Cyclic AMP Induction of Phosphoenolpyruvate Carboxykinase (GTP ...

T H E JOURNAL OF BIOLOGICAL CHEMISTRY IC:) 1991 by The American Society for Biochemistry and Molecular Biology, lnc

Vol. 266, No. 28, Issue of October 5, pp. 19095-19102, 1991 Printed in U.S.A.

Cyclic AMP Induction of Phosphoenolpyruvate Carboxykinase (GTP) Gene Transcription Is Mediated by Multiple Promoter Elements*

(Received for publication, April 9, 1991)

dinsong Lius, Edwards A. Park, Austin L. Gurney$, William J. Roeslerll, and Richard W. Hanson From the Department of Biochemistry, Case Western Reserve University School of Medicine, Cleveland, Ohio 44106

The cis elements involved in the CAMP regulation of transcription of the gene for phosphoenolpyruvate carboxykinase (GTP) (EC 4.1.1.32) (PEPCK) were stud- ied by introducing a series of block mutations (10-15 base pairs of random sequence) into eight of the protein binding domains in a region of the promoter between -490 and +73. Each mutant promoter was ligated to the structural gene for chloramphenicol acetyltransferase (CAT) and transfected into HepG2 cells. Tran- scription of PEPCK-CAT was stimulated 4-fold by the addition of 8-bromo-CAMP (8-Br-CAMP), whereas overexpression of the catalytic subunit of protein kinase A in these cells increased transcription from the PEPCK promoter 30-fold. Several elements within the PEPCK promoter acted synergistically to mediate this effect. These include CRE-1 (-92 to -82) and a complex unit from -220 to -280 composed of multiple binding sites termed P3(I) (-250 to -234), P3(II) (-260 to -250), and P4 (-286 to -270). Mutation of both CRE-1 and P3(I) resulted in the complete elimi- nation of transcriptional induction by either 8-Br- cAMP or the catalytic subunit of protein kinase A. To examine the proteins involved in this response, we replaced CRE-1, which binds both C/EBP and CAMP- responsive element binding protein (CREB), with an optimal C/EBP binding sequence which significantly decreased the binding of CREB, but maintained the affinity for C/EBP. Transcription from this modified promoterwas induced by 8-Br-CAMP and the catalytic subunit of protein kinase A (PKA) to a similar extent as noted with the native PEPCK promoter. However, the results of experiments involving cotransfection of PEPCK-CAT with expression vectors for PKA and either C/EBP or CREB suggest that CREB is capable of mediating a greater responsiveness to PKA than C/EBP. Our results indicate that multiple cis elements are involved in the CAMP induction of PEPCK gene transcription and that C/EBP and CREB are poten- tially involved in this response.

* This work was supported in part by Grants DK 21859 and DK 24951 from National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ Current address: Howard Hughes Medical Institute and Dept. of

Arbor, MI 48109-0650. Biological Chemistry, University of Michigan Medical Center, Ann

5 Trainee supported by the Metabolism Training Program Grant DK-07319 from the National Institutes of Health.

ll Current address: Dept. of Biochemistry, University of Saskatch- ewan, Saskatoon, Saskatchewan, Canada S7N OWO.

The cytosolic form of PEPCK’ is a key enzyme in gluco- neogenesis, which is expressed predominantly in liver, kidney cortex, and adipose tissue. The transcription of this gene is stimulated by several hormones, including cAMP (Lamers et al., 1982), glucocorticoids (Magnuson et al., 1987), and thyroid hormone (Loose et al., 1985), whereas insulin, phorbol esters, and vanadate inhibit its expression (Granner et al., 1983; Chu and Granner, 1986; Bosch et al., 1990). The PEPCK promoter (-460 to +73) can direct the expression of a chimeric PEPCK- bovine growth hormone gene in transgenic mice in a manner similar to the endogenous PEPCK gene (McGrane et al., 1988, 1990). These observations suggest that this relatively small region of the promoter contains the information necessary for tissue-specific and hormonally regulated expression of the PEPCK gene.

DNase I footprinting analysis with proteins prepared from rat liver nuclei has defined at least eight binding domains, termed CRE-1, CRE-2, and P1 to P6 (Roesler et al., 1989). Recent studies from this laboratory have identified several transcription factors which can bind to the PEPCK promoter. Nuclear factor 1 (NFl/CTF) and the hepatic nuclear factor- 1 (HNF-1) bind to the P1 and P2 sites, respectively (Roesler et al., 1989). The functional significance of most of the individual elements in the PEPCK promoter, which were identified by their ability to bind nuclear proteins, remains unclear. The only previously described CAMP-responsive element in the PEPCK promoter maps between -94 and -72 (CRE-1). This element was identified using serial deletions of the PEPCK promoter linked to a selectable marker gene, neo (Short et al., 1986). The CRE-1 region is important for both basal and cAMP induced transcription (Short et al., 1986; Quinn et al., 1988; Bokar et al., 1988). The transcription factor C/EBP, which binds to promoters from a variety of genes of metabolic importance, has been shown by DNase I footprinting analysis to bind to CRE-1 and to other regions of the PEPCK promoter at -250 to -234 (P3(I)) and at -286 to -270 (P4). C/EBP also induces transcription of a chimeric PEPCK-CAT gene when it is introduced into hepatoma cells (Park et al., 1990). The CAMP-responsive element binding protein (CREB) binds to the CRE-1 site in the PEPCK promoter (Park et al., 1990). CREB has been implicated in the cAMP induction of transcription of the somatostatin gene (Montminy et al., 1986; Yamamoto et al., 1988). Since both C/EBP and CREB bind to CRE-1, it is possible that either or both of these proteins play a role in the cAMP induction of PEPCK gene transcription.

The intracellular effect of CAMP is mediated via the CAMP- dependent kinase A (PKA) (Edelman et al., 1987; Taylor, 1989), which is composed of two regulatory and two catalytic

I The abbreviations used are: PEPCK, phosphoenolpyruvate carboxykinase; CAT, chloramphenicol acetyltransferase; PKA, protein kinase A; 8-Br-CAMP, 8-bromo-CAMP.

19095

19096 CAMP Induces PEPCK Transcription through Multiple Promoter Elements

(C) subunits. Klemm et al. (1990) have shown, using a cell- free in vitro transcription system, that the C subunit of PKA caused a marked induction of transcription from the segments of the PEPCK promoter as short as -109. If CRE-1 was removed from the promoter by deletion to -68, instead of stimulating transcription, the C subunit of PKA caused a slight inhibition of transcription from the PEPCK promoter. Cotransfection of the C subunit of PKA with chimeric genes has also been shown to induce the transcription of several CAMP-responsive genes (Mellon et al., 1989).

Here we report that cotransfection of an expression vector for the C subunit of PKA together with PEPCK-CAT vectors into HepG2 cells increases transcription from the PEPCK promoter 30-40-fold. Using this transfection system together with the PEPCK promoter containing a series of block mutations in specific protein binding domains, we determined that multiple sequence elements are involved in the cAMP regulation of gene transcription. Our results indicate that CRE-1, P3(I), and to a lesser extent, P3(II) and P4, are of importance in conferring cAMP responsiveness on the PEPCK promoter.

EXPERIMENTAL PROCEDURES

Materials

DNA-modifying enzymes, poly[d(I.C) .d(I. C)], 8-bromo-CAMP (8- Br-CAMP) were purchased from Boehringer Mannheim. [y””P] ATP (6000 Ci/mmol) and [1,2-’4C]chloramphenicol (50 mCi/mmol) were from Du Pont-New England Nuclear. Tissue culture media, sera, and supplies were from GIBCO. The cell line HepG2 was from American Type Culture Collection. Oligonucleotides were chemically synthesized using an Applied Biosystems 380A DNA Synthesizer.

Escherichia coli strain NM522 (dut’ ung+), CJ236 (dut- ung-), and pTZ vectors (Mead et al., 1986) were from the laboratory of Norman Pace, Indiana University, Bloomington, IN. The RSV-(%gal plasmid was a generous gift of Chen-ming Fan, Harvard University. The expression vector for the catalytic subunit of CAMP-dependent protein kinase A was kindly provided by Dr. Muramatsu, DNAX, Palo Alto, CA. The cDNA for CREB was a gift from Dr. M. Montminy, Salk Institute, San Diego, CA and the cDNA for C/EBP was provided by Dr. Steven McKnight, Carnegie Institution, Baltimore, MD. All DNA-modifying enzymes were from Boehringer Mannheim.

Methods

Construction of PEPCK-CAT-A 563-base pair XbaI-BglII fragment of the PEPCK promoter regulatory region, which was isolated from the plasmid BH1.2 (Wynshaw-Boris et al., 1984) was ligated into the XbaI-BglII site of the polylinker from poly-CAT. Poly-CAT is a derivative of pSV,CAT (Silver et al., 1987), except that the XbaI- HindIII site was replaced by a polylinker made with two complemen- tary synthetic oligonucleotides, 5’CTAGACCCGGGATCGATAGAT CTAAGCT 3’ and 5’AGCTTAGATCTATCGATCCCGGGT3’. This polylinker contains XbaI, SmaI, ClaI, BglII, and Hind111 restriction sites. The resulting plasmid was digested with XbaI and PstI restriction enzymes, and the 2.5-kilobase pair XbaI-PstI fragment containing the whole CAT structural gene and SV40 polyadenylation

pTZ18R (Mead et al., 1986). signal from the poly-CAT was ligated into the XbaI-PstI sites of

Specific block mutations were introduced into the PEPCK promoter using a modification of the Kunkel method (Kunkel, 1985) for site-directed mutagenesis (Liu et al., 1990). The individual oligonucleotides containing the mismatched sequence were synthesized and used as the primers for the synthesis of double-stranded DNA using uracil-containing single-stranded DNA as template. The DNA synthesized in vitro was transformed into wild type E. coli NM522. The plasmid DNA was isolated and digested with the appropriate enzyme, since the mismatched nucleotides in all of the primers encode a new restriction site. All of the positive clones were confirmed by dideoxy sequencing.

Serial deletions from the 5’ end of the PEPCK promoter were generated with Ba131 by Short et al. (1986). These promoter deletions were digested with XbaI-BglII and ligated into the XbaI and BglII sites of PEPCK-CAT vector after the wild type promoter (-490 to

+73) was removed with XbaI and BglII digestion (Park et al., 1990). Plasmids containing two mutations in CRE-1 and P3(I), CRE-1

and P3(II), and CRE-1 and P4 in the PEPCK promoter were con- structed using the unique SauI restriction site a t -208. The XbaI- SauI fragment (-490 to -208) of the PEPCK promoter, which contains either P3(I), P3(II), or P4 block mutation, respectively, was ligated into the XbaI-Saul site of the PEPCK-CAT which contains a block mutation in CRE-1.

The pXSVlCAT vector which consists of the SV40 early promoter linked to the CAT structural gene has been described previously (Bokar et al., 1988). Oligonucleotides containing PEPCK promoter sequences -94/-77 (CRE-1) and -251/-234 (P3) were synthesized to contain XbaI compatible ends, and two copies of these nucleotides were ligated into the XbaI site of pXSVlCAT (Bokar et al., 1988).

Construction of Expression Vectors for CREB and C/EBP-The mammalian expression vector for CREB was created by removing the entire CREB cDNA (Gonzalez et al., 1989) by SmaI and BamHI digestion. This fragment was ligated in front of the RSV promoter which was derived from a RSV-CAT vector (Silver et al., 1987) that had been digested with HindIII and NcoI to remove the CAT coding sequences. Construction of the mammalian expression vector for C/EBP has been described (Landschultz et al., 1989). Construction of the plasmid for the expression of CREB and the production of CREB in E. coli by the two vector system of Tabor and Richardson (1987) has been described (Park et al., 1990). Recombinant C/EBP was purified after overexpression in E. coli (Landshultz et al., 1989).

Cell Culture, DNA Transfection, and the Determination of CAT Activity-HepG2 cells were grown in 10-cm plates in Dulbecco’s minimal essential medium, containing 5% fetal calf serum and 5% calf serum. Cells were grown to 60-70% confluence, treated with trypsin, centrifuged, and resuspended in 2 ml of complete medium. Ten pg of PEPCK-CAT, 5 pg of RSV-P-gal, and 10 mg of the expression vector for the C subunit of PKA were precipitated using calcium phosphate (Park et al., 1990). Two ml of the calcium phosphate-DNA precipitate was mixed thoroughly with the 2 ml of cells, and the mixture of cells with DNA was then transferred to two plates containing 10 ml of complete medium and incubated for 36 h. 8-Br- cAMP was added for 12 h prior to harvesting the cells. No 8-Br- cAMP was added to the cells cotransfected with the C subunit of PKA. The cell extracts containing CAT were prepared as described previously (Park et al., 1990). The protein concentration in the extracts was determined by the method of Bradford (1976). A quarter of the extract was saved for measurement of @-galactosidase activity (Miller, 1972) to correct for transfection efficiency. The percentage of [’4C]chloramphenicol in the acetylated form was normalized for variation in transfection efficiency by dividing by the @-galactosidase activity measured in each cell extract.

Footprinting Analysis-The DNase I footprinting analysis was carried out using a probe of a 513-base pair segment of the PEPCK promoter prepared from PEPCK-CAT (Fig. 1). The DNA fragment was labeled at the XbaI site a t -490 with [y-””PIATP and T4 DNA polynucleotide kinase as described previously (Roesler et al., 1989). The same restriction site was used for the promoter containing individual mutants. Nuclear proteins were isolated from rat liver nuclei as described previously (Roesler et al., 1989).

RESULTS

Introduction of Block Mutations into Specific Regions of the PEPCK Gene-Site-directed mutagenesis was used to introduce mutations directly into those regions of the PEPCK promoter known to bind proteins isolated from rat liver nuclei (Fig. 1). A detailed description of the technique used to introduce the block mutations which are examined in this report has been presented in a previous publication (Liu et al., 1990). We analyzed the ability of proteins isolated from rat liver nuclei to bind to the PEPCK promoter containing block mutations by footprint analysis. These experiments were designed to ensure that binding at the specific site was eliminated and to show that the mutations did not introduce an unexpected protein binding site in the promoter. Mutation of nucleotides at CRE-1, CRE-2, P3(I), and P4 disrupted the interaction of nuclear proteins from rat liver with each of these regions (Fig. 2). The other mutations introduced a t P1, P2, P3(11), P5, and P6 also disrupted binding of proteins to

CAMP Induces PEPCK Transcription through Multiple Promoter Elements 19097

c 3 their corresponding binding sites in the PEPCK promoter GRU c Y e - N I D

o - o - o u m x m I m x k ? m u L u u z U L U

k z :: : Y 5 :: G e t : : (data not shown). The Effect of the Catalytic Subunit of PKA on Transcription

from the PEPCK Promoter Deletions-We first transfected Xbal P6 P5 P4 P3(111P3(1) P2 CRE2 Pl CREl TRTA 8g1,1 the PEPCK-CAT vector into HepG2 cells, a liver cell line

-490 -400 -300 -200 -100 +1 r73 derived from a human hepatoblastoma which has been used to study of variety a liver-specific functions (Aden et al., 1979;

tein binding domains in the PEPCK promoter. Schematic diagram of protein binding domains in the PEPCK promter from -490 scription of PEPCK-CAT gene about 4-fold but had no effect t.0 +73 defined by the XbaI and BglII sites. Each protein binding on the RSV-CAT gene (data not shown). Transcription of a domain from P1 to P6. CRE-1. and CRE-2 is shown at the bottom of Dromoterless Dlasmid (18R-CAT) was also included as a con-

l. A schematic diagram Of PEPCK-CAT and the pro- Javitt, 1990), and noted that 8-Br-cAMP induced the tran-

the promoter and the corresponding transcription factors which hind to these regions are outlined above. The region between -455 and -350, which was shown to be involved in glucocorticoid responsiveness, is indicated by GRU (glucocorticoid-responsive unit) (Imai et nl., 1990).

c

i

FIG. 2. Footprint analysis of block mutations in the PEPCK promoter. The XbaI-Rg/II fragment of the PEPCK promoter (-490 to +7B) was isolated from PEPCK-CAT and end-labeled on the noncoding strand a t the XbaI site. The mutant PEPCK promoters were identically end-laheled. In the left lane is the DNase I digestion in the absense of proteins. The remaining lanes show the DNase I digestion pattern in the presence of rat liver nuclear proteins for the wild type and mutant forms of the PEPCK promoter. The corresponding binding sites are outlined by the boxes on the right.

'trol for nonsiecific CAT activity, and no CAT activity was observed. The level of induction of transcription from the PEPCK promoter noted above (about 4-fold) was not sufficient to analyze the role of each of the putative regulatory elements in the PEPCK promoter. It was possible that either the concentration of CAMP-dependent PKA or the transcription factors mediating the effect of PKA in HepG2 cells was limiting. We next cotransfected an expression vector encoding the C subunit of PKA, together with the PEPCK-CAT gene, which increased transcription from the PEPCK promoter approximately 30-fold. This effect of the C subunit of PKA was specific for the PEPCK promoter, since it did not affect transcription from the RSV promoter (data not shown).

We analyzed the 8-Br-CAMP and PKA responsiveness of serial deletions in the 5"flanking region of the PEPCK promoter (Fig. 3). Removal of the sequences between -355 and -210 resulted in a substantial loss of both CAMP and the C subunit of PKA induction of PEPCK transcription. This region contains the protein binding sites termed P3(I), P3(II), and P4 (Fig. l.4). The remaining induction of transcription was retained by the PEPCK promoter containing -174, -134, and -109 deletions, but was lost with the promoter containing a deletion to -68. The region of the PEPCK promoter between -109 and -68 contains the protein binding site termed

Multiple Elements Are Involved in the Induction by PKA of Transcription from the PEPCK Promoter-Analysis of the serial deletions of the PEPCK promoter demonstrated that

CRE-1.

t

,440 . 3 5 5 .?i' . ? ? c , 1 7 6 . 1 3 4 . l o 3 . 6 8

FIG. 3. Transcriptional induction by 8-Br-CAMP or the C subunit of PKA of the PEPCK-CAT gene containing serial deletions. HepG2 cells were transfected with 5 pg of PEPCK-CAT and 2.5 pg of RSV-a-gal plasmids. After 36 h, 1 mM 8-Br-CAMP was added for 12 h. The cells were also transfected with 5 pg of PEPCK- CAT and 5 pg of SR-PKA and RSV-6-gal. No 8-Rr-CAMP was added to the transfected cells when the expression vector for catalytic subunit of PKA was added. The expression vector for the C subunit of PKA contains the SRn promoter to direct the expression of the open reading frame for the C subunit (Muramatsu et al., 1989). The cells were harvested, and CAT activity was measured as described under "Experimental Procedures." The results shown are corrected for @-galactosidase expression from the RSV-@-gal. Shown in the figure are average values from two to five independent transfection experiments. Open bar, no treatment, striped bar, 8-Rr-CAMP added, solid bar, cotransfected with the C subunit of PKA.


upstream elements are required for the induction of transcription by C subunit of PKA. To further define these elements, chimeric PEPCK-CAT genes containing individual mutations in the PEPCK promoter at specific protein binding domains were transfected into HepG2 cells and tested for their transcriptional responsiveness to 8-Br-CAMP or the C subunit of PKA (Fig. 4). Mutations in regions P1, CRE-2, P2, and P4 of the PEPCK promoter had no effect on the stimulation of transcription by 8-Br-CAMP. Disruption of CRE-1 caused a greater reduction in CAMP-stimulated transcription from the PEPCK promoter than a block mutation in P3(I).

The PEPCK promoter containing a mutation in CRE-1 could be induced %fold by the C subunit of PKA, as compared with the 30-fold induction noted with the intact promoter (Fig. 4). Mutations in P3(I), P3(II), or P4 resulted in a 3- or 4-fold induction of transcription, respectively, from the PEPCK promoter by the C subunit of PKA. A mutation at P1, a binding site for NF-1/CTF, although adjacent to CRE- 1, did not affect the induction of transcription from the PEPCK promoter by the C subunit of PKA. Finally, a mutation in P2, a binding site for HNF-1, or in CRE-2, a weak binding site for C/EBP, had no significant effect on the induction of transcription from the PEPCK promoter by the C subunit of PKA.

Since no single mutation completely abolished induction by cAMP or the C subunit of PKA, we created a series of double mutations at key protein binding sites within the PEPCK promoter (Fig. 4). The chimeric PEPCK-CAT gene containing a mutation in both CRE-1 and P3(I) had a low level of basal transcription and was completely unresponsive to stimulation by 8-Br-CAMP or the C subunit of PKA. The PEPCK promoters containing double mutations in both P3(II) and CRE-1 or in P4 and CRE-1 were induced 2-3-fold by 8-Br-CAMP or the catalytic subunit of PKA. These results suggest that cAMP responsiveness is mediated by both CRE- 1 and P3(I), with some additional involvement of P3(II) and P4. It is also possible that the effects of P4 and P3(II) are mediated through CRE-1, since no additional inhibition was observed with these double mutations.

CRE-1 but Not P3 Can Confer 8-Br-CAMP Responsiveness to an SV40 Promoter in Jeg-3 Cells-To examine whether P3(I) or CRE-1 functioned as CAMP-responsive elements

35 c

WT ~ ~ 5 . 1 P ? C R E 2 P 2 P 3 1 l I P311lI P 1 C R E l CRE 1 CRE 1 P 1 P3(11l P3lll

FIG. 4. The effect of 8-Br-CAMP or the C subunit of PKA on the induction of transcription from the PEPCK promoter containing block mutations. A, HepGP cells were transfected with PEPCK-CAT vectors containing specific mutations in the protein binding domains of the promoter. The cells were treated with 8-Br- cAMP (striped bars) or cotransfected with a PKA expression vector (solid bars) as described in Fig. 3. Basal level of transcription is indicated by open bars. The site which was mutated is indicated on the horizontal axis.

when linked to a neutral promoter, two copies of the core CRE-1 sequence or two copies of P3 were ligated to an enhancerless SV40 promoter (Park et al., 1990). Transcription from the SV40 promoter in the presence of 8-Br-CAMP was analyzed in both HepG2 and Jeg-3 cells. Jeg-3 cells were used since they are very CAMP-responsive when transfected with a variety of CAMP-regulated genes (Deutsch et al., 1988). Both chimeric genes responded very poorly to 8-Br-CAMP when they were transfected into HepG2 cells (Fig. 5). How- ever, transcription from a chimeric gene containing two copies of CRE-1 linked to the SV40 promoter and introduced into Jeg-3 cells was induced 30-fold by 8-Br-CAMP. In contrast, 8-Br-CAMP caused only a %fold stimulation of transcription in these cells when two copies of P3(I) were included in the promoter. Thus, P3(I) must be in an appropriate context within the PEPCK promoter to contribute to the cAMP regulation of PEPCK transcription.

An Optimal CIEBP Binding Site Can Function as a CRE when Introduced into the PEPCK Promoter-Since both C/ EBP and CREB can bind to CRE-1, it was not clear which protein bound to this element in uiuo, to mediate the cAMP induction of PEPCK gene transcription. We replaced the entire core CRE-1 (CTTACGTCAG) with an optimal C/EBP binding sequence (ATTGCGCAAT). Fig. 6 shows DNase I

A.

Oligomer S V 1 CAT

1 . S V 1 C A T "----b 2 . C R E - 1 x 2 _____._I)

3 . P 3 x 2 ~h

B.

S V 1 C R E l P 3 Svi C R E l P 3

HepGP J e g - 3

FIG. 5 . Response of CRE-1 or P3 elements ligated the SV40 promoter to 8-Br-CAMP in HepG2 or Jeq-3 cells. A, two copies of the CRE-1 or P3 sequence were ligated to the SV1 enhancerless promoter driving the CAT gene. B, 5 pg of each plasmid along with RSV-(3-gal was transfected into HepG2 cells. The cells were treated for 16 h with 8-Br-CAMP (solid bars) and the CAT activity analyzed. The vectors containing specific mutations in the PEPCK promoter, together with the cell lines used are indicated on the horizontal axis.

cAMP Induces PEPCK Transcription through Multiple Promoter Elements 19099

Wild Type CRE1 -b CIEBP

2 1 4 1 6 1 4 1 6 2 1 4 1 6 1 4 16 " "

u p3(')

3 P4

"""""""

"""- ~- ""

" ~ " ~ 0 " " -

FIG. 6. Footprinting analysis of the intact PEPCK promoter and the promoter with a C/EBP site replacement at the CRE- 1. The XbaI-&/I1 fragment from the wild type PEPCK promoter from -490 to +.in and the PEPCK promoter containing the sequence o f CRE-1 replaced by an optimal C/EBP sequence were isolated and end-labeled at the XbaI site as described in Fig. 2. The footprinting analysis was carried out using recombinant C/EBP and CRER. The hinding sites for C/ERP and CREB are outlined in boxes.

footprinting analysis of the native PEPCK promoter and the promoter with a C/EBP site replacing CRE-1. The four C/ EBP binding sites within the PEPCK promoter are shown by boxes a t CRE-1, CRE-2, P3(I), and P4. The major site pro- tected by CREB was CRE-1, and there was weak protection at P3(II), which contains a near consensus AP-1 binding site. When CRE-1 was replaced by the optimal C/EBP binding sequence, the binding affinity of CREB to the modified PEPCK promoter was markedly decreased, and only weak DNase I protection at the newly introduced C/EBP optimal sequence was attained at the highest CREB concentration used. The binding affinity of C/EBP for the optimal C/EBP binding site in the modified PEPCK promoter was similar to that observed with the native promoter.

The induction of transcription from this modified promoter was analyzed in the presence of 8-Br-CAMP or after cotransfection with the expression vector containing the C subunit of PKA (Fig. 7). The degree of transcriptional induction from this modified form of the PEPCK promoter was about same as that noted with the native promoter. Surprisingly, the consensus CRE-1 is not absolutely required for the cAMP responsiveness of the PEPCK promoter. This finding suggested that C/EBP-like proteins may mediate the induction of PEPCK gene transcription caused by CAMP.

Expression Vectors for C/EBP but Not CREB Stimulate Basal Transcription from the PEPCK Promoter-To further analyze the role of C/EBP and CREB in basal and cAMP induction of PEPCK gene transcription, the expression vector for each protein was cotransfected into HepG2 cells with PEPCK-CAT. Fig. 8 shows the activity of CAT transcribed from modifed forms of the PEPCK promoter in the presence and absence of an expression vector for C/EBP and in the presence of 8-Br-CAMP. Cotransfection of an expression vector for C/EBP with the PEPCK-CAT vector resulted in a 4- fold induction of transcription. The addition of 8-Br-CAMP increased the stimulation of PEPCK-CAT only 3-4-fold above the level resulting from introducing C/EBP into the cells. The sequences at P3(I) and CRE-1 each contributed equally to the activation of transcription from the PEPCK promoter caused by C/EBP. When both 8-Br-CAMP and C/ EBP were present together, transcription from the PEPCK promoter containing the CRE-1 block mutation was induced 4-fold, whereas transcription from the promoter with the P3(I) mutation was increased 6-fold. The PEPCK promoter, containing a double mutation at the CRE-1 and P3(I) had a low level of basal transcription and was completely unresponsive to stimulation by 8-Br-cAMP, C/EBP, or a combination of both. Similar experiments with an expression vector for CREB did not indicate an effect of CREB on basal expression or significant increase in responsiveness to 8 Br-CAMP (data not shown). However, because our previous work suggested that protein kinase A might be limiting, we cotransfected either the C/EBP or CREB expression vectors with the expression vector for the C subunit of PKA. As can be seen

1 cAMP Catalytic subunit 35

WT CRE-1

C/EBP c WT CRE-1

CEBP +

FIG. 7. Transcriptional induction by 8-Br-CAMP or the C subunit of PKA of the PEPCK-CAT gene following replacement of CRE-1 with an optimal C/EBP binding site. The relative level of induction of transcription from this modified promoter is outlined. HepG2 cells were transfected with PEPCK-CAT vectors in which the binding sites had been switched. Cells were treated with 8-Br-CAMP (striped bars) or cotransfected with the catalytic subunit of PKA (solid bars) as described in Fig. 3.


1 4

1 2

1 0 C 0 .- r ; 8

U 3

C - 6

2 L 4 0

2

C /EBP

cAMP - CIEBPIcAMI

- 4 9 0 C R E - 1 P 3 ( 1 ) C R E - 1 I p 3 ( 1 )

FIG. 8. The effect of overexpression of C/EBP on the cAMP responsiveness of the PEPCK-CAT vectors. A , wild type or mutant PEPCK-CAT vectors were transfected into HepG2 cells with expression vectors for C/EBP or a mutant C/EBP (12V) in the presence or in the absence of CAMP. Each transfection contained 5 pg of PEPCK-CAT and 5 pg of C/EBP vector. 1 mM 8-Br-CAMP was added for 16 h. The results are average of at least three independent experiments. Specific mutations in the PEPCK promoter are indicated on the horizontal axis.

8 0 -

7 0 -

6 0 -

5 0 - .- c 0 3

C u 4 0 - - 2 3 0 - L 0

2 0 -

1 0 -

- 1 1 z n

m m W Lt o r

?j

FIG. 9. Effect of cotransfection of the C subunit of PKA with expression vectors for CREB and C/EBP on the induction of PEPCK-CAT. HepG2 cells were transfected with 5 eg of PEPCK- CAT, 5 pg of RSV-CREB or MSV-C/EBP, 5 pg SR-PKA, and 2.5 pg of RSV-0-gal. Cells were harvested after 40 h and CAT assays performed as described in the legend to Fig. 3.

in Fig. 9, the C subunit of PKA caused a 40-fold stimulation in the presense of C/EBP. However CREB increased transcription from the PEPCK promoter 80-fold in the presence of C subunit of PKA. Taken together, our results suggest that cAMP induction of PEPCK gene transcription could involve the interaction of both C/EBP and CREB.

DISCUSSION

The acute transcriptional responsiveness of the PEPCK gene to both positive and negative regulation by hormones is a unique aspect of the rapid control of hepatic gluconeogene- sis. Considering the number of hormones and other effectors known to regulate PEPCK gene expression in the liver (Tilgh- man et al., 1976; Liu and Hanson, 1991), it is not surprising that the PEPCK promoter exhibits a high degree of complexity. These hormones interact with each other via multiple regulatory elements contained within a relatively small segment of the PEPCK promoter. For example, the region between -455 and -350, which is required for the glucocorticoid responsiveness of the PEPCK promoter, contains two glucocorticoid receptor binding sites as well as two additional binding sites for accessory factors (Imai et al., 1990). In addition, a sequence in the PEPCK promoter between -415 and -405, which corresponds to one of the glucocorticoid binding domains mentioned above, was also shown to be necessary for part of the inhibitory effect of insulin on transcription from the PEPCK promoter (O’Brien et al., 1990). In this paper, we used a series of block mutations in specific protein binding domains in the PEPCK promoter to determine their functional significance within an intact segment of the promoter and show that multiple elements in the promoter are involved in the basal and inducible transcription of the PEPCK promoter by CAMP. Elsewhere, we have demonstrated that cAMP can act synergistically with thyroid hormone (T3) to stimulate PEPCK gene transcription (Giralt et al.). The thyroid hormone receptor binds at -322 to -308 within the PEPCK promoter and functions in a synergistic manner with P3(I), but not with CRE-1. On the other hand, removal of the glucocorticoid-responsive domain by deletion at -355 or block mutations in the P6 and P5 region, which correspond to the binding sites for glucocorticoid receptor and accessory factor (AF) (Imai et al., 1990), did not affect induction of transcription by 8-Br-CAMP or the C subunit of PKA. This suggests that unlike T3, which shares a common regulatory element with CAMP, glucocorticoids and cAMP use entirely different elements in the PEPCK promoter to mediate their effects.

One surprising result from this study is the extent to which the C subunit of PKA-stimulated transcription from the PEPCK promoter when it was cotransfected into HepG2 cells with the PEPCK-CAT chimeric gene. It is likely that the concentration of free C subunit produced by cotransfection was significantly higher than the level of free subunit produced by cAMP treatment and that the transcription factorb) that mediates the cAMP effect was not limiting in HepG2 cells. Cotransfection of the expression vector for the C subunit of PKA has also been shown to stimulate transcription from the E3 promoter, c-fos promoter, and a-subunit promoter (Mellon et al., 1989). The large magnititude of transcriptional induction from the PEPCK promoter caused by the cotransfection of a PKA expression vector allowed us to define the role of the upstream elements, as well as CRE-1, in the cAMP responsiveness of the PEPCK promoter. The most significant difference in the effect of 8-Br-CAMP and the expression of the C subunit of PKA was noted with the P4 block mutation. It is possible that the C subunit of PKA induced the expression of an additional factor which binds to this site to stimulate transcription from the PEPCK promoter.

CRE-1 was among the first CAMP-responsive elements identified (Short et al., 1986; Bokar et al., 1988). However, this sequence alone was not sufficient for the full induction

M. Giralt, E. A. Park, J. Liu, A. L. Gurney, and R. W. Hanson, J. Biol. Chem., in press, November issue.


by CAMP. When the region from -109 to -68 was ligated to a neutral promoter and introduced into FTO-2B cells, the response to dibutyryl cAMP was much less robust than when a larger segment from -416 to -68 was utilized (Short et al., 1986). It was apparent from these studies that other elements, 5‘ to CRE-1, were required for the appropriate level of transcription from the PEPCK promoter.

Many different genes require multiple elements for complete hormonal responsiveness. Initial characterization of several CAMP-responsive genes identified the sequence TGACGTCA as a CAMP-inducible enhancer sequence, since an oligonucleotide containing this consensus sequence con- ferred cAMP responsivness to a neutral promoter (Montminy et al., 1986; Silver et al., 1987; Bokar et al., 1988; Sassone- Corsi et al., 1988). Later studies demonstrated that the nucleotides flanking this consensus sequence also affect the responsiveness to cAMP (Deutsch et al., 1988; Bokar et al., 1988). This consensus sequence is not the only element which can mediate the effect of CAMP. AP-2, an enhancer binding protein which binds to the promoter of the metallothionein IIA gene, is responsible for both the effect of cAMP and protein kinase C on transcription (Imagawa et al., 1987). The binding site for AP-1, TGA(G or C)TCA, which interacts with the family of Jun proteins, has been reported to mediate both the effect of cAMP and phorbol ester tumor promoters (TPA) in Jeg-3 and HepG2 cells (Deutsch et al., 1988). The promoter for the c-fos gene contains four elements that mediate cAMP responsiveness (Fisch et al., 1989; Berkowitz et al., 1989), and only one of these elements has been shown to be a consensus CRE sequence; others show homology with binding sequence AP-1 or AP-4 in the SV40 promoter (Angel et al., 1987; Lee et al., 1987; Mermod et al., 1988). The elements involved in the responsiveness to cAMP in the proenkephalin gene contain overlapping binding sites for a t least four factors, ENKTF-1, AP-1, AP-4, and AP-2, and these elements act synergistically to regulate CAMP-inducible transcription (Comb et al., 1988; Hyman et al., 1989). We have shown here that the PEPCK promoter contains two regions that are required for induction of transcription by CAMP.

Although CRE-1 and P3 are involved in the cAMP responsiveness of the intact promoter, these elements show differ- ences in function when two copies of either element are linked to a neutral promoter. Since neither one is sufficient for full transcriptional induction by cAMP in HepG2 cells, these elements must interact within the context of the PEPCK promoter to transmit their transcriptional effect. I t is not clear why in Jeg-3 cells two copies of CRE-1 ligated to the SV40 promoter are induced 30-fold by 8-Br-cAMP, and the same degree of stimulation is not observed with the HepG2 cell line. Most probably, CREB, which is present in high concentrations in Jeg-3 cells, binds to the CRE-1 sequence causing a marked induction of transcription. The intact PEPCK promoter responds very poorly to transcriptional induction by cAMP when transfected into Jeg-3 cells (data not shown), suggesting that additional liver-specific factors are required for the full induction of transcription from the PEPCK promoter by CAMP.

Is C/EBP Involved in the Induction of Transcription by CAMP?-C/EBP activated transcription from the PEPCK promoter by interacting at CRE-1 and P3(I) (Trus et al., 1990; Park et al., 1990). The presence of CRE-1 and P3(I) in the PEPCK promoter was required for the full trans-activation of gene transcription by both C/EBP and 8-Br-CAMP. A protein purified from rat liver nuclei by CRE-1 affinity chro- matography behaved like purified recombinant C/EBP in titration and competition studies with the PEPCK promoter.

This suggests that C/EBP or a C/EBP-like protein from rat liver nuclei interacts with the PEPCK promoter. To date, the only proteins which are known to bind to the P3(I) site are C/EBP or members of the C/EBP family of transcription factors. Since CREB did not bind to the P3(I) element, some member of the C/EBP family is likely to be involved in the cAMP response. However, since CRE-1 can interact with both C/EBP and CREB, the factor which binds to CRE-1 in vivo is not clear. The results of the “binding site switch” experiment described in this paper suggest the involvement of C/EBP in the cAMP response. A modified form of the PEPCK promoter which has a very poor affinity for CREB but two high affinity C/EBP sites, was equally responsive to 8-Br-CAMP. In contrast, our experiments cotransfecting CREB and PKA suggested that a greater responsiveness to cAMP can be obtained with CREB. Of course, more than one factor may be able to transmit the response to cAMP at the CRE-1 site of the PEPCK promoter.

It must be emphasized that our results are preliminary since C/EBP and CREB are members of a family of transcription factors which can form homo- and heterodimers and which are known to bind to similar sites in the promoters of specific genes (Descombes et al., 1990; Poli et al., 1990; Hai et al., 1989). One of these transcription factors, C/EBPP or liver activator protein (Decombes et al., 1990; Cao et al., 1991), also binds to the same sites on the PEPCK promoter as C/EBP and can stimulate the transcription of a PEPCK-CAT chimeric gene promoter when it is introduced into hepatoma cells.” A full understanding of the mechanism of action of cAMP on PEPCK gene transcription will require careful analysis of both the C/EBP and CREB families of transcription factors for their relative binding affinity, binding specificity, and tissue distribution.

The synergistic effect of cAMP on transcription from the PEPCK promoter is probably achieved through a complicated interaction of factors at several levels. The first level of interaction is within the enhancers themselves. CRE-1 can bind several transcription factors, which may compete for binding in response to physiological signals. On the other hand, the upstream region of the PEPCK promoter is composed of several adjacent and overlapping sites (P3(I), PS(I1) and P4), and protein-protein interactions are very likely involved within these elements. The second level of interaction may occur between the downstream CRE-1 and upstream element(s) either through cooperative binding to the DNA or protein-protein interaction or simultaneous modulation of the basal transcription factors at the TATA box. The third level of interaction is between elements involved in cAMP responsiveness and other hormones such as T3 or factors involved in the tissue-specific expression of the PEPCK gene. The specificity of these interactions may require the maintenance of both the spacing and alignment of elements in the PEPCK promoter.

It is clear that the complexity of transcriptional regulation of the PEPCK gene requires a critical evaluation of promoter elements in the context of the physiological effectors known to control transcription of the gene i n vivo. We have recently demonstrated that the PEPCK promoter, containing a block mutation in P3(I), linked to the bGH structural gene and introduced into the germ line of transgenic mice is expressed predominantly in the kidney rather than the liver and has a blunted response to dietary and hormonal regulati~n.~ This reinforces the conclusions of the present manuscript impli-

E. A. Park, A. L. Gurney, and R. W. Hanson, unpublished

Y. M. Patel, J. Liu, and R. W. Hanson, unpublished observations. observations.


cating P3(I) as important for the regulated expression of the PEPCK gene in the liver. Further studies relating our observations on the interactions between elements in the PEPCK promoter are currently being tested in transgenic mice containing a variety of chimeric genes with specific mutations in the PEPCK promoter to determine the physiological rele- vance of each of these elements in controlling PEPCK gene transcription in the intact animal.

REFERENCES Aden, D. P., Fogel, A., Plotkin, S., Damjanov, I., and Knowles, B.

(1979) Nature 282, 615-616 Angel, P., Imagawa, R., Chiu, R., Stein, B., Imhra, R. J., Rahmsdorf,

H. J., Jonat, C., Herrlich, P., and Karin, M. (1987) Cell 729-739 Berkowitz, L. A., Riabowol, K. T., and Gilman, M. Z. (1989) Mol.

Cell. Biol. 9, 4272-4281 Bokar, J. A., Roesler, W. J., Vandenbark, G. R., Kaetzel, D. M.,

Hanson R. W., and Nilson, J . H. (1988) J. Biol. Chem. 263,19740- 19747

Bosch, F., Hatzoglou, M., Park, E. A., and Hanson, R. W. (1990) J . Biol. Chem. 265,13677-13682

Bradford, M. M. (1976) Anal. Biochem. 72, 248-254 Cao, Z., Umek, R. M., and McKnight, S. C. (1991) Genes & Deu., in

Chu, D. T. W., and Granner, D. K. (1986) J. Biol. Chem. 261,16848- press

16853 Comb, M., Mermod, N., Hyman, S. E., Pearlberg, J., Ross, M. E., and

Goodman, H. M. (1988) EMBO J. 7,3793-3805 Davis, L. G., Dibner, M. D., and Buttey, J. F. (1986) Basic Methods

in Molecular Biology, Elsevier Science Publishing Co., Inc., New York

Descombes, P., Chojkier, M., Lichtsteiner, S., Falvey, E., and Schi- bler, U. (1990) Genes & Deu. 4, 1541-1551

Deutsch, P. J., Hoeffler, J . P., Jameson, J . L., and Habener, J. F. (1988a) Proc. Natl. Acud. Sci. U. S. A. 8 5 , 7922-7926

Deutsch, P. J . Hoeffler, J. P., Jameson, J. L., Lin, J. C., and Habener, J. F. (198813) J. Biol. Chem. 263, 18466-18472

Edelman, A. M., Blumenthal, D. K., and Krebs, E. G. (1987) Annu. Reu. Biochem. 56,567-613

Fisch, T. M., Prywes, R., Simon, M. C., and Roeder, R. G. (1989) Genes & Deu. 3 , 198-211

Giralt, M., Park, E. A., Liu, J., Gurney, A. L., and Hanson, R. W. (1991) J. Biol. Chem. 266, in press

Gonzalez, G. A., Yamamoto, K. K., Fischer, W. H., Karr, D., Menzel, P., Biggs, W., Vale, W. W., and Montminy, M. R. (1989) Nature

Granner, D. K., Andreone, T., Sasaki, K., and Beale, E. (1983) Nature

Hai, T., F. Liu, Coukos, W. J., and Green, M. R. (1989) Genes & Deu.

Hyman, S. E., Comb, M., Pearlberg, J., and Goodman, H. M. (1989)

Imagawa, M., Chiu, R., and Karin, M. (1987) Cell 51, 251-260 Imai, E., Stromstedt, P., Quinn, P. G., Carlstedt-Duke, J., Gunstafs-

son, J., and Granner, D. K. (1990) Mol. Cell. Biol. 1 0 , 4712-4719 Javitt, N. B. (1990) FASEB J . 4 , 161-168 Klemm, D. J., Roesler, W. J., Liu, J., Park, E. A,, and Hanson, R. W.

Kunkel. T. A. (1985) Proc. Natl. Acad. Sci. U. S. A . 82.488-492

337,749-752

305,549-551

3,2083-2090

Mol. Cell. Biol. 9, 321-324

(1990) Mol. Cell. Biol. 1 0 , 390-395

Natl. Acad. Sci. U. S. A. 79, 5137-5141 Landschulz, W. H., Johnson, P. F., and McKnight, S. L. (1989)

Lee, W., Mitchell, P., and Tjian, R. (1987) Cell 49, 741-752 Liu, J., and Hanson, R. W. (1991) Mol. Cell. Biochem., in press Liu, J., Roesler, W. J., and Hanson, R. W. (1990) BioTechniques 9,

Loose, D. S., Cameron, D. K., Short, H. P., and Hanson, R. W. (1985) Biochemistry 24,4509-4512

Magnuson, M. A., Quinn, P. G., and Granner, D. K. (1987) J. Biol. Chem. 262, 14917-14920

McGrane, M. M., devente, J., Yun, J., Bloom, J., Park, E., Wynshaw- Boris, A., Wagner, T., Rottman, F. M., and Hanson, R. W. (1988) J. Biol. Chem. 263,11443-11451

McGrane, M. M., Yun, J . S., Moorman, A. F. M., Lamers, W. H.,

Hanson, R. W. (1990) J. Biol. Chem. 265, 22372-22379 Hendrick, G. K., Arafa, B. M., Park, E. A., Wagner, T. E., and

Mead, D. A., Szczesna-Skorupa, E., and Kemper, B. (1986) Protein Eng. 1,67-74

Mellon, P. L, Clegg, C . H., Correll, L. A., and McKnight, G. S. (1989) Proc. Natl. Acad. Sci. U. S. A. 86,4887-4891

Mermod, N., Williams, T. J., and Tjian, R. (1988) Nature 332,557- 561

Miller, J . (1972) in Experiments in Molecular Genetics (Miller, J., ed) pp. 352-356, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

Montminy, M. R., Sevarino, K. A., Wagner, J . A,, Mandel, G., and Goodman, R. H. (1986) Proc. Natl. Acud. Sci. U. S. A. 8 3 , 6682- 6686

Muramatsu, M., Kaibuchi, K., and Arai, K. (1989) Mol. Cell. Biol. 9,

O’Brien, R. M., Lucas, P. C., Forest, C. D., Magnuson, M. A., and Granner, D. K. (1990) Science 249,533-537

Park, E. A., Roesler, W. J., Liu, J., Klemm, D. J., Gurney, A. L., Thatcher, J. D., Shuman, J., Friedman, A., and Hanson, R. W. (1990) Mol. Cell. Biol. 1 0 , 6264-6272

Science 243, 1681-1688

738-742

831-836

Poli, V., Mancini, F. P., and Cortese, R. (1990) Cell 63, 643-653 Quinn, P. A., Wong, T. W., Magnuson, M. A., Shabb, J . B., and

Granner, D. K. (1988) Mol. Cell. Biol. 8, 3467-3475 Roesler, W. J., Vandenbark, G. R., and Hanson, R. W. (1988) J. Biol.

Chem. 263,9063-9066 Roesler, W. J., Vandenbark, G. R., and Hanson, R. W. (1989) J. Biol.

Chem. 264,9657-9664 Sassone-Corsi, P., Visvader, J., Ferland, L., Mellon, P. L., and Verma,

I. M. (1988) Genes & Dev. 2,1529-1538 Short, J. M., Wynshaw-Boris, A., Short H. P., and Hanson, R. W.

(1986) J. Biol. Chem. 261,9721-9726 Silver, B. J., Bokar, J. A., Virgin, J. B., Vallen, E. A., Milstead, A.,

and Nilson, J. H. (1987) Proc. Natl. Acad Sci. U. S. A . 84, 2198- 2202

Tabor, T., and Richardson, C. C. (1987) Proc. Natl. Acad. Sci. U. S. A . 82,1074-1078

Taylor, S. S. (1989) J. Biol. Chem. 264,8843-8446 Tilghman, S. M., Hanson, R. W., and Ballard, J . F. (1976) in Gluco-

and Mehlman, M. A., eds) pp. 47-91 John Wiley & Sons, Inc., New neogenesis: Its Regulation in Mammalian Species (Hanson, R. W.,

York TNS, M., Benvenisty, N., Cohen, H., and Reshef, L. (1990) Mol. Cell.

Biol. 10,2418-2422 Wynshaw-Boris, A., Short, J. M., Loose, D. S., and Hanson, R. W.

(1986) J . Biol. Chem. 261,9414-9720 Yamamoto. K. K.. Gonzalez. G. A.. Brigns. W. H.. 111, and Montminy,

Lamars, W. H:, Hanson, R. W., and Meisner, H. M: (1982) Proc. M. R. (1988) Nature 334; 494-498 ~~

~I -_

Cyclic AMP Induction of Phosphoenolpyruvate Carboxykinase (GTP ...

Documents

Transcript of Cyclic AMP Induction of Phosphoenolpyruvate Carboxykinase (GTP ...