT machinery." Science 316(5833): 1908-1912.
Casamayor, A. and M. Snyder (2003). "Molecular dissection of a yeast septin: distinct domains
are required for septin interaction, localization, and function." Mol Cell Biol 23(8): 2762-
2777.
Chant, J. and I. Herskowitz (1991). "Genetic control of bud site selection in yeast by a set of
gene products that constitute a morphogenetic pathway." Cell 65(7): 1203-1212.
Chant, J. and J. R. Pringle (1995). "Patterns of bud-site selection in the yeast Saccharomyces
cerevisiae." J Cell Biol 129(3): 751-765.
Chen, B., S. C. Borinstein, J. Gillis, V. W. Sykes and O. Bogler (2000). "The glioma-associated
protein SETA interacts with AIP1/Alix and ALG-2 and modulates apoptosis in
astrocytes." J Biol Chem 275(25): 19275-19281.
Chesneau, L., D. Dambournet, M. Machicoane, I. Kouranti, M. Fukuda, B. Goud and A. Echard
(2012). "An ARF6/Rab35 GTPase cascade for endocytic recycling and successful
cytokinesis." Curr Biol 22(2): 147-153.
60
Clay, L., F. Caudron, A. Denoth-Lippuner, B. Boettcher, S. Buvelot Frei, E. L. Snapp and Y.
Barral (2014). "A sphingolipid-dependent diffusion barrier confines ER stress to the yeast
mother cell." Elife 3: e01883.
Cormont, M., I. Meton, M. Mari, P. Monzo, F. Keslair, C. Gaskin, T. E. McGraw and Y. Le
Marchand-Brustel (2003). "CD2AP/CMS regulates endosome morphology and traffic to
the degradative pathway through its interaction with Rab4 and c-Cbl." Traffic 4(2): 97-
112.
D'Avino, P. P., T. Takeda, L. Capalbo, W. Zhang, K. S. Lilley, E. D. Laue and D. M. Glover
(2008). "Interaction between Anillin and RacGAP50C connects the actomyosin
contractile ring with spindle microtubules at the cell division site." J Cell Sci 121(Pt 8):
1151-1158.
DeMarini, D. J., A. E. Adams, H. Fares, C. De Virgilio, G. Valle, J. S. Chuang and J. R. Pringle
(1997). "A septin-based hierarchy of proteins required for localized deposition of chitin
in the Saccharomyces cerevisiae cell wall." J Cell Biol 139(1): 75-93.
Drees, B. L., B. Sundin, E. Brazeau, J. P. Caviston, G. C. Chen, W. Guo, K. G. Kozminski, M.
W. Lau, J. J. Moskow, A. Tong, et al. (2001). "A protein interaction map for cell polarity
development." J Cell Biol 154(3): 549-571.
Dustin, M. L., M. W. Olszowy, A. D. Holdorf, J. Li, S. Bromley, N. Desai, P. Widder, F.
Rosenberger, P. A. van der Merwe, P. M. Allen, et al. (1998). "A novel adaptor protein
orchestrates receptor patterning and cytoskeletal polarity in T-cell contacts." Cell 94(5):
667-677.
Eikenes, A. H., A. Brech, H. Stenmark and K. Haglund (2013). "Spatiotemporal control of Cindr
at ring canals during incomplete cytokinesis in the Drosophila male germline." Dev Biol
377(1): 9-20.
El Amine, N., A. Kechad, S. Jananji and G. R. Hickson (2013). "Opposing actions of septins and
Sticky on Anillin promote the transition from contractile to midbody ring." J Cell Biol
203(3): 487-504.
Elia, N., R. Sougrat, T. A. Spurlin, J. H. Hurley and J. Lippincott-Schwartz (2011). "Dynamics
of endosomal sorting complex required for transport (ESCRT) machinery during
cytokinesis and its role in abscission." Proc Natl Acad Sci U S A 108(12): 4846-4851.
Emoto, K., H. Inadome, Y. Kanaho, S. Narumiya and M. Umeda (2005). "Local change in
phospholipid composition at the cleavage furrow is essential for completion of
cytokinesis." J Biol Chem 280(45): 37901-37907.
Estey, M. P., C. Di Ciano-Oliveira, C. D. Froese, M. T. Bejide and W. S. Trimble (2010).
"Distinct roles of septins in cytokinesis: SEPT9 mediates midbody abscission." J Cell
Biol 191(4): 741-749.
Estey, M. P., C. Di Ciano-Oliveira, C. D. Froese, K. Y. Fung, J. D. Steels, D. W. Litchfield and
W. S. Trimble (2013). "Mitotic regulation of SEPT9 protein by cyclin-dependent kinase 1
61
(Cdk1) and Pin1 protein is important for the completion of cytokinesis." J Biol Chem
288(42): 30075-30086.
Estey, M. P., M. S. Kim and W. S. Trimble (2011). "Septins." Curr Biol 21(10): R384-387.
Ettenberg, S. A., A. Magnifico, M. Cuello, M. M. Nau, Y. R. Rubinstein, Y. Yarden, A. M.
Weissman and S. Lipkowitz (2001). "Cbl-b-dependent coordinated degradation of the
epidermal growth factor receptor signaling complex." J Biol Chem 276(29): 27677-
27684.
Field, C. M., O. al-Awar, J. Rosenblatt, M. L. Wong, B. Alberts and T. J. Mitchison (1996). "A
purified Drosophila septin complex forms filaments and exhibits GTPase activity." J Cell
Biol 133(3): 605-616.
Field, C. M. and B. M. Alberts (1995). "Anillin, a contractile ring protein that cycles from the
nucleus to the cell cortex." J Cell Biol 131(1): 165-178.
Field, C. M., M. Coughlin, S. Doberstein, T. Marty and W. Sullivan (2005). "Characterization of
anillin mutants reveals essential roles in septin localization and plasma membrane
integrity." Development 132(12): 2849-2860.
Frazier, J. A., M. L. Wong, M. S. Longtine, J. R. Pringle, M. Mann, T. J. Mitchison and C. Field
(1998). "Polymerization of purified yeast septins: evidence that organized filament arrays
may not be required for septin function." J Cell Biol 143(3): 737-749.
Fujita, A., C. Oka, Y. Arikawa, T. Katagai, A. Tonouchi, S. Kuhara and Y. Misumi (1994). "A
yeast gene necessary for bud-site selection encodes a protein similar to insulin-degrading
enzymes." Nature 372(6506): 567-570.
Gaidos, G., S. Soni, D. J. Oswald, P. A. Toselli and K. H. Kirsch (2007). "Structure and function
analysis of the CMS/CIN85 protein family identifies actin-bundling properties and
heterotypic-complex formation." J Cell Sci 120(Pt 14): 2366-2377.
Gilden, J. K., S. Peck, Y. C. Chen and M. F. Krummel (2012). "The septin cytoskeleton
facilitates membrane retraction during motility and blebbing." J Cell Biol 196(1): 103-
114.
Gladfelter, A. S., J. R. Pringle and D. J. Lew (2001). "The septin cortex at the yeast mother-bud
neck." Curr Opin Microbiol 4(6): 681-689.
Goldbach, P., R. Wong, N. Beise, R. Sarpal, W. S. Trimble and J. A. Brill (2010). "Stabilization
of the actomyosin ring enables spermatocyte cytokinesis in Drosophila." Mol Biol Cell
21(9): 1482-1493.
Green, R. A., E. Paluch and K. Oegema (2012). "Cytokinesis in animal cells." Annu Rev Cell
Dev Biol 28: 29-58.
62
Gromley, A., C. Yeaman, J. Rosa, S. Redick, C. T. Chen, S. Mirabelle, M. Guha, J. Sillibourne
and S. J. Doxsey (2005). "Centriolin anchoring of exocyst and SNARE complexes at the
midbody is required for secretory-vesicle-mediated abscission." Cell 123(1): 75-87.
Guizetti, J., L. Schermelleh, J. Mantler, S. Maar, I. Poser, H. Leonhardt, T. Muller-Reichert and
D. W. Gerlich (2011). "Cortical constriction during abscission involves helices of
ESCRT-III-dependent filaments." Science 331(6024): 1616-1620.
Haarer, B. K. and J. R. Pringle (1987). "Immunofluorescence localization of the Saccaromyces-
cerevisiae CDC12 gene-product to the vicinity of the 10-nm filaments in the mother-bud
neck." Molecular and Cellular Biology 7(10): 3678-3687.
Haglund, K., I. P. Nezis, D. Lemus, C. Grabbe, J. Wesche, K. Liestol, I. Dikic, R. Palmer and H.
Stenmark (2010). "Cindr interacts with anillin to control cytokinesis in Drosophila
melanogaster." Curr Biol 20(10): 944-950.
Haglund, K., M. H. Schmidt, E. S. Wong, G. R. Guy and I. Dikic (2005). "Sprouty2 acts at the
Cbl/CIN85 interface to inhibit epidermal growth factor receptor downregulation." EMBO
Rep 6(7): 635-641.
Hall, P. A., K. Jung, K. J. Hillan and S. E. Russell (2005). "Expression profiling the human
septin gene family." J Pathol 206(3): 269-278.
Halme, A., M. Michelitch, E. L. Mitchell and J. Chant (1996). "Bud10p directs axial cell
polarization in budding yeast and resembles a transmembrane receptor." Curr Biol 6(5):
570-579.
Hartwell, L. H. (1971). "Genetic control of the cell division cycle in yeast. IV. Genes controlling
bud emergence and cytokinesis." Exp Cell Res 69(2): 265-276.
Havrylov, S., F. Ichioka, K. Powell, E. B. Borthwick, J. Baranska, M. Maki and V. L. Buchman
(2008). "Adaptor protein Ruk/CIN85 is associated with a subset of COPI-coated
membranes of the Golgi complex." Traffic 9(5): 798-812.
Havrylov, S., Y. Rzhepetskyy, A. Malinowska, L. Drobot and M. J. Redowicz (2009). "Proteins
recruited by SH3 domains of Ruk/CIN85 adaptor identified by LC-MS/MS." Proteome
Sci 7: 21.
Henne, W. M., N. J. Buchkovich and S. D. Emr (2011). "The ESCRT pathway." Dev Cell 21(1):
77-91.
Hsu, S. C., C. D. Hazuka, R. Roth, D. L. Foletti, J. Heuser and R. H. Scheller (1998). "Subunit
composition, protein interactions, and structures of the mammalian brain sec6/8 complex
and septin filaments." Neuron 20(6): 1111-1122.
Huang, F., L. K. Goh and A. Sorkin (2007). "EGF receptor ubiquitination is not necessary for its
internalization." Proc Natl Acad Sci U S A 104(43): 16904-16909.
63
Huang, Y. W., M. Yan, R. F. Collins, J. E. Diciccio, S. Grinstein and W. S. Trimble (2008).
"Mammalian septins are required for phagosome formation." Mol Biol Cell 19(4): 1717-
1726.
Huber, T. B., C. Kwoh, H. Wu, K. Asanuma, M. Godel, B. Hartleben, K. J. Blumer, J. H. Miner,
P. Mundel and A. S. Shaw (2006). "Bigenic mouse models of focal segmental
glomerulosclerosis involving pairwise interaction of CD2AP, Fyn, and synaptopodin." J
Clin Invest 116(5): 1337-1345.
John, C. M., R. K. Hite, C. S. Weirich, D. J. Fitzgerald, H. Jawhari, M. Faty, D. Schlapfer, R.
Kroschewski, F. K. Winkler, T. Walz, et al. (2007). "The Caenorhabditis elegans septin
complex is nonpolar." EMBO J 26(14): 3296-3307.
Johnson, R. I., S. Bao and R. L. Cagan (2012). "Interactions between Drosophila IgCAM
adhesion receptors and cindr, the Cd2ap/Cin85 ortholog." Dev Dyn 241(12): 1933-1943.
Johnson, R. I., A. Sedgwick, C. D'Souza-Schorey and R. L. Cagan (2011). "Role for a Cindr-
Arf6 axis in patterning emerging epithelia." Mol Biol Cell 22(23): 4513-4526.
Johnson, R. I., M. J. Seppa and R. L. Cagan (2008). "The Drosophila CD2AP/CIN85 orthologue
Cindr regulates junctions and cytoskeleton dynamics during tissue patterning." J Cell
Biol 180(6): 1191-1204.
Joo, E., M. C. Surka and W. S. Trimble (2007). "Mammalian SEPT2 is required for scaffolding
nonmuscle myosin II and its kinases." Dev Cell 13(5): 677-690.
Jozic, D., N. Cardenes, Y. L. Deribe, G. Moncalian, D. Hoeller, Y. Groemping, I. Dikic, K.
Rittinger and J. Bravo (2005). "Cbl promotes clustering of endocytic adaptor proteins."
Nat Struct Mol Biol 12(11): 972-979.
Kechad, A., S. Jananji, Y. Ruella and G. R. Hickson (2012). "Anillin acts as a bifunctional linker
coordinating midbody ring biogenesis during cytokinesis." Curr Biol 22(3): 197-203.
Kim, H. B., B. K. Haarer and J. R. Pringle (1991). "Cellular morphogenesis in the
Saccharomyces cerevisiae cell cycle: localization of the CDC3 gene product and the
timing of events at the budding site." J Cell Biol 112(4): 535-544.
Kim, M. S., C. D. Froese, M. P. Estey and W. S. Trimble (2011). "SEPT9 occupies the terminal
positions in septin octamers and mediates polymerization-dependent functions in
abscission." Journal of Cell Biology 195(5): 815-826.
Kimura, K., M. Ito, M. Amano, K. Chihara, Y. Fukata, M. Nakafuku, B. Yamamori, J. Feng, T.
Nakano, K. Okawa, et al. (1996). "Regulation of myosin phosphatase by Rho and Rho-
associated kinase (Rho-kinase)." Science 273(5272): 245-248.
Kirsch, K. H., M. M. Georgescu, S. Ishimaru and H. Hanafusa (1999). "CMS: an adapter
molecule involved in cytoskeletal rearrangements." Proc Natl Acad Sci U S A 96(11):
6211-6216.
64
Kirsch, K. H., M. M. Georgescu, T. Shishido, W. Y. Langdon, R. B. Birge and H. Hanafusa
(2001). "The adapter type protein CMS/CD2AP binds to the proto-oncogenic protein c-
Cbl through a tyrosine phosphorylation-regulated Src homology 3 domain interaction." J
Biol Chem 276(7): 4957-4963.
Kjaerulff, O., L. Brodin and A. Jung (2011). "The structure and function of endophilin proteins."
Cell Biochem Biophys 60(3): 137-154.
Konishi, H., K. Tashiro, Y. Murata, H. Nabeshi, E. Yamauchi and H. Taniguchi (2006). "CFBP
is a novel tyrosine-phosphorylated protein that might function as a regulator of
CIN85/CD2AP." J Biol Chem 281(39): 28919-28931.
Kosako, H., T. Yoshida, F. Matsumura, T. Ishizaki, S. Narumiya and M. Inagaki (2000). "Rho-
kinase/ROCK is involved in cytokinesis through the phosphorylation of myosin light
chain and not ezrin/radixin/moesin proteins at the cleavage furrow." Oncogene 19(52):
6059-6064.
Kouranti, I., M. Sachse, N. Arouche, B. Goud and A. Echard (2006). "Rab35 regulates an
endocytic recycling pathway essential for the terminal steps of cytokinesis." Curr Biol
16(17): 1719-1725.
Kowanetz, K., I. Szymkiewicz, K. Haglund, M. Kowanetz, K. Husnjak, J. D. Taylor, P.
Soubeyran, U. Engstrom, J. E. Ladbury and I. Dikic (2003a). "Identification of a novel
proline-arginine motif involved in CIN85-dependent clustering of Cbl and down-
regulation of epidermal growth factor receptors." J Biol Chem 278(41): 39735-39746.
Kowanetz, K., J. Terzic and I. Dikic (2003b). "Dab2 links CIN85 with clathrin-mediated receptor
internalization." FEBS Lett 554(1-2): 81-87.
Kurakin, A. V., S. Wu and D. E. Bredesen (2003). "Atypical recognition consensus of
CIN85/SETA/Ruk SH3 domains revealed by target-assisted iterative screening." J Biol
Chem 278(36): 34102-34109.
Lehtonen, S., E. Lehtonen, K. Kudlicka, H. Holthofer and M. G. Farquhar (2004). "Nephrin
forms a complex with adherens junction proteins and CASK in podocytes and in Madin-
Darby canine kidney cells expressing nephrin." Am J Pathol 165(3): 923-936.
Liu, J., G. D. Fairn, D. F. Ceccarelli, F. Sicheri and A. Wilde (2012). "Cleavage furrow
organization requires PIP(2)-mediated recruitment of anillin." Curr Biol 22(1): 64-69.
Luedeke, C., S. B. Frei, I. Sbalzarini, H. Schwarz, A. Spang and Y. Barral (2005). "Septin-
dependent compartmentalization of the endoplasmic reticulum during yeast polarized
growth." J Cell Biol 169(6): 897-908.
Lynch, D. K., S. C. Winata, R. J. Lyons, W. E. Hughes, G. M. Lehrbach, V. Wasinger, G.
Corthals, S. Cordwell and R. J. Daly (2003). "A Cortactin-CD2-associated protein
(CD2AP) complex provides a novel link between epidermal growth factor receptor
endocytosis and the actin cytoskeleton." J Biol Chem 278(24): 21805-21813.
65
Madaule, P., M. Eda, N. Watanabe, K. Fujisawa, T. Matsuoka, H. Bito, T. Ishizaki and S.
Narumiya (1998). "Role of citron kinase as a target of the small GTPase Rho in
cytokinesis." Nature 394(6692): 491-494.
McIlhatton, M. A., J. F. Burrows, P. G. Donaghy, S. Chanduloy, P. G. Johnston and S. E. Russell
(2001). "Genomic organization, complex splicing pattern and expression of a human
septin gene on chromosome 17q25.3." Oncogene 20(41): 5930-5939.
McMurray, M. A. and J. Thorner (2009). "Septins: molecular partitioning and the generation of
cellular asymmetry." Cell Div 4: 18.
Moncalian, G., N. Cardenes, Y. L. Deribe, M. Spinola-Amilibia, I. Dikic and J. Bravo (2006).
"Atypical polyproline recognition by the CMS N-terminal Src homology 3 domain." J
Biol Chem 281(50): 38845-38853.
Monzo, P., N. C. Gauthier, F. Keslair, A. Loubat, C. M. Field, Y. Le Marchand-Brustel and M.
Cormont (2005). "Clues to CD2-associated protein involvement in cytokinesis." Mol Biol
Cell 16(6): 2891-2902.
Morita, E., V. Sandrin, H. Y. Chung, S. G. Morham, S. P. Gygi, C. K. Rodesch and W. I.
Sundquist (2007). "Human ESCRT and ALIX proteins interact with proteins of the
midbody and function in cytokinesis." EMBO J 26(19): 4215-4227.
Mostowy, S. and P. Cossart (2012). "Septins: the fourth component of the cytoskeleton." Nat
Rev Mol Cell Biol 13(3): 183-194.
Nakahira, M., J. N. Macedo, T. V. Seraphim, N. Cavalcante, T. A. Souza, J. C. Damalio, L. F.
Reyes, E. M. Assmann, M. R. Alborghetti, R. C. Garratt, et al. (2010). "A draft of the
human septin interactome." PLoS One 5(11): e13799.
Nam, J. M., Y. Onodera, Y. Mazaki, H. Miyoshi, S. Hashimoto and H. Sabe (2007). "CIN85, a
Cbl-interacting protein, is a component of AMAP1-mediated breast cancer invasion
machinery." EMBO J 26(3): 647-656.
Neufeld, T. P. and G. M. Rubin (1994). "The Drosophila peanut gene is required for cytokinesis
and encodes a protein similar to yeast putative bud neck filament proteins." Cell 77(3):
371-379.
Nishihama, R., M. Onishi and J. R. Pringle (2011). "New insights into the phylogenetic
distribution and evolutionary origins of the septins." Biological Chemistry 392(8-9): 681-
687.
Oegema, K., M. S. Savoian, T. J. Mitchison and C. M. Field (2000). "Functional analysis of a
human homologue of the Drosophila actin binding protein anillin suggests a role in
cytokinesis." J Cell Biol 150(3): 539-552.
Pan, F., R. L. Malmberg and M. Momany (2007). "Analysis of septins across kingdoms reveals
orthology and new motifs." BMC Evol Biol 7: 103.
66
Petrelli, A., G. F. Gilestro, S. Lanzardo, P. M. Comoglio, N. Migone and S. Giordano (2002).
"The endophilin-CIN85-Cbl complex mediates ligand-dependent downregulation of c-
Met." Nature 416(6877): 187-190.
Piekny, A. J. and M. Glotzer (2008). "Anillin is a scaffold protein that links RhoA, actin, and
myosin during cytokinesis." Curr Biol 18(1): 30-36.
Piekny, A. J. and A. S. Maddox (2010). "The myriad roles of Anillin during cytokinesis." Semin
Cell Dev Biol 21(9): 881-891.
Poperechnaya, A., O. Varlamova, P. J. Lin, J. T. Stull and A. R. Bresnick (2000). "Localization
and activity of myosin light chain kinase isoforms during the cell cycle." J Cell Biol
151(3): 697-708.
Qi, M., W. Yu, S. Liu, H. Jia, L. Tang, M. Shen, X. Yan, H. Saiyin, Q. Lang, B. Wan, et al.
(2005). "Septin1, a new interaction partner for human serine/threonine kinase aurora-B."
Biochem Biophys Res Commun 336(3): 994-1000.
Renshaw, M. J., J. Liu, B. D. Lavoie and A. Wilde (2014). "Anillin-dependent organization of
septin filaments promotes intercellular bridge elongation and Chmp4B targeting to the
abscission site." Open Biol 4: 130190.
Rizo, J. and T. C. Sudhof (2012). "The membrane fusion enigma: SNAREs, Sec1/Munc18
proteins, and their accomplices--guilty as charged?" Annu Rev Cell Dev Biol 28: 279-
308.
Roemer, T., K. Madden, J. Chang and M. Snyder (1996). "Selection of axial growth sites in yeast
requires Axl2p, a novel plasma membrane glycoprotein." Genes Dev 10(7): 777-793.
Sanders, S. L. and I. Herskowitz (1996). "The BUD4 protein of yeast, required for axial budding,
is localized to the mother/BUD neck in a cell cycle-dependent manner." J Cell Biol
134(2): 413-427.
Schiel, J. A., K. Park, M. K. Morphew, E. Reid, A. Hoenger and R. Prekeris (2011). "Endocytic
membrane fusion and buckling-induced microtubule severing mediate cell abscission." J
Cell Sci 124(Pt 9): 1411-1424.
Schmidt, M., A. Varma, T. Drgon, B. Bowers and E. Cabib (2003a). "Septins, under Cla4p
regulation, and the chitin ring are required for neck integrity in budding yeast." Mol Biol
Cell 14(5): 2128-2141.
Schmidt, M. H., B. Chen, L. M. Randazzo and O. Bogler (2003b). "SETA/CIN85/Ruk and its
binding partner AIP1 associate with diverse cytoskeletal elements, including FAKs, and
modulate cell adhesion." J Cell Sci 116(Pt 14): 2845-2855.
Schmidt, M. H., D. Hoeller, J. Yu, F. B. Furnari, W. K. Cavenee, I. Dikic and O. Bogler (2004).
"Alix/AIP1 antagonizes epidermal growth factor receptor downregulation by the Cbl-
SETA/CIN85 complex." Mol Cell Biol 24(20): 8981-8993.
67
Schroeder, B., S. Srivatsan, A. Shaw, D. Billadeau and M. A. McNiven (2012). "CIN85
phosphorylation is essential for EGFR ubiquitination and sorting into multivesicular
bodies." Mol Biol Cell 23(18): 3602-3611.
Schroeder, B., S. G. Weller, J. Chen, D. Billadeau and M. A. McNiven (2010). "A Dyn2-CIN85
complex mediates degradative traffic of the EGFR by regulation of late endosomal
budding." EMBO J 29(18): 3039-3053.
Sellers, J. R., M. D. Pato and R. S. Adelstein (1981). "Reversible phosphorylation of smooth
muscle myosin, heavy meromyosin, and platelet myosin." J Biol Chem 256(24): 13137-
13142.
Sellin, M. E., L. Sandblad, S. Stenmark and M. Gullberg (2011). "Deciphering the rules
governing assembly order of mammalian septin complexes." Molecular Biology of the
Cell 22(17): 3152-3164.
Shih, N. Y., J. Li, R. Cotran, P. Mundel, J. H. Miner and A. S. Shaw (2001). "CD2AP localizes
to the slit diaphragm and binds to nephrin via a novel C-terminal domain." Am J Pathol
159(6): 2303-2308.
Shih, N. Y., J. Li, V. Karpitskii, A. Nguyen, M. L. Dustin, O. Kanagawa, J. H. Miner and A. S.
Shaw (1999). "Congenital nephrotic syndrome in mice lacking CD2-associated protein."
Science 286(5438): 312-315.
Sirajuddin, M., M. Farkasovsky, F. Hauer, D. Kuhlmann, I. G. Macara, M. Weyand, H. Stark and
A. Wittinghofer (2007). "Structural insight into filament formation by mammalian
septins." Nature 449(7160): 311-315.
Skop, A. R., D. Bergmann, W. A. Mohler and J. G. White (2001). "Completion of cytokinesis in
C. elegans requires a brefeldin A-sensitive membrane accumulation at the cleavage
furrow apex." Curr Biol 11(10): 735-746.
Skop, A. R., H. Liu, J. Yates, 3rd, B. J. Meyer and R. Heald (2004). "Dissection of the
mammalian midbody proteome reveals conserved cytokinesis mechanisms." Science
305(5680): 61-66.
Soubeyran, P., K. Kowanetz, I. Szymkiewicz, W. Y. Langdon and I. Dikic (2002). "Cbl-CIN85-
endophilin complex mediates ligand-induced downregulation of EGF receptors." Nature
416(6877): 183-187.
Straight, A. F., C. M. Field and T. J. Mitchison (2005). "Anillin binds nonmuscle myosin II and
regulates the contractile ring." Mol Biol Cell 16(1): 193-201.
Surka, M. C., C. W. Tsang and W. S. Trimble (2002). "The mammalian septin MSF localizes
with microtubules and is required for completion of cytokinesis." Mol Biol Cell 13(10):
3532-3545.
68
TerBush, D. R., T. Maurice, D. Roth and P. Novick (1996). "The Exocyst is a multiprotein
complex required for exocytosis in Saccharomyces cerevisiae." EMBO J 15(23): 6483-
6494.
Tibaldi, E. V. and E. L. Reinherz (2003). "CD2BP3, CIN85 and the structurally related adaptor
protein CMS bind to the same CD2 cytoplasmic segment, but elicit divergent functional
activities." Int Immunol 15(3): 313-329.
Tooley, A. J., J. Gilden, J. Jacobelli, P. Beemiller, W. S. Trimble, M. Kinoshita and M. F.
Krummel (2009). "Amoeboid T lymphocytes require the septin cytoskeleton for cortical
integrity and persistent motility." Nat Cell Biol 11(1): 17-26.
Tossidou, I., R. Niedenthal, M. Klaus, B. Teng, K. Worthmann, B. L. King, K. J. Peterson, H.
Haller and M. Schiffer (2012). "CD2AP regulates SUMOylation of CIN85 in podocytes."
Mol Cell Biol 32(6): 1068-1079.
Tsang, C. W., M. P. Estey, J. E. DiCiccio, H. Xie, D. Patterson and W. S. Trimble (2011).
"Characterization of presynaptic septin complexes in mammalian hippocampal neurons."
Biol Chem 392(8-9): 739-749.
Versele, M. and J. Thorner (2005). "Some assembly required: yeast septins provide the
instruction manual." Trends Cell Biol 15(8): 414-424.
Watanabe, S., Y. Ando, S. Yasuda, H. Hosoya, N. Watanabe, T. Ishizaki and S. Narumiya
(2008). "mDia2 induces the actin scaffold for the contractile ring and stabilizes its
position during cytokinesis in NIH 3T3 cells." Mol Biol Cell 19(5): 2328-2338.
Watanabe, S., K. Okawa, T. Miki, S. Sakamoto, T. Morinaga, K. Segawa, T. Arakawa, M.
Kinoshita, T. Ishizaki and S. Narumiya (2010). "Rho and anillin-dependent control of
mDia2 localization and function in cytokinesis." Mol Biol Cell 21(18): 3193-3204.
Welsch, T., N. Endlich, G. Gokce, E. Doroshenko, J. C. Simpson, W. Kriz, A. S. Shaw and K.
Endlich (2005). "Association of CD2AP with dynamic actin on vesicles in podocytes."
Am J Physiol Renal Physiol 289(5): F1134-1143.
Wilson, G. M., A. B. Fielding, G. C. Simon, X. Yu, P. D. Andrews, R. S. Hames, A. M. Frey, A.
A. Peden, G. W. Gould and R. Prekeris (2005). "The FIP3-Rab11 protein complex
regulates recycling endosome targeting to the cleavage furrow during late cytokinesis."
Mol Biol Cell 16(2): 849-860.
Wollert, T., D. Yang, X. Ren, H. H. Lee, Y. J. Im and J. H. Hurley (2009). "The ESCRT
machinery at a glance." J Cell Sci 122(Pt 13): 2163-2166.
Yamashiro, S., G. Totsukawa, Y. Yamakita, Y. Sasaki, P. Madaule, T. Ishizaki, S. Narumiya and
F. Matsumura (2003). "Citron kinase, a Rho-dependent kinase, induces di-
phosphorylation of regulatory light chain of myosin II." Mol Biol Cell 14(5): 1745-1756.
Yang, Y. M., M. J. Fedchyshyn, G. Grande, J. Aitoubah, C. W. Tsang, H. Xie, C. A. Ackerley,
W. S. Trimble and L. Y. Wang (2010). "Septins regulate developmental switching from
69
microdomain to nanodomain coupling of Ca(2+) influx to neurotransmitter release at a
central synapse." Neuron 67(1): 100-115.
Zhang, C., H. J. Jiang, Y. Chang, Z. Fang, X. F. Sun, J. S. Liu, A. G. Deng and Z. H. Zhu
(2009a). "Downregulation of CD2-associated protein impaired the physiological
functions of podocytes." Cell Biol Int 33(6): 632-639.
Zhang, J., C. Kong, H. Xie, P. S. McPherson, S. Grinstein and W. S. Trimble (1999).
"Phosphatidylinositol polyphosphate binding to the mammalian septin H5 is modulated
by GTP." Curr Biol 9(24): 1458-1467.
Zhang, J., X. Zheng, X. Yang and K. Liao (2009b). "CIN85 associates with endosomal
membrane and binds phosphatidic acid." Cell Res 19(6): 733-746.
