DEEPFISHMAN 227390 Deliverable D8 - Ifremer

1

DEEPFISHMAN Management And Monitoring Of Deep-sea Fisheries And Stocks

Project number: 227390

Small or medium scale focused research action

Topic: FP7-KBBE-2008-1-4-02 (Deepsea fisheries management)

DELIVERABLE D8.5

Title: Stakeholder Workshop Due date of deliverable: M2 (May 2009) Actual attending date of the workshop: M3 (29 and 30 june 2009, in Brussels) Start date of the project: April 1st, 2009 Duration : 36 months

Organisation Name of lead coordinator: Ifremer Dissemination Level: PU Public Date: July 31th, 2009

2

The first stakeholder workshop scheduled in DEEPFISHMAN was held on 29-30 June 2009 at CLORA, 8 rue des Arts, Brussels (Workshop timetable in annex 1 ). The organization of the workshop was discussed during the kick-off meeting (12-14 May 2009, Nantes). Where it was decided to have the workshop led by a facilitator. The workshop was announced by email. Invitations (model in annex 2 ) were circulated by project partners at Case Study level, through the RACS and other lists of stakeholders. The workshop was attended by 14 people (attendees list in annex 3 : project partners, scientists, scientists outside of the project, RMFO, ICES, EC, fishing sector, Government representative).

The workshop was designed to provide:

An opportunity for stakeholders to meet DEEPFISHMAN project partners, • Presentations and discussions of key aspects of the three-year project, and • a stakeholder analysis to underpin DEEPFISHMAN's engagement and

communication strategies.

A number of participatory sessions made it possible to: 1. Identify the stakeholder community 2. Discuss the strengths and weaknesses of current management regimes and

fisheries assessments methodologies 3. Identify channels and details of stakeholder engagement, and 4. Devise a Communication Strategy for the project.

All the presentations are joint in annex 4 . The consensus report from Stakeholders workshop (deliverable 8.6 due on M4 July 2009) will be made available on the DEEPFISHMAN website (http://www.ifremer.fr/deepfishman), disseminated to workshop participants, deepfishman partners, invited stakeholders and further distributions will be requested to RACs and other stakeholders.

3

Annex 1: Workshop timetable (actual).

Monday 29 June 2009 Tuesday 30 June 2009

09:00

c. Assessment + reference points and discussions

5. SW Current Stock Assessment

10:00 Registration 10:00

5. SW Current Stock Assessment

a. DEEPFISHMAN presentation

Workshop and Day 1 intro 5. OT Stock Assessment

11:00 11:00

1. Stakeholder identification

5. OT Stock Assessment

Coffee / tea break Coffee / tea break

d. Available data – Biology, ecology,

ecosystem

12:00

2. Stakeholders essential to the project

12:00 e. Available data – economic and social

3. Stakeholder interested in the project

6. Brainstorm Future Management regimes

Report back and data needs

13:00 13:00

Lunch

Lunch

14:00 b. Current Management regimes 14:00 f. Future Management regimes

4. SWOT Management regimes

6. Brainstorm Future Management regimes

g. Suggestions and industry data

15:00 Identification

15:00 6. Brainstorm Future Management

regimes

Coffee / tea break 7. Stakeholders & Project communication

Wrap up Workshop

4. SWOT Management regimes

16:00

16:30

Discussions and report back

Wrap up Day 1

4

Annex 2: invitation send by e-mail on June 7 th, 2009.

Deepwater fisheries pose particular difficulties for management. Target species are difficult to assess and they are generally vulnerable to overfishing. The EU project DEEPFISHMAN will develop a range of strategy options for the management of deepwater fisheries in the NE Atlantic that will take account of these factors. Firstly, the aim will be to identify new and more effective assessment methods, reference points, control rules and management strategies to be used in the short term, making better use of available data. Secondly, a reliable long-term framework will be developed for which additional data needs will be specified in order to fill current information gaps to achieve reliable long-term management requirements. This work will be developed by examining a range of case studies selected to reflect the diverse characteristics of the different types of deepwater fishery. The socio-economic profile and projected impact of the management strategy options will be examined. The project outputs will aim to provide robust guidelines for deepwater fisheries management suitable for adoption within the Common Fishery policy. The workshop will provide short descriptions of the three-year project tasks and partners. A number of participatory sessions will:

1. Define the stakeholder community 2. Discuss Strengths and Weaknesses of current managem ent and monitoring

regimes 3. Identify channels and details of stakeholder engage ment 4. Finalise the project Communication Strategy to maxi mise stakeholder

engagement

CLORA- 8 avenue des Arts, 1210 Métro Madou Monday 29 June 10am - 4:30pm, Tuesday 30 June 9am – 4pm

Free Registration before 26 June: [email protected]

Management and Monitoring of deep-sea Fisheries and Stocks

Stakeholder Workshop 29 and 30 June 2009

5

Annex 3: List of attendees of the Stakeholders Work shop 29-30 June, 2009.

N°

Name Organisation 29 june 2009

30 june 2009

1 Marina Santurtun AZTI-tecnalia [email protected]

X X

2 Carl O'Brien

Cefas ICES ACOM Vice-chair [email protected]

X X

3 Joao Neves NEAFC [email protected]

X X

4 Philippe Moguedet CE DG-RESEARCH [email protected]

X X

5 Pascal Lorance Ifremer [email protected]

X X

6 Phil Large Cefas [email protected]

X X

7 Charlotte Jagot CLORA [email protected]

X

8 Gunnar Haraldsson

University of Iceland [email protected]

X X

9 Marc Ghiglia Europêche [email protected]

X X

10 Adrija Gasiliauskiene

Lithuania Permt. Representation to EU [email protected]

X

11 Frank Evrat RAC SWW – PROMA-PMA [email protected]

X X

12 Tom Blasdale JNCC – ICES WGDEEP chair [email protected]

X X

13 Pascal Legrand DG-Research [email protected]

X

14 Sophie des Clers Facilitator [email protected] X X

6

Annex 4: Presentations of the workshop.

� Presentation 1: Presentation of the objectives and organisation of the workshop, by Sophie des Clers , independent consultant and honorary teaching fellow, at University College London (UK). � Presentation 2: Presentation of the aim and issues of the project DEEPFISHMAN, and of the work with the stakeholders, by Pascal Lorance , Ifremer (FR), coordinator of DEEPFISHMAN. � Presentation 3: Presentation of stock assessment and Biological Reference Points : problems and methods, and progress and objectives achieved in the project DEEPFISHMAN (in the work packages WP4 and WP5), By Phil Large , CEFAS (UK).

� Presentation 4: Presentation of the Management Strategies in relation to Deep Sea Stocks and the Management Strategy Evaluation as a potential tool, by Marina Santurtún, Guzmán Diez & Dorleta Garcia , AZTI-TECHNALIA (ES) � Presentation 5: Presentation of the data avaibility, By Pascal Lorance .

� Presentation 6: Presentation of socio-economic aspects and data avaibility, By Gunnar Haraldsson , UoI (IS).

7

Presentation 1: ---

Presentation of the objectives and organisation of the workshop -

by Sophie des Clers , independent consultant and honorary teaching fellow,

at University College London (UK).

8

Diapositive 1 Deepfishman

Stakeholder Workshop

Sophie des Clers

Independent consultant

and honorary teaching fellow, Department of Geograhy, University College London

Fisheries Geography (people and ecosystems)

Diapositive 2

Two sets of Goals: (1) Deepfishman

� Identify new and more effective assessment methods, reference points, control rules and management strategies making better use of available data in the short-term;

� Develop a management framework with additional data for the long-term

=> Provide more robust guidelines for deepwater fisheries management suitable for CFP adoption

Diapositive 3

Strategy options for the management of NE Atlantic deepwater fisheries

(2) Workshop main aims

� Learn about project and about stakeholders

� Identify stakeholders, priorities, strengths, networks

� SWOT current resource management and assessment

� Recommendations for stakeholder involvement over the duration of Deepfishman

9

Diapositive 4

Workshop organisation

Mix of presentations from project partners and facilitated working sessions

� Day 1 am: Stakeholders

pm: Resource Management & Assessment SWOT

� Day 2 am: Stakeholder input &

pm: communication plan

Diapositive 5

The importance of stakeholders to Freshwater

and Coastal Scientists

Sophie des Clers [email protected] October 2008

Diapositive 6 Policy Transparency Key to

Saving World’s Fisheries June

2009Newswise - A new study provides the first global evaluation of how management practices influence fisheries’sustainability. The study assessed the effectiveness of the world’s fisheries management regimes using evaluations by nearly 1,200 fisheries experts and analyzing these in combination with data on the sustainability of fisheries catches. The results indicated that most fisheries management regimes are lagging far behind standards set by international organizations, and that the conversion of scientific advice into policy, through a participatory and transparent process, plays the most critical role in determining the sustainability of fisheries. (Morina PLoS)

10

Diapositive 7

Steps of stakeholder analysis

1. Individual lists of stakeholders and their interests Consolidated group lists

2. Stakeholder networks

3. Ranking Stakeholder interests and priorities

For ranking use: -- - 0 + ++

Diapositive 8

Stakeholders

� Any individual, groups or institutions, to whom Deepfishman can be of interest (positively or negatively affected)

and

� from whom Deepfishman can receive

Diapositive 9 1. Deepfishman Stakeholders

who are they?

• Individually, list on a piece of paper:

• 10 stakeholders, and for each its main interest(s) in the project 10 minutes

10

to

1

Main interest(s)Stakeholder

11


who are they?Groups

• Consolidate lists on paper charts provided, if several interests: one per YELLOW post-it -numbered with most important first10 mins.

.

B

A

Main interest(s)Stakeholders


who are they?

• Groups report back and discuss group lists 10 mns.

=>Master list for Communication Plan


needs and priorities

Groups: Use 1/3 of the consolidated list

• For each stakeholder in list, define

needs/interests with priority/importance 15 mins

• Report back 15 mins

Use 1 YELLOW post-it per need/interest and to indicate priority/importance use -, -- (0) +, ++

=> Part of Participation matrix

12


type, scale and networks

Groups: Use 1/3 of the consolidated list

• For each stakeholder in list, define on post-its

• type (public, private, individual, assoc., govt, …) GREEN

• Scale (international, European, national, sub-nat, local), ORANGE and

• Links to other (list pairs) PINK 20 mins

• Report back

• post-its on flip-charts 15 mins

Diapositive 14

SWOT analysis

Strengths

Weaknesses Threats

Opportunities

Internal factors External factors

Strategicplanning

Diapositive 15

SWOT

From presentation of main characteristics

Groups:

• S and W for each aspects 10 mins

• T and O 10 mins

• Report back and discuss 10 mins

13

Diapositive 16

Brainstorm - end day 1Data problems defined in presentations - to sum up

• Individuals

• Suggest ideas to overcome data problem 10 mins

• Groups:

• Prioritize and select, and for each idea that floats, define on A4 sheet

• advantages and disadvantages (no discussion)

• Critical concerns (what needed to make it possible)

• Implementation / Action plan 20 mins

Diapositive 17

Participation Matrix

Diapositive 18

Workshop outputs

� Stakeholder analysis

� Questionnaire to survey other stakeholders

� Workshop report

� Content of December 2009 Newsletter

� Other suggestions?

14

Presentation 2: ---

Presentation of the aim and issues of the project D EEPFISHMAN, and of the work with the stakeholders

- by Pascal Lorance ,

Ifremer (FR), coordinator of DEEPFISHMAN

15

Diapositive 1

DEEPFISHMAN Stakeholder workshop Brussels, 29-30 June 2009

DEEPFISHMANStakeholder worskshop

Brussels

29-30 June 2009

http://www.ifremer.fr/deepfishman

Diapositive 2


DEEPFISHMAN general aim

• Develop strategy options for the management of deepwater fisheries in the NE Atlantic– Appropriate/new

• Stock assessment methods• Biological reference points (BRPs)• Harvest Control rules (HCRs)• Managements strategies

– Account of • Stock sensitivity • Biodiversity/ecosystem and VMEs sustainability and conservation

– Specify additional monitoring data requirements • (e.g.) lack of scientific cruises, economics data missing in some

fisheries, poor knowledge of high resolution spatial distribution of fishing effort

Deep-water stock have proven difficult to assess so far due to (1) limitation of data; (3) lacking basic biological parameters, stock distribution, migrations Current management does not integrate stock and ecosystem aspect (deepwater fishing is known to impact sensitive benthic communities such as CWC and sponges). Some rare non commercial species may be more sensitive to fishing than target stock (no current assessement nor management framework to take account of this)

Diapositive 3


Current situation: assessment• Exploratory/unreliable in most CSs

• Existing data no all available to assessment groups (e.g. ICES/WGDEEP)

• No protocole to integrate some data (e.g. on-board observations)

16

Diapositive 4


Current situation: management(EU only)

• Main management tool= TACs

• Effort limitation (ceiling on total effort/ member country licensing scheme)

• Existing technical measures: e.g. spatial and seasonal closures for blue ling

• Ecosystem/biodiversity assessment: not integrated with stock assessment

– Some MPAs designed for VMEs conservations

Licensing scheme but no protocole for adjusting fleet capacity and/or effort to TACs levels

Diapositive 5


What should be achived in 2012• Reliable assessments and/or indicator based

management• Biological reference Points (BRPs)• Harvest Control Rules (HCRs)• Monitoring framework • Requirements for progress towards

– objectives of WSSD (e.g. MSY estimated data or requirements)

– (For EU) MSFD• initial ecosystem assessment• indicators relevant to the 11 ecosystem descriptors of

MSFDIntegrated in a long-term management strategy framework

Monitoring framework (which data should be collected and how)

Diapositive 6


THE SELECTED CASE STUDIES COLLATE DATA & PROVIDE IN PUTS FOR THE SELECTED CASE STUDIES COLLATE DATA & PROVIDE IN PUTS FOR WPsWPs

WP7: Management strategy framework Integrates Overall Project ImpactsIntegrates Overall Project ImpactsLeaderAZTI

WP6

Trends inbiodiversity

LeaderIFREMER

WP2Review of

existingManagement& monitoring approaches

LeaderCEFAS

WP5Reference

Points

& HCRs

LeaderImp. College

WP4Dev. of

appropriate Assessm. Methodol.

LeaderImp. College.

WP3Socio-

economic study

LeaderUoI

WP8: Dissemination & OutreachLeader MRI

How the project is organised

Case study are essential to he start of the project, then we must organise the right interaction between CSs and WPs.

17

Diapositive 7


Deepfishman builds on 5 case studies (at least 9 fisheries)• range of situations in EU waters• some case studies out of EU waters (Namibia, NAFO, Iceland, Norway, NEAFC regulatory area)• several are data poor two data rich Case study are included

Case study 1: Single species fisheries:Highly sensitive(*) species

1a: Orange roughy in Namibia

1b: Orange roughy in ICES sub-areas VI and VII

Less sensitive(*) species

1c: Blue ling in ICES Division Vb and sub-areas VI-VII

sensitive = easy to overexploit

Contacts:

Rudy Cloete, NatMIRC, Namibia ([email protected])

Leonie Dransfeld, Marine Institute, Ireland ([email protected] )

Phil Large, Cefas, UK ([email protected])

Diapositive 8


Case study 2: Multi species fisheryFrench trawl fishery to the west of the British Isles

Main target species:

roundnose grenadier

blackscabbard fish

used to exploit significantly deep-water shark (low TAC in 2009; 0 TAC in 2010)

Link with CS2c: single species fishery for blue ling

due to evolution over time of fishing activitiesContact: Pascal Lorance, Ifremer, Nantes, F ([email protected])

Diapositive 9


Case study 3: artisanal fisheries3a: Red seabream in the Gulf of Cadix (handlines andlonglines) and Bay of Biscay (depleted stock)

3b: Red seabream in the Mediterranean sea (handlines, longlines and nets)

3c: Black scabbard fish of Portugal (longlines)

Contacts:Chrissi-Yianna Politou, HCMR ([email protected])Juan Gil, IEO, Cadix, ES ([email protected])Pascal Lorance, Ifremer, Nantes, FR ([email protected])Ivone Figueiredo, IPIMAR, Lisbon, PT ([email protected])

18

Diapositive 10


Case study 4: redfish (Sebastes mentella) in the NE AtlanticFishery:

- well documented bottom trawling on Norwegian shelf

- data poor pelagic trawling

- an unclear complex (?)

- no quantitative assessment

Contact: Benjamin Planque, IMR, Troms, NO [email protected]

Diapositive 11


Case study 5: Greenland halibut in NAFO area• Fishing grounds: Between 600-1300 m. Depth

• Catch levels: 22.000 – 25.000 ton• Countries: Spain, Portugal, Canada, Russia, etc• Fleet: around 60 vessels• Gear: Bottom trawl • Last assessment:

•XSA Model

•Explo. Biomass = 86.000 tons•Fbar (5-10) = 0.432

Contact: Fernando Gonzales, IEO, Vigo, ES [email protected]

Diapositive 12


SC5Data rich

Greenland halibutNAFO

CS4Data richRedfish

CS3Artisanal fisheries

CS 2Multi

species

fishery

CS 1Directed single

species fisheries

ReviewsData

Preliminary reportCase study workshop

Case study reports (April 2010)

19

Diapositive 13


Work with stakeholders

- analyse how deep-water fisheries can be assessed/managed

- discuss the project plan

- analyse where stakeholder can contribute with data

- define the involvement of stakeholders in the management of Deep-water fisheries

Diapositive 14


Links with MarineStrategy Framework Directive ( MSFD)

• Descriptors of MSFD:- 1 - Biological diversity is maintained. [...]- 2 - Non-indigenous species

- 3 - Commercially exploited fish [...] healthy stock.- 4 - Marine food web [...] normal abundance and diversity [...]- 5 - Eutrophication

- 6 - Sea-floor integrity [...] structure and functions [...] safeguarded [...] benthic ecosystems [...] not adversely affected

- 7 - Hydrographical conditions- 8 - Contaminants in the environment

- 9 - contaminants in seafood- 10 - [...] marine litter do not cause harm- 11 - Introduced energy

Diapositive 15


Future management

• Agenda– implementation of the MSFD– reform of the CFP

• Topics– green paper on the CFP reform: more

involvement of the stakeholders; stock managed to produce MSY

– MSFD & CFP reform : ecosystem approach

20

Presentation 3: ---

Presentation of stock assessment and Biological Ref erence Points : problems and methods, and progress and objectives achieved in the project DEEPFISHMAN (in the work packages WP4 a nd WP5)

- by Phil Large , CEFAS (UK)

21

Diapositive 1 DEEPFISHMAN

Stock assessment (WP 4) and Biological Reference Points (WP 5)

Phil Large

Diapositive 2 Brief background

• Deep-water species in NE Atlantic are extremely diverse.

• In a data rich situation - biology & life history characteristics (LHCs) pose severe problems for assessments

• In data poor situation, where until 2003 fisheries developed without monitoring & management in place.

Diapositive 3

Overview of major assessment problems

• Last 10 yrs - greater level of research and biological sampling but still ‘data-poor’.

• Stock identity, migration & recruit processes.

• Paucity of biological data – where present often short time series & ageing problems

• Observer data – sparse

• Discards

22

Diapositive 4 • Fisheries-independent surveys:-

•• Scottish deepwater survey Scottish deepwater survey –– 1998 to present1998 to present•• Irish deepwater survey Irish deepwater survey -- 2006 to present2006 to present•• Iceland autumn survey Iceland autumn survey -- 1996 to present1996 to present•• FaroesFaroes Autumn survey Autumn survey –– 2000 to present.2000 to present.•• AzoresAzores longlinelongline survey survey –– 1995 to present1995 to present•• Spanish Porcupine Bank survey Spanish Porcupine Bank survey –– 2001 to present2001 to present

• Sequential depletion & expansion of effort to new grounds and depths

• Need estimates of virgin/current biomass & sustainable catches (MSY – stock reduction)

Diapositive 5 Progress to date

• Often only time-series data available are total international landings and fleet CPUE.

• Provisional assessment units based on;Theoretical separation of populations in relation to the hydrological and geological structures Distribution of species

Comparison of trends in catch ratesConsistency with management units.

• Exception tusk (genetics studies)

Diapositive 6 • Exploratory assessments - surplus production &

depletion models, Sep VPA and XSA, Catch Survey Analysis (CSA), stock reduction, catch curves etc.

• Fringe methods – software often not very robust & diagnostics are poor.

• Increasing stakeholder involvement (French CPUE & blue ling (POORFISH))

• ICES advice based on abundance indices and LHCs.

23

Diapositive 7 What can DEEPFISHMAN do?

• Use case studies as tools to develop and trial methods

• Data – review existing monitoring & observer schemes

• Data and information – from Stakeholders

• Recommendations for surveys (ICES PGNEACS).

• Review & make recommendations for research

• Existing assessment methods – migrate these to FLR improve diagnostics, user-friendly.

Diapositive 8

• Trial alternative assessment methodologies and develop new approaches.

• Bayesian models

• Multi-species models (linked to conserving current species composition or depleted species)

• Life history rule-of-thumb models

• Length-based methods

• Ecosystem assessment of impact of fisheries on vulnerable/indicator species and VMEs.

Diapositive 9 ICES Benchmark Assessment

•• Aim Aim –– To develop and standardise assessment methodologiesTo develop and standardise assessment methodologies

•• Standardised methodologies should be used in subsequent Standardised methodologies should be used in subsequent years for “update” assessments (exploratory assessments?)years for “update” assessments (exploratory assessments?)

•• Stakeholder participation is encouragedStakeholder participation is encouraged

•• Includes a 1 day “data compilation” workshopIncludes a 1 day “data compilation” workshop

•• Provisionally, Feb 2010 at ICESProvisionally, Feb 2010 at ICES

• ICES WGDEEP and DEEPFISHMAN resources will be optimised

24

Diapositive 10 Biological reference points (BRPs)

• WGDEEP in 2005 reviewed BRPs used since 1998.

• Proposed for data-poor situations by ICES SGPA and NAFO in 1997 and are as follows:-Ulim = 0.2 * Umax Upa = 0.5 * Umax

Where U is the index of exploitable biomass.

• Aim is to maintain Ucurrent > Upa

Diapositive 11

• WGDEEP proposed BRPs should take into account differences in LHCs between species

• ICES concerned that Umax may not represent virgin biomass and BRPs not used

Diapositive 12

• DEEPFISHMAN - global review of candidate (biological, ecological and socio-economic) reference points.

• Aim to move beyond single target-species approach & test alternative fishery and ecosystem reference points.

• Key issue - multi-species nature of many deep-water fisheries & need to capture this in management framework.

• Review the potential use of existing and multi-species biological reference points e.g. status of indicator species, biodiversity indicators

• Also consider simplistic metrics such as changes in mean length, proportion of large fish in catches etc

25

Diapositive 13 Interaction with stakeholders

• Data – skipper logbooks

CPUE series from haul by haul data from French Fishermen’s personal logbooks (source, PROMA IFREMER cooperative work)

Ling in Division IIa.

Estimates of Norwegian longline cpue (kg/1000 hooks) based on skippers’

logbooks (pre-2000) and from the entire fleet (2000–2006).

Data from Skippers

private logbooks

Diapositive 14

• Qualitative views on abundance and distribution.

• Sentinel fishers

• What you would see as suitable reference points based on actual catch-rates?

Thank you

26

Presentation 4: ---

Presentation of the Management Strategies in relation to Deep Sea Stocks and

the Management Strategy Evaluation as a potential t ool -

by Marina Santurtún, Guzmán Diez & Dorleta Garcia , AZTI-TECHNALIA (ES)

27

Diapositive 1

Management Strategies in relation to Deep Sea Stocks.

The Management Strategy Evaluation as a potential tool.

Marina Santurtún, Guzmán Diez & Dorleta Garcia

Diapositive 2

© AZTI-Tecnalia

Useful Management Systems for the fishing activity

Management systems potentially useful for managing fishing activities can be classified on the basis of the criteria described below (a recent complete revision of Management Systems can be found in Motos & Wilson, 2006):

Systems based in the establishment of a fishing eff ort control Based in the control of “inputs” that can be used by the fishers in the

development of their activity. In particular, the physical characteristics of the vessels in terms of number of boats with license for fishing, and/other characteristics of the vessels, such as the technical ones or number of fishing days, the establishment of temporal or spatial fishing bans… are specified.

System based in the establishment of catches contro l or also named as production control

In this case, the maximum amount of catches that can be retrieved from a stock along a year or fishing periods is limited. The establishment of a Total Allowable Catch (TACs) or Individual transferable Quotas (ITQs) would be management mechanisms based in “output” control.

Diapositive 3

© AZTI-Tecnalia

• Market Systems These systems jointly with the two mentioned before (effort and catches

control) are the most popularly implemented in fisheries all around the world. However, the most traditional market tools, taxes, do not usually achieve their objectives, also they are not socially well accepted which make difficult implementation and control. Finally it has to be mentioned that the exchange of ITQs have been lately incorporated to the market system when are made on organized markets.

• Management systems based in the establishment of ge ographical areas for the development of the fishing activity ( Territorial Use Rights in Fisheries, TURFs). Regional Zonation of the resou rces use

In these systems the right to fish inside a determined are is established. They respond to a regional zonation of the use of the resources. This fishing right can be also complemented limited with the control of inputs from which, for instance, the type of vessel which can access to the area of fishing zone is determined.

• Establishment of Marine Protected Areas (MPAs).The objective of the establishment of marine protected areas is to preserve the

natural “landscape” banning the development of any human activity related to the fishing. It is a specific system to preserve the marine biodiversity.

28

Diapositive 4

© AZTI-Tecnalia

• Management systems under an ecosystem approach .

In the last years, it has been reiterated the need that the nations develop tools for managing fishing which incorporate considerations related to the ecosystem. However, the complexity of the marine ecosystems complicates largely this task, as large amount of basic biological research is needed.

In general, it cannot be said that just one rule can assure that one specific system of management could lead to a better use of the fishing resources in comparison to other rule. The particular characteristics related to the fishing activity in one region would condition the use of one or anothermanagement system.

For instance: the disadvantage of the management systems based in the output control is that this just control the amount of the stock captured in an indirect way. On the other hand, system based on output controls facilitate the election of a combination of inputs that minimize the costs of the fishing activity while those based on input controls incentive the use of inputs from which catches are incremented, increasing, at the same time, costs. Finally management systems based on the establishment of specific fishing areas work well for sedentary fisheries but no so well in the case of migratory or highly migratory stocks.

Diapositive 5

© AZTI-TecnaliaRed Seabream(PagellusBogaraveo)

TACTACAlfonsinos (BeryxSpp.)

TACTACTACTACGreater Forkbeard(Phycis Blennoides)

TAC, licensing

system

TAC, licensing

system

TAC,licensing

system

Black scabbard fish (Aphanopus carbo)

TACTACTACTAC

RoundnoseGrenadier (Coryphaenoidesrupestris)

TACTACTACTAC

Orange Roughy(HoplostethusAtlanticus)

TACTACTACTACGreater Silver Smelt (Argentina Silus)

no manag.no manag.Tusk (BrosmeBrosme)

TACTACTACTACBlue Ling (MolvaDypterygia)

TACTACno manag.no manag.Ling (Molva molva)

IVIIIIII

TACTAC

TACTACTAC

TACTACTACTACTAC

TAC, licensing system

TAC,

licensing system

TAC,

licensing system

TAC,

licensing system

TACTAC mimlanding size,

TAC,

protected areas

TAC,prote

ced areas

TAC

TACTAClicensesmim. landing size

licencesTAC

TACTAClicenses, effort

limitation

TACTAC

TAC TAC

TAC, protected areas, catch limited by vessel

TACTAClicenses, MLS, TACTAC

VIIVIVbVaV

Diapositive 6

© AZTI-TecnaliaRed Seabream (PagellusBogaraveo)

Alfonsinos (Beryx Spp.)

Greater Forkbeard (PhycisBlennoides)

Black scabbard fish (Aphanopus carbo)

Roundnose Grenadier (Coryphaenoides rupestris)

Orange Roughy(Hoplostethus Atlanticus)

Greater Silver Smelt (Argentina Silus)

Tusk (Brosme Brosme)

Blue Ling (MolvaDypterygia)

Ling (Molva molva)

TAC, trawl

forbidden, quota by

vessel

TAC

*Regional Recovery

Plan

TAC

TACTACTAC, trawl

forbiddenTACTAC

TACTACTACTACTACTACTAC

TAC,

licensing

system

TAC,

licensing

system

TAC, licensing

system

TAC,

licensing

system

TACTAC

biennalTACTACTACTAC

TACTACTACTACTAC

TACTACTACTACTAC

TAC

effort

limitatio

n

closed

areasTACTACTACTAC

TACTACTACTACTACTAC

XIVXIIIXIIbXIIXIXVIII

* closure of the fishing, season during two and half months (15 January–31 March), minimum size of fish retained or landed (33 cm total length), authorized vessels list, hook size, maximum hooks per line (100), maximum number of lines per boat (30), and maximum number of automatic machines for hauling per boat (3), restricted ports for landing the red sea bream catches (only Tarifa and Algeciras)

29

Diapositive 7

© AZTI-Tecnalia

What can be done in the context of DEEPFISHMAN?..

Using Management Strategy Evaluation approach (MSE).

Trying to find the management procedure that obtains the best results in terms of biological, economical and social robustness, taking into account the main uncertainties.

Diapositive 8

© AZTI-Tecnalia

Management Strategy Evaluation (MSE)

• The Operating Model simulates the real stock and the fishery under certain hypothesis about their dynamics and interactions.

ManagementProcedure (MP)

STOCK

&

FISHERY

ASSESSMENT

PROCESS

ADVICEDATA

COLLETION

Operating Model

(OM)

• The Management Procedures simulates three main processes:

� Data collection: Simulate the sampling of the necessary data to run the assessment

� Assessment: Compile the data and obtain an estimated population through an assessment model.

� Advice: Apply a predefined HCR to the observed population to obtain themanagement advice (TAC, TAE, spatio-temporal closures…).

Diapositive 9

© AZTI-Tecnalia

What can be done in the context of DEEPFISHMAN?..

We can compare, for instance, which of these procedures are the most suitable for the stocks of interest:

TAC based regulation (output regulation): the idea is to determine the quantity extracted from the sea (Ideally) or as second best the quantity landed, in order to achieve a desired target (Biological, economic, social, …).

Effort based regulation ( input regulation): the idea is to determine the pressure against the stock(s) in physical terms in order to achieve a desired target (Biological, economic, social,…).

Or once that one procedure is chosen, different strategies can be compared to achieve the possible targets.

30

Presentation 5: ---

Presentation of the data avaibility -

by Pascal Lorance , IFREMER (FR)

31

Diapositive 1


DEEPFISHMANStakeholder worskshop

Brussels

29-30 June 2009

Data availability

Diapositive 2


Data on management procedure,regulation availableImpact on fleet poorly known

Management

Most assessment exploratory, not validatedeven for redfish “data rich” stock

Assessment methodologies

See G. Haraldsson’s presentationSocial

See G. Haraldsson’s presentationEconomy

Often limited, observation data provide by-catch, not all fleet covered

BiodiversityBy-catch, benthos, VMEs, fishing impact,

UncertaintyBiology (biological parameters, stock structure)

Start time of time-series, resolution, completeness

FishingTimes series of fleet, catch and effort

ProblemsType of Data

Diapositive 3


More data allow more realistic assessment and management

Example 1:

Tally book data provide haul by haul catch and effort

The view of the fishery is different for that for EU logbook data (hauls aggregated per day and statistical rectangle)

Tally books allow : - better estimates of CPUEs

- account of fishing strategies on trends in landings and CPUEs

32

Diapositive 4


Example 2.

-the effect on fishing on both exploited species and other species in the ecosystem is primarily a matter of mortality- for benthos mortality can be assessed from the frequency of trawling

Diapositive 5


Example 2.

-the effect on fishing on both exploited speices and other species in the ecosystem is primarily a matter of mortality- for benthos mortality can be assessed from the fequency of trawling

When data resolution increases a large proportion of the seabed appears no to be fished:

% of unfished bottom (% unimpacted benthos) estimated lower from VMS

No change in estimated fishing mortality for target species

From Piet and Quirijns (2009). The importance of scale for fishing impact estimations. can. J. Fish. Aquat. Sci.

Diapositive 6


Questions

Which data can be made available for stock and ecosystem assessment

- VMS data: which are available?

what can de done with?

- Tally book data: main use might be stock assessment?

- Data availability in the future (e.g. electronic logbook)

33

Presentation 6: ---

Presentation of socio-economic aspects and data ava ibility -

by Gunnar Haraldsson , UoI (IS)

34

Diapositive 1

DEEPFISHMANData and data availability

Institute of Economic StudiesGunnar Haraldsson

Stakeholder’s meetingBruxelles 29-30 June 2009

Diapositive 2 Socio-economic aspects - What are we

looking at?

• Sustainability (long-term)

• Profitability/Social benefits• Employment

• Markets

• Cost of management

Diapositive 3 The data

• Construct a general bio-economic model applicable to each case study for which there exist appropriate data. Data requirements

• 1. Stocks• 2. Harvest• 3. Costs • 4. Revenue• 5. Various macroeconomic data• 6. Various microeconomic data

35

Diapositive 4 Basic characteristics

• The model should be

• 1. Dynamic• 2. Stochastic• 3. Capable of incorporating various

management regimes (which?)

Diapositive 5 What data is ‘easily’ available

• Macroeconomic data (economic and social data)– Unemployment rates– Wage developments– ...

Diapositive 6 What data is not so easily available?

• Microeconomic data– Cost data (fuel, labor, gear, effort indices)– Prices

• Soft data– Institutional setting

– Fisheries management measures (official/unofficial)

36

Diapositive 7 Case studies

• Case study 1 – Directed single species fisheries:-• Highly vulnerable - orange roughy in Namibian waters – NatMIRC• Highly vulnerable - orange roughy in ICES VI &VII – MI• Less vulnerable - blue ling (Molva dypterygia) in Vb,VI ,VII – Cefas• Case study 2 – Mixed demersal fishery:-• French trawl fishery for roundnose grenadier (Coryphaenoides rupestris), black

scabbardfish, deep-water sharks in Vb, VI and VII – IFREMER• Case study 3 – Artisanal fisheries :• Vulnerable :• -Fisheries for red (blackspot) seabream in the Gibraltar Strait and Bay of Biscay– IEO • -Fisheries for red (blackspot) seabream in the eastern Mediterranean– HCMR• Less vulnerable : • -Portuguese fishery for black scabbardfish in IX –IPIMAR• Case study 4 – Data rich stock – NE Atlantic redfish -IMR• Case study 5 – Data- rich stock - Greenland halibut stocks in the NAFO area – IEO

Diapositive 8 Case studies

• We can do a socio-economic description of each case

• Bioeconomic modeling for selected cases

• We rely heavily on receiving data from case study leaders and on collaboration with our colleagues in the scientific community

• Stakeholder’s participation is very important

Diapositive 9 An example: Comparison between actual and

optimal harvest.

DEEPFISHMAN 227390 Deliverable D8 - Ifremer

Documents

Transcript of DEEPFISHMAN 227390 Deliverable D8 - Ifremer