Department of Pathobiology

University of Veterinary Medicine Vienna

Institute of Bacteriology, Mycology and Hygiene

(Head: Univ. Prof. DDr. Renate Rosengarten)

In vivo imaging of Salmonella enterica serovar Typhimurium infection in mice

BACHELOR THESIS for obtaining the degree

Bachelor of Science (B.Sc.) of the University of Veterinary Medicine Vienna

submitted by

Jutta A. Pikalo

Vienna, May 2010

2

The Thesis was performed at

Intercell AG

Department: Infectious Disease Models & Adjuvant Research

(Head: PhD Benjamin Wizel)

Group: Bacterial Infectious Disease Models

(Group Leader: PhD MD Gabor Nagy)

External Supervisor: PhD MD Gabor Nagy

Internal Supervisor: Dr. Michael Szostak

Reviewer: Univ. Prof. DDr. Renate Rosengarten

3

TABLE OF CONTENTS

1 Introduction .................................................................................................... 5 1.1 The genus Salmonella ..................................................................................... 5

1.2 Pathogenesis of salmonellosis ........................................................................ 6

1.2.1 Typhoid fever ................................................................................................... 7

1.2.2 Enterocolitis ..................................................................................................... 8

1.2.3 Bacteraemia: non-typhoidal Salmonellae ........................................................ 8

1.3 Molecular mechanism of pathogenicity of salmonellosis ................................. 9

1.3.1 Colonization of mucosal sites .......................................................................... 9

1.3.2 Systemic infection .......................................................................................... 10

1.4 Animal models for the study of Salmonella pathogenesis.............................. 12

1.4.1 The mouse model of typhoid fever ................................................................ 12

1.5 Bioluminescence imaging .............................................................................. 12

1.6 The lux operon from Photorhabdus luminescens ......................................... 14

1.7 Aims of the thesis .......................................................................................... 15

2 Materials and Methods ................................................................................ 16 2.1 Bacterial strains and growth conditions ......................................................... 16

2.1.1 Glycerol stocks .............................................................................................. 16

2.2 Plasmids ........................................................................................................ 16

2.2.1 pXen-13 ......................................................................................................... 17

2.2.2 pLDR8 ........................................................................................................... 17

2.2.3 pLDR11 ......................................................................................................... 18

2.2.4 pJUPI-1 and pJUPI-2 ..................................................................................... 18

2.3 Molecular biological techniques ..................................................................... 18

2.3.1 Purification of plasmid DNA (Miniprep) .......................................................... 18

2.3.2 Polymerase chain reaction (PCR) ................................................................. 18

2.3.3 DNA electrophoresis ...................................................................................... 20

2.3.4 Cloning of pJUPI-1 and pJUPI-2 .................................................................... 20

2.3.5 Ligations ........................................................................................................ 21

2.3.6 Transformations ............................................................................................. 21

2.4 In vivo studies ................................................................................................ 22

2.4.1 Laboratory animals ........................................................................................ 22

2.4.2 Monitoring bioluminescent Salmonella infections in mice .............................. 22

4

2.4.3 Quantification of bioluminescence data from mice ........................................ 23

3 Results .......................................................................................................... 24 3.1 Generation of bioluminescent Salmonella ..................................................... 24

3.1.1 Construction of plasmid pJUPI-1 and pJUPI-2 .............................................. 24

3.1.2 Integration of lux operon into the attB site of the S. Typhimurium .....................

SL1344 chromosome..................................................................................... 26

3.1.3 Generation of S. Typhimurium SL1344 containing pXen-13 .......................... 29

3.1.4 Comparison of in vitro growth ........................................................................ 29

3.2 Virulence study .............................................................................................. 30

3.2.1 Animal experimental setup ............................................................................ 30

3.2.2 Animal experimental outcome ....................................................................... 31

4 Discussion ................................................................................................... 36 5 Summary ...................................................................................................... 38 6 Zusammenfassung ...................................................................................... 39 7 References ................................................................................................... 40 8 Abbreviations ............................................................................................... 45 9 Appendix ...................................................................................................... 46 9.1 Code for earmarks ......................................................................................... 46

9.2 Experimental scheme .................................................................................... 47

10 Acknowledgements ..................................................................................... 48

5

1 INTRODUCTION

1.1 The genus Salmonella

Salmonellae are Gram-negative, facultative anaerobic, facultative intracellular

bacilli, which are members of the family Enterobacteriaceae. The genus

Salmonella contains three species: Salmonella enterica, Salmonella subterranean

(a new species recognized in 2005) and Salmonella bongori. S. bongori and S.

subterranean are rarely associated with human disease. The species S. enterica

consists of six subspecies as listed in Fig. 1 (SU and CHIU, 2007).

The subspecies I (enterica) contains more than 1500 different serovars which are

classified by major immunogenic antigens: O-antigens (somatic) reflecting

variations in the exposed part of the lipopolysaccharide and H-antigens (flagellar)

reflecting variations in flagellin, the major protein of the flagellum. Names of the

serovars are usually indicative of associated diseases, geographic origins or usual

habitats (LAN et al., 2009).

Serotypes (difference O- (surface) and H- (flagella) antigens

Genus

Species

Subspecies

Salmonella

Salmonella enterica Salmonella bongori

S. enterica subsp. enterica

(subsp. I)

S. enterica subsp. salamae

(subsp. II)

S. enterica subsp. arizonae

(subsp. IIIa)

S. enterica subsp. diarizonae

(subsp. IIIb) subsp. V

S. enterica subsp. houtenae

(subsp. IV)

S. enterica subsp. indica (subsp. VI)

1.504 ** 502 95 333 72 13 22

Fig. 1: Pedigree of Salmonella * LIN-HUI SU, 2006; which was recognized in 2005 ** including: S. Typhi, S. Paratyphi, S. Enteritidis and S. Typhimurium

Salmonella subterranean *

6

From Subspecies I several serovars are important pathogens for humans and

animals, specifically Typhi, Paratyphi, Typhimurium, Enteritidis and Newport,

(DARWIN and MILLER, 1999; PORWOLLIK et al., 2004). There are three groups

of disease syndromes in humans which are associated with Salmonella serotypes:

enterocolitis, typhoid fever and bacteremia (DARWIN and MILLER, 1999;

SANTOS et al., 2001; ZHANG et al., 2003).

In this study the serovar Typhimurium was used because it is known to be

responsible for a typhoid-like disease in the mouse model, resembling the disease

caused by S. Typhi in humans. As S. Typhi is a restricted human pathogen, this

model is widely used to mimic human typhoid in mice (CHAN et al., 2003; BURNS-

GUYDISH et al., 2005; GRASSL and FINLAY, 2008). Therefore, the murine

typhoid model has been used successfully for understanding and identifying

virulence mechanisms and pathogenicity and for developing vaccines against S.

Typhi in humans (TSOLIS et al., 1999; BURNS-GUYDISH et al., 2005; GRASSL

and FINLAY, 2008).

1.2 Pathogenesis of salmonellosis

Salmonellosis is one of the most common bacterial infections in humans and

animals. It remains a major cause of mortality and morbidity worldwide. It could

present as enterocolitis, typhoid fever or bacteremia in humans (ZHANG et al.,

1997; DARWIN and MILLER, 1999; FINLAY and BRUMELL, 2000).

S. enterica serovar Typhi causes typhoid fever, which is a potentially fatal multi-

organ systemic disease. In contrast, wide host-range serovars like S. enterica

serovar Typhimurium and Enteritidis cause enterocolitis in humans and cattle, but

systemic infection in mice (BURNS-GUYDISH et al., 2005; GRASSL and FINLAY,

2008; BRUSCH and GARVEY, 2009).

7

1.2.1 Typhoid fever

Typhoid fever is transmitted by ingestion of water or food contaminated with

S. Typhi. Being a human specific pathogen, human fecal contamination is the sole

source of infection. Therefore, typhoid is common in regions, where hygienic

conditions are suboptimal, i. e. in most developing countries.

Typhoid fever has a long incubation period, a long duration of symptoms and the

bacterium can persist in human tissues for a long time. In addition to colonization

of the intestine and the mesenteric lymph nodes, S. Typhi also spreads to the liver,

spleen and bone marrow during the systemic infection (ZHANG et al., 1997;

GRASSL and FINLAY, 2008; RAFFATELLU et al., 2008; LAN et al., 2009).

Classically, typhoid fever is considered a multiple stage disease: 1) in the first

week typhoid fever is characterized by progressive elevation of body temperature,

followed by bacteremia, 2) in the second week with rose spots in the skin,

abdominal pain and splenomegaly develop and 3) the third week shows more

intensive intestinal inflammatory processes, particularly in the Peyer´s patches and

complications such as digestive bleeding and intestinal perforation may develop.

The infectious process is shown in Fig. 2 (ANDRADE and ANDRADE jr., 2003;

HAMID and JAIN, 2007). Fig. 2: Infection pathway of Salmonella: 1.

After the oral infection, passing threw the

stomach, S. Typhi enters the host´s

system primarily through the Peyer´s

patches of the distal ilium. Non-invasive

serovars subvert function of the

enterocytes and cause diarrhea. Invasive

Salmonellae translocate to the submucosa

and invade macrophages (see also Fig. 3).

Subsequently, bacteria replicate in the

reticuloendothelial tissues of the liver,

spleen, bone marrow and lymph nodes

and cause a disseminated infection. In

some instances the infected person

becomes a non-symptomatic carrier, when bacteria survive in the gall bladder. The result is that the

organism re-enters the gastrointestinal tract in the bile and reinfects Peyer patches. Bacteria that

do not reinfect the host are typically shed in the stool and are then available to infect other hosts

(GIANNELLA, 1996; BRUSCH et al., 2009).

8

1.2.2 Enterocolitis

Salmonella enterocolitis is the second most frequent cause of bacterial food-borne

disease. Salmonella enterica serovar Typhimurium and Enteritidis are associated

most frequently with this diarrheal disease syndrome (DARWIN and MILLER,

1999; SANTOS et al., 2003; ZHANG et al., 2003). Gastroenteritis is characterized

by a rapid onset after a short incubation period from 6 to 24 hours and a brief

duration. The short clinical course of gastroenteritis suggests that the onset of an

adaptive immune response results in clearance of the infection (RAFFATELLU et

al., 2008). The typically clinical and pathological symptoms are diarrhea and

massive influx of neutrophils (DARWIN and MILLER, 1999; GRASSL and FINLAY,

2008).

After oral ingestion, Salmonella colonizes the intestines and invades the intestinal

mucosa. Invasion of enterocytes and microfold cells (M cells) results in the

extrusion of infected epithelial cells into the intestinal lumen with consequent villus

blunting and loss of absorptive surfaces. Salmonella also elicit a polymorphnuclear

leukocyte influx into infected mucosa and induce watery diarrhea, which may

contain blood (DARWIN and MILLER, 1999; WALLIS and GALYOV, 2000). Unlike

in case of typhoid, however, the infection is restricted to the mucosa of the small

intestines and disseminates only in immunocompromised individuals (Fig. 2).

For animal models of enterocolitis calves and pigs were used because the mouse

does not develop diarrhea with S. Typhimurium infections (SANTOS et al., 2001;

GRASSL and FINLAY, 2008). Recently, however, it was shown that elimination of

the normal flora by streptomycin treatment makes mice also susceptible to

enterocolitis by these serovar (BARTHEL et al., 2003).

1.2.3 Bacteraemia: non-typhoidal Salmonellae

Nowadays a new phenomenon could be seen in sub-Saharan Africa. In young

children and in HIV-infected adults the normal non-typhoid Salmonellae (NTS)

which causes gastroenteritis in industrial countries, are getting invasive like S.

Typhi. NTS bacteraemia is more common during the rainy seasons and is

associated with malaria and anaemia and also with pneumonia. Furthermore NTS

septicaemia is also associated with meningitis. On the other hand an absence of

9

diarrhea or abdominal features is seen. Unlike, typhoid fever, however, gall-

bladder involvement appears to be very rare and the late complications of upper

GI bleed or haemorrhage, which are seen in typhoid, are not described in invasive

NTS disease. NTS infection appears to primarily involve the large bowel. The wide

variety of clinical presentations and lack of gastrointestinal features makes

diagnosis extremely challenging. Another highlight of systemic NTS is that NTS

could persist within macrophages (GORDON and GRAHAM, 2008).

1.3 Molecular mechanism of pathogenicity of salmonellosis

1.3.1. Colonization of mucosal sites

After entering the small intestine, Salmonella has to cross the intestinal mucus

layer before encountering and adhering to cells of the intestinal epithelium.

Salmonellae express several fimbriae that contribute to their ability to adhere to

intestinal epithelial cells. Next, Salmonellae invade host cells by a morphological

distinct process termed bacterial-mediated endocytosis. Shortly after bacteria

adhere to the apical epithelial surface, profound cytoskeletal rearrangements

occur in the host cell, disrupting the normal epithelial brush border and inducing

the subsequent formation of “membrane ruffles” that reach out and engulf

adherent bacteria in large vesicles. This process is induced by effector molecules

injected by Salmonella into the eukaryotic cells through a type 3 secretion system

(TTSS). In mice, Salmonellae appear to preferentially adhere to and enter the M

cells of the intestinal epithelium, although invasion of normally non-phagocytic

enterocytes also occurs. M cells are specialized epithelial cells that sample

intestinal antigens through pinocytosis and transport these antigens to lymphoid

cells that underlie the epithelium in Peyer´s patches (FINLAY and BRUMELL,

2000; OHL und MILLER, 2001; HAMID and JAIN, 2007).

In S. Typhimurium, many virulence genes cluster together on Pathogenicity

Islands (PAIs). Now, five Salmonella Pathogenicity Island (SPI) have been

described but only two of them, SPI1 and SPI2 encode type III secretion systems.

The SPI1 TTSS translocates effector proteins into the cytosol of host cells, so it

plays an important role in invasion of non-phagocytic epithelial cells and

10

enteropathogenesis, while the SPI2 encoded TTSS is required for intracellular

survival and replication in murine macrophages (SANTOS et al., 2003; HAMID and

JAIN, 2007; IBARRA and STEELE-MORTIMER, 2009). Only the species S.

enterica is able to spread systemically due to the presence of SPI2 (LAN et al,

2009).

1.3.2 Systemic infection

Once across the intestinal epithelium, Salmonellae encounter another obstacle of

innate immunity, the submucosal macrophage. Salmonella serotypes that cause

systemic infection i. e. S. Typhi and Paratyphi in humans, enter macrophages,

again apparently by induced macropinocytosis (SPI2 encoding TTSS-2) and

subsequently activate virulence mechanisms that allow evasion of the microbicidal

functions of the phagocyte, permitting survival and replication in the intracellular

environment (HOUSE et al., 2001; OHL und MILLER, 2001; ANDRADE and

ANDRADE jr., 2003; HAMID and JAIN, 2007). Travelling in macrophages the

bacteria colonize systemic organs, primarily the spleen and the liver. Following

replication Salmonella cause a secondary bacteraemia, which is characterized by

a very high fever and disseminated infection (Fig. 2).

The molecular pathogenesis difference between typhoid fever and enterocolitis is

shown in Fig. 3.

11

Fig. 3: Schematic representation of the pathogenesis of Salmonella with the most significant

events described (OHL and MILLER, 2001).

Typhoid Fever

Enteritis

1. Bacterial-mediated endocytosis 2. Neutrophil recruitment and migration 3. Fluid and electrolyte secretion 4. Epithelial-cell cytokine secretion 5. Survival in macrophage

12

1.4 Animal models for the study of Salmonella pathogenesis

Animal models are frequently used to study the virulence mechanisms of

Salmonella serotypes that are important for the human disease syndromes,

typhoid fever and enteritis (SANTOS et al., 2001).

The most successfully used animal models for elucidating virulence mechanisms

are the mouse for typhoid fever (S. Typhimurium) and the calf for human enteritis

and these days also the pig, because the gastrointestinal tract of the pig is very

similar to humans and pigs are also an important source of Salmonella infections

in humans (TSOLIS et al., 1999; SANTOS et al., 2001; METCALF et al., 2000;

BOYEN et al., 2008). Recently, mice have been also used for the modelling of

enterocolitis (BARTHEL et al., 2003).

1.4.1 The mouse model of typhoid fever

The mouse model has been extremely useful in identifying virulence mechanisms

or to study clinically relevant mechanisms of anti-Salmonella host defense of

serotype Thyphimurium and in addition used successfully for finding live

attenuated typhoid fever vaccine candidates.

Mice show signs of infection between 4 – 8 days post oral infection, but without

diarrhea. Instead, mice develop a systemic disease characterized by rapid

bacterial multiplication in the liver and spleen. Mice usually succumb to infection at

10 – 14 days post infection. The infectious process and the symptoms caused by

S. Typhimurium in mice mimic the human disease, typhoid fever caused by S.

Typhi, which is restricted to the human host (HOUSE et al, 2001; SANTOS et al,

2001; HAMID and JAIN, 2007).

1.5 Bioluminescence imaging

In vivo bioluminescent imaging (BLI) is a sensitive tool that is based on detection

of light emission from cells or tissues. Optical imaging by bioluminescence allows

a low-cost, non-invasive and real-time analysis of infection processes at the

molecular level in living organisms. It also allows longitudinal monitoring of a

13

disease course in the same animal, a perfect alternative to analyzing a number of

animals at many time points during the infection (SATO et al., 2004; HUTCHENS

and LUKER, 2007; ZINN et al., 2008).

Low levels of light at wavelengths between 400 and 1000 nm can be detected with

charge-coupled device (CCD) cameras that convert the light photons that strike

silicon wafers into electrons. The software is able to convert electron signals into a

two-dimensional image and also to quantify the intensity of the emitted light and

then convert these numerical values into a pseudocolor graphic. The actual data is

measured in photons, but the pseudocolor graphic enables rapid visual

interpretation. The sensitivity of BLI is difficult to define and must be established

for each biological assay (SATO et al., 2004).

Fig. 4: The Optical In Vivo Imaging System IVIS 200 (Xenogen, Caliper life schience, Alameda,

Canada), which was used in this study.

The imaging times in BLI are short and typically, a diagnostic image can be

generated in a time frame of a few seconds to several minutes. In order to

generate the best possible image, it is important that the subject be immobilized,

and this is best accomplished with anesthesia. Animals may be anesthetized with

injectable or inhalant anesthetics, depending in the set up of the imaging device

(SATO et al., 2004).

14

1.6 The lux operon from Photorhabdus luminescens

Bioluminescence is a chemiluminescent reaction between at least two molecules

produced under physiological conditions within or in association with an organism

(GREER and SZALAY, 2002). Photorhabdus luminescens is a terrestrial bacterium which has a bioluminescent

system. This bacterium-based bioluminescent system is encoded by five essential

genes that are organized in an operon such as luxCDABE and it is attractive

because the genes coding for both the bacterial luciferase and substrate

biosynthesis enzymes can be expressed within bacterial host (MEIGHEN, 1993;

ROCCHETTA et al., 2001; GREER and SZALAY, 2002; GUPTA et al., 2003).

LuxAB code for the heterodimeric luciferase catalyzing the oxidation of reduced

flavin mononucleotide (FMNH2), luxCDE encode a long-chain fatty aldehyde which

is synthesized by a fatty acid reductase complex (FRACKMAN et al., 1990;

MEIGHEN, 1991; MEIGHEN 1993; DOYLE et al., 2004). Although a number of

additional lux genes in bioluminescent bacteria have been identified but only luxA-

E are essential for the biosynthesis of light (MEIGHEN 1993). The lux operon from

P. luminescens is ideally suited for the study of gram-negative pathogens in

mammalian animal models as the enzymes retain significant activity at 37°C

(MEIGHEN, 1993; FRANCIS et al., 2000; DOYLE et al., 2004).

15

1.7 Aims of the thesis

This thesis was aimed to construct Salmonella strains that emit a luminescent

signal strong enough for in vivo monitoring of a Salmonella infection in mice.

For this, the following objectives were set:

1. The operon encoding the luminescence gene should be provided either on a

multi-copy plasmid or integrated at the λ phage attachment site in the

Salmonella genome.

2. The virulence of such genetically modified luminescent Salmonella should be

compared to the wild-type strain in corresponding mouse models to ensure

this virulence potential.

3. The infection caused by these luminescent Salmonella constructs should be

monitored by in vivo detection of the luminescent signal. This way, the

bacterial load of different organs could be determined at various time-points

of the infection.

16

2 MATERIALS AND METHODS

2.1 Bacterial strains and growth conditions

Escherichia coli strain DH5α (Invitrogen, Lofer, Austria) was used for all cloning

purposes and E. coli strain BL21 Star (Invitrogen, Lofer, Austria) for analyzing the

pT7 promoter activity. The prototype Salmonella enterica serovar Typhimurium (S.

Typhimurium) strain SL1344 (Dept. of Medical Microbiology and Immunity,

University of Pécs, Hungary) was used for virulence studies. Genetically modified

variants (described later in this study) of this wild-type strain emitting luminescent

signal were used for in vivo imaging.

All bacterial strains were routinely grown in Luria Bertani (LB) broth (PAA

Laboratories GmbH, Pasching, Austria) or LB agar plates solidified with 1.5 %

Select Agar (Invitrogen, Lofer, Austria). Cultures were shaken at 250 rpm and

incubated at 37°C if not indicated otherwise. When appropriate, media were

supplemented with the following concentration of antibiotics: ampicillin 150 μg/ml

(Sigma-Aldrich, Vienna, Austria), kanamycin 100 μg/ml (Sigma-Aldrich, Vienna,

Austria) or tetracycline 50 μg/ml (Sigma-Aldrich, Vienna, Austria).

2.1.1 Glycerol stocks

Single light-emitting colonies as verified by the Xenogen IVIS Imaging System 200

Series (Caliper Life Sciences, Mainz, Germany) were picked from the agar plate

and overnight cultures were prepared in LB medium with the appropriate antibiotic.

Next day glycerol (Sigma, Vienna, Austria) was added to a final concentration of

15 % and cultures were frozen in sterile 1.8 ml Cryo.s PP with srew caps (Greiner

bio-one, Kremsmünster, Austria) at -80°C.

2.2 Plasmids

General descriptions of the plasmids used in this study are described below.

Bacterial strains carrying this plasmid were cultured according to the

characteristics provided under the given plasmid.

17

2.2.1 pXen-13

This plasmid carries the original Photorhabdus luminescens luxCDABE operon for

the engineering of bioluminescent Gram-negative bacteria. The plasmids bacterial

luciferase operon consisting of luxC, luxD, luxA, luxB and luxE was used for

integration to the λ attachment site of S. Typhimurium strain SL1344.

According to Xenogen there is no apparent promoter for the lux operon on the

plasmid. The observed expression is speculated to be induced by some not

properly disclosed upstream promoter.

General purpose: luxCDABE

Source: Caliper Life Sciences (www.caliperls.com)

Plasmid size: 8.8 kb

Antibiotic selection: ampicillin at 150 μg/ml

Growth temperature: 37°C

Reference: WINSON M. K. et al. 1998

2.2.2 pLDR8

The plasmid pLDR8 carries the λ int gene encoding the Lambda phage integrase

required for the λ attB-driven integration of DNA at any genomic attB site. Besides,

pLDR8 harbours a kanamycin resistance gene and a temperature-sensitive

replicon.

General purpose: helper plasmid for the integration of DNA into the λ attachment

site in the bacterial genome.

Source: Dept. of Medical Microbiology and Immunity, University of Pécs, Hungary

Plasmid size: 7.6 kb

Antibiotic selection: kanamycin at 100 μg/ml

Growth temperature: 30°C

Reference: DIEDERICH et al., 1992

18

2.2.3 pLDR11

General description: Vector for attB-driven integration into the λ attachment site.

Source: Dept.of Medical Microbiology and Immunity, University of Pécs, Hungary

Plasmid size: 4.1 kb

Antibiotic selection: ampicillin at 150 μg/ml and tetracyclin at 50 μg/ml

Growth temperature: 37°C

Reference: DIEDERICH et al., 1992

2.2.4 pJUPI-1 and pJUPI-2

General description: luxCDABE operon under pT7 control subcloned into the

EcoRI and PstI sites of the λ attB integration vector pLDR11

Plasmid size: 10.2 kb

Host bacterium: E. coli DH5α

Antibiotic selection: ampicillin at 150 μg/ml

Growth temperature: 37°C

Reference: this work

2.3 Molecular biological techniques

2.3.1 Purification of plasmid DNA (Miniprep)

For plasmid purification the QIAprep Spin Miniprep Kit (QIAGEN, Vienna, Austria)

was applied using a Microcentrifuge (Heraeus Biofuge fresco, Thermo Fisher

Scientific, Vienna, Austria) as described by the manufacturer’s instructions. DNA

was eluted in ddH2O (Invitrogen, Lofer, Austria) and kept at -20°C until further

processing.

2.3.2 Polymerase chain reaction (PCR)

All oligonucleotides (Table 1) were designed with the help of the Vector NTI

Software (Invitrogen, Lofer, Austria), and primers were synthesized by Eurofins

MWG Operon (Ebersberg, Germany).

19

PCR reactions were performed using a T3 Thermocycler (Biometra, Göttingen,

Germany) in 200 μl thin-walled PCR tubes (Sarstedt, Wr. Neudorf, Austria).

Routinely, two PCR kits were used: Expand High Fidelity PCR System (Roche,

Vienna, Austria) and GO TaqR DNA polymerase (Promega, Vienna, Austria).

For the amplification of the lux operon, the Expand High Fidelity PCR System was

used. A typical 50 μl reaction was set up containing 5 μl 10 x PCR buffer 2, 2 mM

MgCl2 (Roche, Vienna, Austria), 0.5 μl each primer Nr. 8610 and 8611, 1 μl dNTP

mix (Invitrogen, Lofer, Austria), 0.5 μl Taq DNA polymerase (Roche, Vienna,

Austria) and 1 μl template DNA.

Amplification was achieved with 35 cycles at 94°C for 30 sec, 58°C for 30 sec and

68°C for 7 min, followed by a final extension step at 68°C for 10 min.

The GO TaqR kit was used to confirm the integration and the orientation of

integrated constructs by using oligos from Table 1 at the following conditions: 32

cycles at 94°C for 30 sec, 57°C for 30 sec and 72°C for 2 min 30 sec, followed by

a final extension step at 72°C for 5 min.

Reactions were carried out in 20 μl volumes containing 4 μl of 5 x Green GoTaqTM

Reaction Buffer (Promega, Vienna, Austria), 2 mM MgCl2, 0.5 μl of each selected

primer, 1 μl dNTPs, 0.5 μl GoTaq DNA Polymerase (Promega, Vienna, Austria),

and 1 μl template DNA.

QIAquick PCR Purification Kit (Qiagen, Vienna, Austria) was used for purifying the

PCR mixture before digestion, according to the manufacturer’s instructions.

Name Sequence (5´-> 3´) Length

[bp]

8610 TATCTGCAGTAATACGACTCACTATAGGG

TTCAGGCTTGGAGGATACGTATGACTA 56

8611 TATGAATTCGTCATCAACTTCAACTATCAAACGCTTCG 38

8624 CGTAGAGCTACAGGCGCTC 19

8625 GCATTCCTGTCGCTCTCTTG 20

8630 CGAAGCGTTTGATAGTTGAAGTTG 24

8631 TAGTCATACGTATCCTCCAAGCCT 24 Table 1: Oligonucleotides used in this study.

Restriction sites for PstI and EcoRI are shown in bold and the sequence of the T7 promoter is

underlined.

20

2.3.3 DNA electrophoresis

DNA molecules were analysed by gel electrophoresis using 1 % agarose

(Invitrogen, Lofer, Austria) gels prepared with 1 x TAE buffer (Sigma, Vienna,

Austria). Electrophoresis was performed in a Biorad system (BIORAD, Vienna,

Austria). Staining was achieved by adding 0.5 μg/ml ethidiumbromide (Fluka,

Vienna, Austria) to the liquid agarose. A DNA gel loading buffer (6 x loading dye,

Fermentas, St. Leon-Rot, Germany) was added to the DNA sample. For size

estimations the GeneRulerTM 1 kb DNA Ladder (Fermentas, St. Leon-Rot,

Germany) was used. DNA fragments for cloning procedures were excised from the

gel and purified using the QIAquick Gel Extraction Kit (QIAGEN, Vienna, Austria).

2.3.4 Cloning of pJUPI-1 and pJUPI-2

Restriction digestion (for the enzymes and restriction sites see Table 2) was

performed using PstI and EcoRI enzymes (Fermentas, St. Leon-Rot, Germany) at

the following conditions: 2 h digestion at 37°C in a total volume of 50 μl containing:

for the pXen-13: 38 μl DNA, 10 μl of 10 x Buffer TangoTM (2 x final concentration),

1 μl PstI and 1 μl EcoRI (5 Units each).

for the pLDR11: 12 μl vector, 10 μl of 10 x Buffer TangoTM (2 x final concentration),

1 μl PstI, 1 μl EcoRI and filled up with ddH2O.

For the restriction digestion from pJUPI-1 with NotI (Fermentas, St. Leon-Rot,

Germany) the following conditions were used: 2 h digestion at 37°C with a total

volume of 60 μl containing: 49 μl of the plasmid, 2 μl NotI, 6 μl buffer O+ and 3 μl

ddH2O.

After digestion the DNA was purified using the QIAquick PCR purification or Gel

Extraction Kit from Qiagen according to manufacturer´s instructions (Vienna,

Austria).

21

Enzyme Recognition sequence Buffer

PstI

5´…CTGCAG…3´

3´…GACGTC…5´

Tango

EcoRI

5´…GAATTC…3´

3´…CTTAAG…5´

Tango

NotI

5'...GCGGCCGC...3'

3'...CGCCGGCG...5'

O+

Table 2: Restriction endonucleases used in this study.

2.3.5 Ligations

Ligation reactions were carried out overnight at 16°C using 1 U/μl of T4 DNA

Ligase (Invitrogen, Lofer, Austria) with 5 x T4 Ligase buffer. The reaction volume

of 21 μl contained: 1 μl of vector pLDR11, 15 μl pXen-13, 4 μl buffer and 1 μl T4

ligase.

The ligation volume from pJUPI-1 after the digestion with NotI was total 50 μl

contained: 6 μl from pJUPI-1, 10 μl buffer, 1 μl T4 ligase and 33 μl ddH2O. To purify the ligation mixture before electroporation a precipitation was carried out

by adding 2 μl 3 M NaAc and 55 μl cold EtOH, vortexed and incubated at -20°C for

1 h. Subsequently the mixture was centrifuged 10 min at 13,000 rpm at 4°C, the

pellet was washed twice with 70 % EtOH by repeating the centrifugation step.

Finally, the pellet was air-dried, resuspended in 2 μl ddH2O and used for

transformation.

2.3.6 Transformations

ElectroMAXTM DH5α-ETM cells (Invitrogen, Lofer, Austria) were transformed by

electroporation following to manufacturer’s instructions. Electroporation was

carried out using a BIORAD Gene Pulser XcellTM equipment and 1 mm cuvettes

(BIORAD, Vienna, Austria) at the following settings: voltage of 1,800 V,

capacitance of 25 μF, resistance of 200 Ω.

22

2.4 In vivo studies

All animal experiments were accepted by the Vienna government

M58/007378/2008/5 and were carried out at Intercell AG under barrier, S2 and IVC

conditions.

2.4.1 Laboratory animals

20 female specific pathogen free (SPF) BALB/cJRj (Charles River Laboratories,

Sulzfeld, Germany) were used in 4 groups of 5 mice each. The laboratory animals

were kept in individual ventilated cages (IVC) in the S2 area of Intercell AG under

standardised conditions. Barrier owning, 20 – 24°C room temperature and 55% ±

10% atmospheric humidity included in the standardised conditions. Artificial light

was used in a 12 hours day-night circle. The weight of the mice was between 20

and 25 g, the age was between 8 and 10 weeks at the beginning of the

experiment. The mice were kept in Type 2 Long Polysulfon cages (EBECO,

Castrop-Rauxel, Germany) with laboratory animal sprinkle PP-bag (ABEDD,

Vienna, Austria), equipped with standard lid for IVC Typ 2 long, filtertops Typ 2

long and 450 ml Polysulfon water bottles (all from EBECO, Castrop-Rauxel,

Germany). The food ssniff R/M-H (Ssniff Specialdiet GmbH, Soest, Germany) and

the water were ad libitum.

2.4.2 Monitoring bioluminescent Salmonella infections in mice

Bacterial cultures were grown until mid-logarithmic growth phase, pelleted and

then resuspended in phosphate buffer saline (PBS). Bacterial numbers were

estimated spectrophotometerically, justified by previous viable counts, by

determining the absorbance at 600 nm wave-length. Concentrations were adjusted

to approximately 5 x 108 CFU/ml by dilution with PBS. The cells were chilled down

on ice for a short period. Mice were orally inoculated with 200 μl of bacterial

suspension using a gavage (Fuchigami, Japan). Cell numbers were determined by

retrospective plating on LB agar containing the appropriate antibiotic.

23

2.4.3 Quantification of bioluminescence data from mice

Mice were monitored for bioluminescence every 24 h over a period of 2 weeks

post infection. For this purpose mice were placed in the Xenogen IVIS Imaging

System 200 Series equipment and anesthetized with 2.5 % isoflurane gas (Baxter,

Vienna, Austria). The IVIS 200 System was used with the following settings: Em

filter = open, Ex filter = block, Bin: (HS)16, For: 21.7, f1, for a maximum of 5 min.,

using an IVIS CCD camera (Xenogen Corporation, ISO743N4388, Spectral

Instruments).

Total photon emission of each mouse was quantified with the Living Image 3.1

software package (Xenogen, Caliper life sciences) and the region of interest (ROI)

measurements were analysed with Microsoft Excel (Windows 2003). The photon

signal from the gastrointestinal-tract (GI-tract) was quantified from the ventral

image of each mouse.

The virulence of each Salmonella strain was analysed with Graph Pad Prism 5.0

(Graph Pad Software Inc., La Jolla, CA) and for the statistical analysis the Log-

rank (Mantel-Cox) Test was used.

Fig. 5: Anesthesia System used in this study.

24

3 RESULTS 3.1 Generation of bioluminescent Salmonella For the generation of bioluminescent Salmonella we followed two approaches: 1)

expression of the Photorhabdus luminescens luciferase genes from an

extrachromosomal plasmid and, in case that such a plasmid would not be

consistently propagated, 2) the technique described by DIEDERICH et al., 1992.

Diederich used a λ attP sequence encoded on plasmid pLDR11 to integrate the

plasmid into the attB λ attachment site on the Salmonella chromosome with the

help of pLDR8 which encodes the λ int gene.

3.1.1 Construction of plasmid pJUPI-1 and pJUPI-2 For subcloning of a full-length lux operon consisting of the genes luxCDABE the

operon was amplified by PCR from plasmid pXen-13 serving as the template. The

oligonucleotides used for the amplification of the lux operon contained restriction

endonuclease sites as well as the T7 promoter sequence (Table 1). The resulting

PCR product was digested by PstI and EcoRI and subsequently ligated to the

corresponding sites of pLDR11. The resulting plasmid pJUPI-2 (Fig. 7) was

transformed into E. coli DH5α and recovered on agar plates containing tetracycline

(tet). Colonies growing on tet-agar plates were subsequently analyzed for

bioluminescence in an IVIS 200 Xenogen analyzer. When transformed into the T7

polymerase-expressing strain E. coli BL21 Star, plasmid pJUPI-2 conferred a good

bioluminescence. When transformed into the E.coli strain DH5α, a

bioluminescence of roughly the same intensity as seen in E. coli BL21* could be

detected although DH5α (unlike BL21*) does not encode a T7 polymerase. In case

of DH5α the lux operon was apparently efficiently expressed from any upstream E.

coli promoter (Fig. 6).

Fig. 6: Bioluminescence of lux-expressing E.coli

(pJUPI-2) on agar plate.

Left: BL21*(pJUPI-2) right: DH5α (pJUPI-2)

DH5α BL21*

25

Fig. 7: Construction of plasmids pJUPI-1 and pJUPI-2. Plasmid pJUPI-1 carries the lux operon

(luxCDABE) and confers resistance against ampicillin and tetracycline. The suicide vector pJUPI-2

derived from pJUPI-1 by deletion of its origin of replication and the tetracycline resistance cassette.

For details, see Material and Methods and Results.

pJUPI 17699 bp

luxC

luxD

luxA

luxB

luxE

attP

bla

Eco RI

Pst I

pLDR 119844 bp

origin cassette

attP

bla

tet

origin

luxC

luxD

luxA

luxB

luxEEco RI

Pst I

Not I

Not I

pXEN138801 bp

luxC

luxD

luxA

luxE

luxB

sense

rev

ampEco RI

Eco RIPst I

Pst IpLDR 114153 bp

origin cassettetet

bla attP

origin

Eco RIPst I

Not INot I 4.1 kb 8.7 kb

10.2 kb

7.2 kb

pLDR11 pXen-13

pJUPI-1

pJUPI-1pJUPI 17699 bp

luxC

luxD

luxA

luxB

luxE

attP

bla

Eco RI

Pst I

pLDR 119844 bp

origin cassette

attP

bla

tet

origin

luxC

luxD

luxA

luxB

luxEEco RI

Pst I

Not I

Not I

pXEN138801 bp

luxC

luxD

luxA

luxE

luxB

sense

rev

ampEco RI

Eco RIPst I

Pst IpLDR 114153 bp

origin cassettetet

bla attP

origin

Eco RIPst I

Not INot I 4.1 kb 8.7 kb

10.2 kb

7.2 kb

pLDR11 pXen-13

pJUPI-1

pJUPI-1pJUPI-2

T7

►

►

T7

26

10000 8000 6000 5000 4000 3500 3000 2500 2000

1500

1000

750

500

250

3.1.2 Integration of lux operon into the attB site of the S. Typhimurium SL1344 chromosome

For the integration of a constitutively expressed lux operon into the Salmonella

genome, via the λ attB system used by the temperature-sensitive helper plasmid

pLDR8 is needed which provides the λ int gene necessary for the integration

process. As pLDR8 carries a temperature-sensitive origin of replication,

transformed cells have to be cultivated at 30°C. Therefore, plasmid pLDR8 was

purified and subsequently transformed into electrocompetent S. Typhimurium

SL1344. To select the colonies containing pLDR8 a LB-agar plate containing the

selective antibiotic kanamycin was used at the permissive temperature of 30°C.

pJUPI-1 was digested by NotI resulting in two DNA fragments. The digestion

products were loaded onto a 1 % agarose gel for electrophoresis (Fig. 8). The 7.2

kb DNA-fragment was excised, purified and subsequently relegated. The resulting

suicide vector pJUPI-2 consisted of the luxCDABE operon followed by the attB site

but lacked an origin of replication (Fig. 7).

Fig. 8: Agarose gel electrophoresis.

Digestion of pJUPI-1 results in 2 DNA fragments.

The larger band used for further cloning is circled.

The pJUPI-2 construct was transformed into SL1344 (pLDR8). After

transformation bacteria were plated onto ampicillin-containing LB agar plates and

incubated overnight at 42°C. This ensures that only clones with a chromosomally

integrated lux construct could be recovered as both the suicide vector pJUPI-2 and

the helper plasmid pLDR8 had been segregated due to the non-permissive

27

temperature for pLDR8 and due to the lack of an appropriate origin of replication

on the circular lux-attB construct.

To confirm the correct integration at the attB site PCR and electrophoresis

analysis was used. Fig. 9 shows the schematic representation of the binding site

of primers in the genome of the wild-type strain as well as in the putative

luminescent mutant strain harbouring a chromosomally integrated lux operon. The

primer combinations used in the different PCR reactions are summarized in

Table 3.

As the orientation of the lux construct at the attB integration site is not predictable

i. e. it could have integrated in both directions, different combinations of the

flanking primers (8624 and 8625) with the lux-specific primers (8630 and 8631)

had to be used. As depicted on panel 1 of Fig. 10, the whole lux construct could be

amplified by using the two flanking primers. Obviously, no products were obtained

using the lux-specific primers on the wild-type chromosomal template. The actual

size of the PCR products obtained from the mutants C1 and C2 matched with the

expected size. Also the combinations of a flanking primer with an internal lux

primer led to the generation of PCR products when primer pairs 8624/8631 (panel

3) and 8625/8630 (panel 4) were used. Products with expected sizes of 1600 and

500 bp, respectively, could be detected as the main amplification products on the

agarose gel. The combination of 8624 with 8630 (panel 2), however failed to

amplify a major product, although due to not further optimized PCR conditions a

bundle of minor, unrelated PCR products were generated (panel 2). In the wild-

type strain the attB-flanking primers amplified an approximately 300bp product,

which corresponded to the calculated size.

28

10000 8000 6000 5000 4000 3500 3000 2500 2000

1500

1000

750

500

250

C1 C2 10000 8000 6000 5000 4000 3500 3000 2500 2000 1500

1000

750

500

250

C1 C1 C1 C1 C2 C2 C2 C2 wt wt wt wt wt

wt

mutant

attB

attB luxCDABE

8624

8625

8625 8630

8631

attB

8624

bla

Fig. 9: Primer beginning for the control PCR

Reaction 1 2 3 4 5

Primer 8624 8624 8624 8625 8625

Primer 8625 8630 8631 8630 8631

Table 3: PCR primer combinations for control of integration at the attB site.

Fig. 10: Analysis of orientation of integrated lux constructs. S. Typhimurium SL1344 wild-type (wt)

and two derivatives with integrated lux constructs (C1, C2) were analysed by PCR for the

orientation of integration at the attB site. Numbers above the panels correspond with reaction

numbers from Table 3.

1 2 3 4 5

29

3.1.3 Generation of S. Typhimurium SL1344 containing pXen-13

Besides the above described chromosomal mutant we also aimed to generate a

strain that encodes the luciferase operon on a multi-copy number plasmid.

Therefore, pXen-13 was also transformed to SL1344 cells. Colonies recovered on

Amp-agar plates were investigated for luminescence with IVIS 200 Xenogen. All

AmpR colonies emitted strong luminescent signals.

3.1.4 Comparison of in vitro growth

To see whether the insertion of the lux operon into the chromosome or the

carriage of pXen-13 has any influence on bacterial growth in vitro, cell growth

studies were performed. The wt strain SL1344 and the strain with the lux operon

integrated into the chromosome, showed no difference in growth (Fig. 11). On the

other hand, SL1344 (pXen-13) showed a slightly slower growth rate in vitro. This

slower growth was apparent both in the presence and absence of ampicillin,

indicating that this phenomenon was due to the replication of the high-copy

number plasmid carried.

Fig. 11: Growth curve from the different SL1344 constructs.

0,00,20,40,60,81,01,21,4

0 1 2 3 4 5 6 7 8 24

OD

600

nm

time [h]

SL1344 growth curve

SL1344

SL1344 (pXen-13)

SL1344 attB::lux

SL1344 (pXen-13) AMP

SL1344 attB::lux AMP

30

3.2 Virulence study

As stated in the project aims the major purpose of this study was to compare

bioluminescent Salmonella with respect to their signal intensity and stability in

vivo, i.e., for their applicability for in vivo luminescent imaging. To compare the

virulence from the modified strains, an animal model of Balb/c mice were used.

3.2.1 Animal experimental setup

Our study included groups of 5 mice each receiving the same oral dose of

Salmonella strains as summarized in Table 4.

Group No. of mice Infected with μl of inoculum

1 5 PBS (no bacteria) 200μl

2 5 SL1344 200μl (5x108 CFU/ml)

3 5 SL1344 attB::luxCDABE 200μl (5x108 CFU/ml)

4 5 SL1344 (pXen-13) 200μl (5x108 CFU/ml)

Table 4: Animal experimental setup.

Bacteria used for infection were cultured until mid-log phase of growth and were

washed and diluted to the required cell density of 5x108 CFU/ml. As expected the

inoculum consisting of SL1344 with the high copy-number plasmid pXen-13

emitted a much stronger luminescent signal than the construct with the

chromosomal integration (Fig. 12), although all inocula contained the same

amount of bacterial cells which was controlled by measuring the OD600 and also by

spreading serial dilutions onto LB agar plates and detecting the colony forming

units.

Fig. 12: Bioluminescence of Salmonella inocula used for the infection of mice, analyzed by IVIS 200 Xenogen. Signals of higher luminescence are visualized by yellow to red colors.

1. SL1344 wt (group 2) 2. SL1344 attB::luxCDABE (group 3) 3. SL1344(pXen-13) (group 4)

1 2 3

31

Following an oral infection by using a gavage, all mice were earmarked in order to

be able to follow individual mice throughout the study period. Mice were monitored

for bioluminescence by the IVIS 200 Xenogen System daily for 14 days.

3.2.2 Animal experimental outcome

At the beginning of day 6 mice orally infected with Salmonella begin to succumb,

whereas the control group of mice which only received PBS did not show any

mortality until the end of the experiment. The mortality of mice which received

genetically modified, luminescent Salmonella strains did not significantly differ

from mice infected with wild-type SL1344 (Fig. 13). Mantel-Cox test P-values were

found to be 0.6313 for SL1344 attB::luxCDABE and 0.1691 for SL1344(pXen-13)

when compared to wild-type SL1344.

The Salmonella strain with the chromosomally integrated lux operon displayed

almost the same virulence as the wild-type. The strain carrying the lux operon on

plasmid pXen-13 was slightly less virulent than the strain with the chromosomally

integrated lux construct.

Fig. 13: Survival curve of the mice.

0 3 6 9 12 15 18 210

50

100naivewild-typeattB::lux

pXen-13

days post challenge

Perc

ent s

urvi

val

Survival curve of the mice

[%]

32

Fig. 14A and B shows daily luminescent signals obtained from mice in groups 3

and 4, respectively. Mice infected by the Salmonella harbouring the chromosomal

lux construct showed no detectable bioluminescence signal until day 3 post-

infection. At later time-points strong localized signals were obtained from the gut,

liver and spleen (Fig. 14A). Shortly before death occurred, disseminated whole

body signals were detected, reflecting the septicaemia that most probably was

responsible for the death of the mice.

In contrast, mice receiving the plasmid-carrying luminescent strain emitted a clear

signal from the intestines at early time points post-infection (Fig. 14B), but

bioluminescence rapidly decreased and even disappeared although mice were still

dying from the Salmonella infection.

33

Fig.

13B

: Pic

ture

with

IVIS

200

Xen

ogen

from

gro

up 4

from

day

0 –

day

12

. The

sig

nal i

nten

sity

dec

reas

es d

ram

atic

ally

bec

ause

the

plas

mid

is

lost

.

Fig.

14A

: Dai

ly lu

min

esce

nt s

igna

ls o

btai

ned

from

mic

e in

gro

up 3

(SL1

344

attB

::lux

). P

ictu

res

wer

e ta

ken

with

IVIS

200

Xen

ogen

, fro

m d

ay 0

– d

ay 1

2.

The

high

est b

iolu

min

esce

nce

sign

als

wer

e se

en in

the

liver

and

the

sple

en.

34

Fig.

14B

: Dai

ly lu

min

esce

nt s

igna

ls o

btai

ned

from

mic

e in

gro

up 4

[SL1

344

(pXE

N-1

3)].

Pic

ture

s w

ere

take

n w

ith IV

IS 2

00 X

enog

en, f

rom

day

0 –

day

12.

Th

e si

gnal

inte

nsity

dec

reas

es d

ram

atic

ally

bec

ause

the

plas

mid

is

segr

egat

ed in

the

lack

of a

ntib

iotic

pre

ssur

e in

viv

o.

35

Fig. 15 shows the overall, whole mouse signal intensity few days before the mice

died. These signals correlated with the apparent levels of disease severity. The

luminescent signal intensity in the chromosomal mutant group (group 3) went up

few days before the mice died. Although mice in group 4 also showed the same

symptoms of disease and subsequently died, they did not produce increased

luminescent signal. This suggests that bacteria have lost pXen-13 due to the lack

of antibiotic pressure in vivo.

Fig. 15: Total - whole body – luminescent intensity of mice infected by various Salmonella strains

on 3 consecutive days prior death.

signal intensity on days before death

group 2

group 3

group 4

group 2

group 3

group 4

group 2

group 3

group 4

1.0×1008

1.0×1009

1.0×1010

1.0×1011

group 2

group 4group 3

Tota

l flu

x (p

hoto

n/se

c)

day 3 day 2 day 1

days before death

36

4 DISCUSSION

In vivo bioluminescent imaging is a good sensitive and non-invasive method to

study the disease course of bacterial infections. This method is able to reduce the

number of animals as well as time and costs. Furthermore, bioluminescent

imaging allows the same group of individual mice to be monitored over time and

so animal-to-animal variations could be compared. This technique has the

potential to increase the quality of animal experimental data in order to provide

more information for selecting new vaccine or drug candidates (FRANCIS et al.,

2000; HUTCHENS and LUKER, 2007).

For in vivo imaging bacteria emitting strong constitutive and stable luminescent

signals are needed. Moreover, virulence of these genetically modified variants

should not substantially differ from their parental wild-type strain. The easiest

solution is to supplement wild-type pathogens with a plasmid encoding both the

substrate and the enzyme required for the luminescence (FRANCIS et al, 2001).

Another example is to integrate these constructs on the chromosome by using

transposons (FRANCIS et al, 2001). In case of such non-targeted transposition,

the site of integration is unknown. Genes important for virulence may be disrupted

and the promoter from which the lux operon is expressed remains unknown.

In frame of this work, we constructed a plasmid carrying the lux operon for in vivo

bioluminescent imaging. With help of this plasmid integration of the lux operon into

the λ attachment site attB of the S. Typhimurium chromosome was achieved. Our

assumption was that this site-specific integration would not alter virulence as the

attB site is located not within any known open reading frames (ORFs). In fact,

virulence was shown not to be affected.

We hypothesised that integration of the lux operon into the chromosome would be

superior to providing the operon on a plasmid with respect to stability. Indeed, we

found that in the absence of antibiotics in vivo the plasmid-based bioluminescence

was disappearing over time, whereas the mutant strain with the chromosomally

integrated lux cassette emitted strong and stable signals throughout the study

period. On the other hand, the signal intensity from the attB::lux is weaker at the

beginning but increases during the infection period.

37

A reason for this might be that the plasmid was lost due to the absence of any

selective antibiotic pressure. A supporting finding was that at the end of

experiment only ampicillin-sensitive Salmonella could be recovered from stool

samples of mice infected with SL1344(pXEN-13) (data not shown). However, in

the stool samples of mice infected with SL1344::pJUPI-2 the ampicillin resistance

was still present.

SL1344 (pXen-13) also showed a slightly slower growth rate in vitro. This slower

growth was apparent both, in the presence and absence of ampicillin, indicating

that this phenomenon was due to the replication of the high-copy number plasmid

carried. Also, we could identify a slightly lower infectious potential for the plasmid

carrying strain, although this attenuation was not statistically significant. This

phenomenon might also be caused by the slower growth rate of this strain.

Altogether, we have shown that the integration of the lux operon at the genomic

attB site is a better way of producing bioluminescent strains than to subclone the

lux operon on a multicopy plasmid. The integration without disruption of other

genes and the stability of integrants is a very important fact for long term studies.

So, for the future this approach seems to be the best possibility for in vivo imaging.

38

5 Summary

Salmonella enterica serovar Typhimurium is a widespread pathogen which causes

a typhoid-like disease in a mouse model. To follow the infectious course in the

mouse, in vivo bioluminescent imaging was applied. For this a plasmid carrying

the lux operon (luxCDABE), encoding the luminescent signal (pXen-13), was

transformed into the S. Typhimurium strain SL1344. Alternatively, the lux operon

has been integrated at the λ phage attachment site in the chromosome.

In the mouse model of typhoid the virulence of these genetically modified

luminescent bacteria was compared to that of the wild-type strain. In the same

model, the infectious process was monitored by in vivo detection of the

luminescent signal over the period of 2 weeks. The disease course could be

followed in the same individual animal over this period. The luminescence

between the plasmid containing strain and the strain with the lux operon

integration into the chromosome showed a remarkable difference in the daily

signal intensity. The chromosomal construct showed no detectable signal until day

3 post-infection. In contrast, mice receiving the plasmid encoded luminescent

strain emitted a clear signal at early timepoints, but rapidly lost detectable levels.

On the other hand, signal intensities in the chromosomal construct increased few

days prior death and correlated well with the severity of disease.

This example of in vivo bioluminescent imaging of mice infected with luminescent

Salmonella enterica serovar Typhimurium shows the possibility to generally

monitor bacterial infections in vivo. It is a sensitive, non-invasive method and

therefore also reduces the number of lab animals required for in vivo experiments

compared to conventional methods.

39

6 Zusammenfassung

Salmonella enterica serovar Typhimurium ist ein weit verbreiteter bakterieller

Krankheitserreger, welcher im Mausmodell eine typhusartige Erkrankung

hervorruft. Um den Infektionsverlauf in der Maus verfolgen zu können, wurde ein

bildgebendes Verfahren angewandt, das auf in vivo Biolumineszenz beruht. Zu

diesem Zwecke wurde ein Plasmid mit dem lux Operon (luxCDABE), welches die

für die Biolumineszenz notwendigen Proteine kodiert, in den S. Typhimurium

Stamm SL1344 transformiert. In einem Alternativansatz wurde das lux Operon in

die λ-Phagenintegrationsstelle des bakteriellen Chromosoms integriert.

Im Typhus-Mausmodell wurde die Virulenz der rekombinanten Salmonellastämme

mit dem Wildtypstamm verglichen und ebenso der Infektionsverlauf mittels in vivo

Detektion der Biolumineszenzsignale über zwei Wochen lang verfolgt. Der

Krankheitsverlauf konnte für das jeweilige Tier über die gesamte Zeitspanne

verfolgt werden.

Die Biolumineszenz zwischen dem plasmidtragenden Stamm und dem Stamm,

der das lux-Operon im Chromosom integriert hat, wies deutliche Unterschiede auf.

Das chromosomale Konstrukt zeigte keine detektierbaren Signale bis zum dritten

Tag nach der Infektion. Mit fortschreitender Infektion nahm die Signalintensität zu

und korrelierte mit dem Schweregrad der Krankheit. Im Gegensatz dazu

emittierten die Mäuse, welche Salmonellen mit plasmid-basierter Biolumineszenz

erhielten, am Anfang ein deutliches Signal, das jedoch im weiteren Verlauf rapide

abnahm.

Dieses Beispiel des "in vivo Biolumineszenz"-Imaging einer Salmonelleninfektion

von Mäusen über einen Zeitraum von 2 Wochen mit täglicher Protokollierung des

individuellen Infektionsverlaufs zeigt generell die Möglichkeit auf, bakterielle

Infektionen künftig in vivo verfolgen zu können.

Dieses Verfahren ist sensitiv, zudem nicht invasiv und reduziert damit auch die

Anzahl der Versuchstiere, welche für in vivo Experimente benötigt wären im

Vergleich zu konventionellen Methoden.

40

7 REFERENCES

ANDRADE de D. R. and ANDRADE jr. de D. R. (2003): Typhoid fever as cellular

microbiological model. Rev. Inst. Med. trop. S. Paulo 45(4):185-191.

BARTHEL M., HAPFELMEIER S., QUINTANILLA-MARTÌNEZ L., KREMER M., ROHDE M., HOGARDT M., PFEFFER K., RÜSSMANN H. and HARDT W. D. (2003): Pretreatment of mice with streptomycin provides a Salmonella enterica

serovar Typhimurium colitis model that allows analysis of both pathogen and host.

Infection and Immunity 71, (5):2839-2858.

BOYEN F., HAESEBROUCK F., MAES D., Van IMMERSEEL F., DUCATELLE R. and PASMANS F. (2008): Non-typhoidal Salmonella infections in pigs: A closer

look at epidemiology, pathogenesis and control. Veterinary Microbiology 130 (1-

2):1-19.

BRUSCH J. L. and GARVEY T. (2009): Typhoid Fever.

http://emedicine.medscape.com/article/231135-overview 1-31.

BURNS-GUYDISH S. M., OLOMU I. N., ZHAO H., WONG R. J., STEVENSON D. K. and CONTAG S. H. (2005): Monitoring age-related susceptibility of young mice

to oral Salmonella enterica Serovar Typhimurium infection using an in vivo murine

model. Pediatric Research 58, (1):153-158.

CHAN K., BAKER S., KIM C. C., DETWEILER C. S., DOUGAN G. and FALKOW S. (2003): Genomic comparison of Salmonella enterica serovars and Salmonella

bongori by use of an S. enterica serovar Typhimurium DNA microarray. Journal of

Bacteriology 185(2):553-63.

DARWIN K. H. and MILLER V. L. (1999): Molecular basis of the interaction of

Salmonella with the intestinal mucosa. Clinical Microbiology Reviews 12, (3):405-

428.

41

DIEDERICH L., RASMUSSEN L. J. and MESSER W. (1992): New cloning

vectors for integration into the λ Attachment site attB of the Escherichia coli

chromosome. Plasmid 28:14-24.

DOYLE T. C., BURNS S. M. and CONTAG C. H. (2004): In vivo bioluminescence

imaging for integrated studies of infection. Cellular Microbiology 6(4):303-317.

FINLAY B. B. and BRUMELL J. H. (2000): Salmonella interactions with host

cells: in vitro to in vivo. Phil. Trans. R. Soc. Lond. B 355:623-631.

FRACKMAN S., ANHALT M. and NEALSON K. H. (1990): Cloning, organization

and expression of the bioluminescence genes of Xenorhabdus luminescens. J.

Bacteriol. 172 (10):5767-5773.

FRANCIS K. P., JOH D., BELLINGER-KAWAHARA C., HAWKINSON M. J., PURCHIO T. F. and CONTAG P. R. (2000): Monitoring Bioluminescent

Staphylococcus aureus Infections in Living Mice Using a Novel luxABCDE

Construct. Infection and Immunity 68 (6):3594-3600.

FRANCIS K. P., YU J., BELLINGER-KAWAHARA C., JOH D., HAWKINSON M. J., XIAO G., PURCHIO T. F., CAPARON M. G., LIPSITCH M. and CONTAG P. R. (2001): Visualizing Pneumococcal Infection in the Lungs of Live Mice Using

Bioluminescent Streptococcus pneumoniae Transformed with a Novel Gram-

Positive lux Transposon. Infection and Immunity 69 (5):3350-3358.

GIANNELLA R. A. (1996): Salmonella. Medical Microbiology 4 (21):

http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=mmed&part=A1221

The University of Texas Medical Branch at Galveston.

GORON M. A. and GRAHAM S. M. (2008): Invasive salmonellosis in Malawi. J

Infect Developing Countries 2(6):438-442.

GRASSL G. A. and FINLAY B. B. (2008): Pathogenesis of enteric Salmonella

infections. Current Opinion in Gastroenterology 24:22-26.

42

GREER III L. F. and SZALAY A. A. (2002): Imaging of light emission from the

expression of luciferases in living cells and organisms: a review. Luminescence

17:43-47.

GUPTA R. K., PATTERSON S. S., RIPP S., SIMPSON M. L. and SAYLER G. S. (2003): Expression of the Photorhabdus luminescens lux genes (luxA, B, C, D and

E) in Saccharomyces cerevisiae. FEMS Yeast Research 4:305-313.

HAMID N. and JAIN S.K. (2007): Immunological, Cellular and Molecular Events in

Typhoid Fever. Indian Journal of Biochemistry and Biophysics 44:320-330.

HOUSE D., BISHOP A., PARRY C., DOUGAN G. and WAIN J. (2001): Typhoid

fever: pathogenesis and disease. Current Opinion in Infectious Diseases 14:573-

578.

HUTCHENS M. and LUKER G. D. (2007): Applications of bioluminescence

imaging to the study of infectious diseases. Cellular Microbiology 9(10):2315-2322.

IBARRA J. A. and STEELE-MORTIMER O. (2009): Salmonella – the ultimate

insider. Salmonella virulence factors that modulate intracellular survival. Cellular

Microbiology 11 (11):1579-1586.

LAN R., REEVES P. R. and OCTAVIA S. (2009): Population structure, origins

and evolution of major Salmonella enterica clones. Infection, Genetics and

Evolution 9:996 – 1005.

MEIGHEN E. A. (1991): Molecular Biology of Bacterial Bioluminescence.

Microbiological Reviews 55 (1):123-142.

MEIGHEN E. A. (1993): Bacterial bioluminescence: organization, regulation, and

application of the lux genes. The FASEB Journal 7:1016-1022.

43

METCALF E. S., ALMOND G. W., ROUTH P. A., HORTON J. R., DILLMAN R. C. and ORNDORFF P. E. (2000): Experimental Salmonella typhi infection in the

domestic pig, Sus scrofa domestica. Microbial Pathogenesis 29 (2):121-126.

OHL M. E. and MILLER S. I. (2001): Salmonella: A Model for Bacterial

Pathogenesis. Annual Reviews Med. 52:259-274.

PORWOLLIK S., BOYD E. F., CHOY C., CHENG P., FLOREA L., PROCTOR E. and McCLELLAND M. (2004): Characterization of Salmonella enterica

Subspecies I Genovars by Use of Microarrays. Journal of Bacteriology

186(17):5883-5898.

RAFFATELLU M., WILSON R. P., WINTER S. E. and BÄUMLER A. J. (2008): Clinical pathogenesis of typhoid fever. J. Infect Developing Countries 2(4):260-

266.

ROCCHETTA H. L., BOY LANC. J., FOLEY J. W., IVERSEN P. W., LETOURNEAU D. L., Mc MILLIAN C. L., CONTAG P. R., JENKINS D. E. and PARR jr. T. R. (2001): Validation of a noninvasive, real-time imaging technology

using bioluminescent E. coli in the neutropenic mouse thigh model of infection.

Antimicrobial agents and chemotherapy 45 (1):129-137.

SANTOS R. L., ZHANG S., TSOLIS R. M., KINGSLEY R. A., ADAMS L. G. and BÄUMLER A. J. (2001): Animal models of Salmonella infections: enteritis versus

typhoid fever. Microbes and Infection 3:1335-1344.

SANTOS R. L., TSOLIS R. M., BÄUMLER A. J. and ADAMS L. G. (2003): Pathogenesis of Salmonella-induced enteritis. Brazilian Journal of Medical and

Biological Research 36:3-12.

SATO A., KLAUNBERG B. and TOLWANI R. (2004): In Vivo Bioluminescence

Imaging. Comparative Medicine 54 (6):631-634.

44

SU L.-H. and CHIU C.-H. (2007): Salmonella: clinical importance and evolution of

nomenclature. Chang Gung Med J. 30(3):210-9.

TSOLIS R. M., KINGSLEY R. A., TOWNSEND S. M., FICHT T. A. ADAMS L. G. and BÄUMLER A. J. (1999): Of mice, calves, and men. Comparison of the mouse

typhoid model with other Salmonella infections. Adv. Exp. Med. Biol. 473:261-74.

WALLIS T. S. and GALYOV E. E. (2000): Molecular basis of Salmonella-induced

enteritis. Molecular Microbiology 36(5):997-1005.

ZHANG S., KINGSLEY R. A., SANTOS R. L., ANDREWS-POLYMENIS H., RAFFATELLU M., FIGUEIREDO J., NUNES J., TSOLIS R. M., ADAMS L. G. and BÄUMLER A. J. (2003): Molecular Pathogenesis of Salmonella enterica

Serotype Typhimurium-Induced Diarrhea. Infection and Immunity 71 (1):1-12.

ZHANG X., KELLY S. M., BOLLEN W. S. and CURTISS R., 3rd (1997): Characterization and immunogenicity of Salmonella typhimurium SL1344 and UK-

1 delta crp and delta cdt deletion mutants. Infection and Immunity 65(12):5381–

5387.

ZINN K. R., CHAUDHURI T. T., ADAMS SZAFRAN A., O’QUINN D., WEAVER C., DUGGER K., LAMAR D., KESTERSON R. A., WANG X. and FRANK S. J. (2008): Noninvasive Bioluminescense Imaging in Small Animals. ILAR J.

49(1):103-115.

45

8 ABBREVIATIONS

BLI bioluminescent imaging

bp base pair(s) of DNA

CCD charge-coupled device

ddH2O double distilled water

DNA deoxyribonucleic acid

dNTP deoxynucleotide triphosphate

EDTA ethylenediaminetetraacetic acid

g relative centrifugal force

EtOH ethanol

GI-tract gastrointestinal tract

HIV Human Immunodeficiency Virus

IVC individual ventilated cages

IVIS In Vivo Imaging System

kb kilobase(s) of DNA

kDa kilo Dalton(s)

LB Luria Bertani

M cells microfold cells of the Peyer's patches

NaAc Sodiumacetate

NTS non-typhoid salmonellae

ORFs open reading frames

PBS phosphate buffered saline

PCR polymerase chain reaction

ROI region of interest

spf specific pathogen-free

SPI Salmonella Pathogenicity Island

sv serovar

TAE Tris-Acetate-EDTA solution

UV ultra-violet light

46

9 APPENDIX

9.1 Code for earmarks

47

9.2 Experimental scheme

Exp.

N°:

oper

ator

:La

b bo

ok N

°:pa

ge:

bind

er:

stra

in:

sex:

room

:so

urce

of d

eliv

ery:

date

of d

eliv

ery:

mic

e (to

tal):

mic

e/gr

oup:

TV:

grou

pN

°an

tigen

amou

nt /

mou

seco

-infe

ctio

nam

ount

tissu

edo

ne b

y

page

offin

al s

igna

ture

:da

te:

date

:si

gnat

ure:

com

men

ts:

inje

ctio

n vo

lum

e / m

ouse

:μl

anal

ysis

day

xin

ject

ion

site

buffe

r

expe

rimen

tal s

chem

e

date

amou

nt /

mou

sead

juva

ntde

aths

(day

)

48

10 ACKNOWLEDGEMENTS First, I would like to thank the company Intercell AG for giving me the opportunity

to learn and to work at the company.

I would also like to thank MD PhD Eszter Nagy to learn and work in the research

department.

I express my special gratitude to Benjamin Wizel, PhD head of MAT and IDM to

learn and work in his group and for his special efforts.

Special thanks are also given to MD PhD Gabor Nagy, for supervising and

mentoring my work. Also, for spending a lot of time for discussions and for always

finding the time to listen, even to little problems. His encouragement and help

made me feel confident and motivated me to overcome every difficulty and to try it

over and over again.

I thank all members of the research groups which I worked with, for the good

atmosphere and their friendly acceptance and the help with all my questions. I

enjoyed the time with each of you.

Furthermore I would like to thank O. Univ. Prof. Dr. rer.nat. Dr. med.vet.habil.

Renate Rosengarten for the expertise.

I owe thanks to Dr. Michael Szostak, for supporting and supervising my work.

Also, for spending a lot of time for discussions and controlling my work.

I am greatly thankful to my colleagues at Intercell Andrea, Ingmar, Kira and Zehra,

for sharing their technical expertise with me and for scientific discussions.

A special thanks goes to my boyfriend. He always stands to me and helped me

with encouraging words and understanding during the study and the work for this

thesis.

Werner, I thank you from the bottom of my heart.

49

Last but not least, I would like to thank my parents, Veronika and Werner, for the

financial and emotional support since my birth. Thank you for the endless

(telephone) conversations, despite your own occupation, and all the cheering

words. Your faith and love gave me the necessary support. And also a special

thank to my brother Peter.

I would like to thank everyone who supported me in writing this thesis and during

my study.