Endophyte-Mediated Modulation of Defense-Related Genesand Systemic Resistance in Withania somnifera (L.) Dunalunder Alternaria alternata Stress

Aradhana Mishra,a Satyendra Pratap Singh,a,b Sahil Mahfooz,a Surendra Pratap Singh,c Arpita Bhattacharya,a Nishtha Mishra,a

C. S. Nautiyala

aDivision of Plant Microbe Interaction, Council of Scientific and Industrial Research-National Botanical ResearchInstitute, Lucknow, India

bDepartment of Microbiology, Mewar University, Gangrar, Chittorgarh, IndiacPlant Molecular Biology Laboratory, CSIR-National Botanical Research Institute, Lucknow, India

ABSTRACT Endophytes have been explored and found to perform an importantrole in plant health. However, their effects on the host physiological function anddisease management remain elusive. The present study aimed to assess the poten-tial effects of endophytes, singly as well as in combination, in Withania somnifera (L.)Dunal, on various physiological parameters and systemic defense mechanisms againstAlternaria alternata. Seeds primed with the endophytic bacteria Bacillus amyloliquefa-ciens and Pseudomonas fluorescens individually and in combination demonstrated anenhanced vigor index and germination rate. Interestingly, plants treated with thetwo-microbe combination showed the lowest plant mortality rate (28%) under A. al-ternata stress. Physiological profiling of treated plants showed improved photosyn-thesis, respiration, transpiration, and stomatal conductance under pathogenic stress.Additionally, these endophytes not only augmented defense enzymes and antioxi-dant activity in treated plants but also enhanced the expression of salicylic acid- andjasmonic acid-responsive genes in the stressed plants. Reductions in reactive oxygenspecies (ROS) and reactive nitrogen species (RNS) along with enhanced callose depo-sition in host plant leaves corroborated well with the above findings. Altogether, thestudy provides novel insights into the underlying mechanisms behind the tripartiteinteraction of endophyte-A. alternata-W. somnifera and underscores their ability toboost plant health under pathogen stress.

IMPORTANCE W. somnifera is well known for producing several medicinally importantsecondary metabolites. These secondary metabolites are required by various pharmaceu-tical sectors to produce life-saving drugs. However, the cultivation of W. somnifera facessevere challenge from leaf spot disease caused by A. alternata. To keep pace with therising demand for this plant and considering its capacity for cultivation under field con-ditions, the present study was undertaken to develop approaches to enhance produc-tion of W. somnifera through intervention using endophytes. Application of bacterial en-dophytes not only suppresses the pathogenicity of A. alternata but also mitigatesexcessive ROS/RNS generation via enhanced physiological processes and antioxidantmachinery. Expression profiling of plant defense-related genes further validates the effi-cacy of bacterial endophytes against leaf spot disease.

KEYWORDS endophytes, Bacillus amyloliquefaciens, Pseudomonas fluorescens,Alternaria alternata, Withania somnifera

According to the FAO, it has been estimated that nearly 80% of people in devel-oping countries rely on plant-derived drugs for their health care, which reflects the

high global importance of medicinal plants (1). Withania somnifera (L.) Dunal, popularly

Received 3 January 2018 Accepted 30January 2018

Accepted manuscript posted online 16February 2018

Citation Mishra A, Singh SP, Mahfooz S, Singh SP,Bhattacharya A, Mishra N, Nautiyal CS. 2018.Endophyte-mediated modulation of defense-related genes and systemic resistance in Withaniasomnifera (L.) Dunal under Alternaria alternatastress. Appl Environ Microbiol 84:e02845-17.https://doi.org/10.1128/AEM.02845-17.

Editor Emma R. Master, University of Toronto

Copyright © 2018 American Society forMicrobiology. All Rights Reserved.

Address correspondence to Aradhana Mishra,mishramyco@yahoo.com.

Aradhana Mishra and Satyendra Pratap Singhcontributed equally to this work.

PLANT MICROBIOLOGY

crossm

April 2018 Volume 84 Issue 8 e02845-17 aem.asm.org 1Applied and Environmental Microbiology

on June 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

known as “Ashwagandha,” is an erect, evergreen, perennial, branched undershrub thathas been extensively used in traditional medicinal systems for over 3,000 years. Thetherapeutic properties of this plant are attributed to its ample number of therapeuti-cally important compounds, such as alkaloids, withanolides, glycowithanolides, flavanolglycosides, steroidal lactones, and polyphenolics (2). With a worldwide increase indemand for herbal products and compounds obtained from W. somnifera, the need toboost its commercial cultivation has been accentuated. In India, about 1,500 metrictons (1,500,000 kg) of W. somnifera plant parts are produced through cultivation, incontrast to an annual requirement of about 7,000 metric tons (7,000,000 kg) (3). Undernatural conditions, the plant is vulnerable to a number of pests and pathogens, amongwhich leaf spot disease, caused by Alternaria alternata, is considered the most promi-nent one (4, 5).

To date, only a few chemical fungicides, like bavistin, mancozeb, antracol, andcaptra, were found to be effective in inhibiting A. alternata spore germination indose-dependent manners (6). Due to the adverse effects of chemical fungicides, asuitable biological control of leaf spot disease of W. somnifera is the need of the hourfor better yield and sustainable agriculture. Thus, to find safer and eco-friendly strate-gies to manage the pathogenicity of A. alternata in W. somnifera, exploitation ofbacterial endophytes as biocontrol agents is an intriguing alternative to the use ofchemical fungicides. Antagonistic endophytic microbes are promising groups of mi-croorganisms that can provide frontline resistance and encourage growth by differentmodes of actions (7–9). Host plant resistance against the diverse group of pathogensis provoked by various microbial elicitors, i.e., those linked with a range of defenseregulatory enzymes, such as phenylalanine ammonia lyase (PAL), peroxidase (PO),polyphenol oxidase (PPO), superoxide dismutase (SOD), catalase (CAT), ascorbate per-oxidase (APx), guaiacol peroxidase (GPx), and induced accumulation of phenols andflavonoids (10). The increased activity of the antioxidant and reactive oxygen species(ROS)-scavenging machinery may also be important in the resistance process observedin plants (11). Plant-pathogen-microbe interaction is a complex process and must bestudied at multiple levels (structural, physiological, and biochemical levels) usingdifferent approaches. Understanding the microbe-pathogen-associated changes in thehost is a prerequisite for designing a target-based approach for disease management.The expression level of defense-induced genes during disease progression in W.somnifera has been previously described (12–14). However, to date, no informationregarding the possible mechanism of the synergistic effect of bacterial endophytes onhost physiology along with the modulation of the defense signaling pathway to endurebiotic stress is available. Considering the above facts, efforts were made to examine theeffects of synergistic antagonistic endophytes on the structural, physiological, andbiochemical parameters and the possible defense mechanism adopted by W. somniferaunder A. alternata stress.

RESULTSEffects of selected isolates on plant biomass and mortality. Application of the

endophytic bacterial isolates, viz., Bacillus amyloliquefaciens and Pseudomonas fluore-scens (Fig. 1), singly and in combination, caused significant differences in plant biomassand mortality compared to the pathogen (A. alternata)-inoculated, non-endophyte-treated control plants (Fig. 2). Plants treated with a combination of the two microbialendophytes (here referred to as combination treatment) significantly enhanced thevigor index (1.47-fold) and seed germination (1.32-fold) compared to control plants (seeFig. S1 in the supplemental material). Treatment with endophytes significantly (P �

0.05) promoted plant growth in term of fresh and dry yield when plants were grown inpots with or without fungal infection (Table 1). Compared to controls, plants treatedwith the endophytes showed a significant enhancement in fresh and dry weight (1.7-to 2.5-fold and 1.43- to 2.19-fold, respectively) (Table 1). A. alternata infection signifi-cantly suppressed plant growth compared to that seen in noninfected pots. After A.alternata inoculation, the efficacy of treatment with endophytes against the pathogen

Mishra et al. Applied and Environmental Microbiology

April 2018 Volume 84 Issue 8 e02845-17 aem.asm.org 2

on June 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

was demonstrated by a drastic reduction in plant mortality (Table 1). The most efficientpathogen management occurred with the combination treatment (P � 0.05), whichyielded 28% plant mortality, followed by use of B. amyloliquefaciens singly (36%) and P.fluorescens singly (40%) (Table 1). The correlation analysis was further confirmed by the

FIG 1 Scanning electron micrographs of mycolytic activity of bacterial endophytes B. amyloliquefaciens (BA) and P. fluorescens (PF) againstA. alternata (AA).

FIG 2 Effects of endophytic bacteria B. amyloliquefaciens (BA) and P. fluorescens (PF) singly as well as in combinationon W. somnifera during A. alternata (AA) infection under greenhouse conditions.

Endophyte-Mediated Disease Resistance in W. somnifera Applied and Environmental Microbiology

April 2018 Volume 84 Issue 8 e02845-17 aem.asm.org 3

on June 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

fact that linear and significant associations were observed among various plant growthparameters (see Table S1 in the supplemental material).

Physiological performance of plants under different treatments. Microbial ap-plication significantly ameliorated the plants’ physiological performance under bioticstress by increasing the rate of photosynthesis, ranging from 1.83- to 2.67-fold incre-ments compared to the rate seen in infected control plants (Fig. 3a). The leaf transpi-ration rate was diminished progressively in all treatments compared to their respectivecontrols. Plants treated with microbes showed 1.46- to 2.7-fold increments comparedto the infected plants, and the maximum value was recorded for combination-treatedplants (2.7-fold) (Fig. 3b). Similarly, greater levels of stomatal conductance were ob-served (1.65-, 1.75-, and 2.58-fold) with the application of P. fluorescens, B. amylolique-faciens, and combination treatments, respectively (Fig. 3c). Water use efficiency (WUE)was found to be maximal under B. amyloliquefaciens (1.30-fold), P. fluorescens (1.10-fold), and combination (2.10-fold) treatments in plants undergoing pathogenic stress(Fig. 3d), whereas the leaf average relative conductivity of the infected plants waselevated up to 1.73-fold in the combination treatment compared to control plants,signifying that the leaf plasma membrane was injured because of pathogenicity(Fig. 3e). Additionally, the levels of total chlorophyll, carotenoids, and anthocyanin wereimproved after B. amyloliquefaciens (2.16-, 1.97-, and 2.09-fold), P. fluorescens (2.11-,1.53-, and 2.31-fold), and the combination (2.46-, 2.34-, and 2.57-fold) treatmentscompared to the pathogen-infected control (Fig. 4a to d). Positive and direct associa-tions were found between net photosynthesis and stomatal conductance (r � 0.92),between transpiration rate and net photosynthesis (r � 0.92), and between transpira-tion rate and stomatal conductance (r � 0.86). Similarly, WUE and anthocyanin werefound to be correlated with net photosynthesis (r values of 0.84 and 0.903, respec-tively), stomatal conductance (r values of 0.84 and 0.80, respectively), and transpirationrate (r values of 0.95 and 0.74, respectively) (Table S1).

Plant defense and antioxidant enzyme profiling. In our study, temporal altera-tions were observed at 24 to 96 h after pathogen inoculation (hapi) in defense andantioxidant enzymes. Significantly, the highest phenylalanine ammonia lyase (PAL)activity was observed in B. amyloliquefaciens- and P. fluorescens-treated plants (1.68- to2.35-fold) after 24 hapi, and this activity was slightly reduced at 72 hapi (1.61- to2.15-fold) compared to what was observed in infected plants (see Fig. S2a in thesupplemental material). The maximum PPO activity (2.03-fold) was observed to behigher at 72 hapi in the combination-treated plants than in the infected control (Fig.S2b). To further investigate the impact of potent inducers during pathogenicity, totalphenolic content was monitored in all treatments at different time intervals. The levelof total phenolics showed a pattern similar to that of PAL and was higher in the plantstreated with the two endophytes (109.65 mmol gallic acid g�1 fresh weight [FW]) at 48hapi under pathogenic stress conditions (Fig. S2c).

In an early response to pathogen infection, alterations in the levels of the differentROS-scavenging molecules were also monitored over a period of 24 to 96 hapi. The

TABLE 1 Effects of endophytic bacteria B. amyloliquefaciens and P. fluorescens singly as well as in combination in W. somnifera inoculatedwith pathogen A. alternata for promotion of plant health parameters and mortality rate under greenhouse conditionsa

Treatment Shoot length (cm) Root length (cm) Fresh wt (g) Dry wt (g) Mortality rate (%)

Control 41.60 � 1.38ab 11.20 � 1.50a 31.88 � 1.22c 7.74 � 1.30a 0.00 � 0.00d

Control � AA 32.40 � 2.07b 8.60 � 1.11a 19.38 � 1.51d 5.56 � 1.40a 76.00 � 2.30a

BA � AA 48.60 � 1.96ab 13.20 � 1.23a 37.36 � 1.52bc 8.58 � 1.20a 36.20 � 2.13b

PF � AA 43.80 � 1.80ab 11.80 � 1.57a 33.00 � 0.58c 7.98 � 0.60a 40.50 � 1.15b

BA � PF � AA 45.80 � 2.42ab 16.20 � 1.15a 41.42 � 1.48ab 11.04 � 0.55a 28.60 � 1.09c

BA 52.60 � 1.40a 18.80 � 1.15a 39.04 � 2.04bc 9.08 � 11.68a 0.00 � 0.00d

PF 48.20 � 1.03ab 13.80 � 2.03a 34.82 � 1.78bc 8.54 � 2.57a 0.00 � 0.00d

BA � PF 56.40 � 1.38a 19.00 � 1.70a 49.26 � 1.58a 12.18 � 2.20a 0.00 � 0.00d

aValues are means � standard errors (SE) for three replicates. Means followed by the same lowercase letter(s) within a column are not significantly different accordingto Tukey’s multiple-comparison test (P � 0.05). The data presented are from representative experiments that were repeated at least twice with similar results. BA, B.amyloliquefaciens; PF, P. fluorescens; AA, A. alternata.

Mishra et al. Applied and Environmental Microbiology

April 2018 Volume 84 Issue 8 e02845-17 aem.asm.org 4

on June 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

levels of SOD and PO activities were observed to increase constantly and achieved amaximum at 72 hapi in the combination treatment (2.23- and 2.3-fold, respectively),followed by plants treated with a single inoculation with pathogen, and finally theinfected control plants (Fig. S2d and S2e). However, a decrease in the activity of lipidperoxidation (LPX) was detected in all the single-microbe-treated as well as thecombination-treated plants throughout the experimental period compared to non-treated, infected plants. Moreover, the maximum reduction in LPX (3.10-fold) wasobserved in the combination-treated plants under pathogenic stress (Fig. S2f). Further,the highest CAT activity was recorded in the combination-treated plants (1.37-fold) at72 hapi (Fig. S3a). The maximum APx activity was observed in combination-treated

FIG 3 Effects of endophytic bacteria B. amyloliquefaciens (BA) and P. fluorescens (PF) singly as well as in combinationon net photosynthesis (a), transpiration rate (b), stomatal conductance (c), water use efficiency (WUE) (d), andrelative conductivity (e) of W. somnifera in the presence and absence of A. alternata. Error bars represent thestandard errors for six replicates. Significance of differences between treatments and pathogen control: *, P � 0.05;**, P � 0.01; NS, nonsignificant.

Endophyte-Mediated Disease Resistance in W. somnifera Applied and Environmental Microbiology

April 2018 Volume 84 Issue 8 e02845-17 aem.asm.org 5

on June 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

plants with pathogen inoculation and was initiated early (24 hapi) with 71.9 U, reachinga maximum of 112.33 U (1.70-fold increase) at 72 hapi and after that remaining stable(Fig. S3b). Similarly, GPx and total flavonoid content (TFC) activities in the combinationtreatment challenged with A. alternata were significantly higher (1.77- and 1.91-fold,respectively) at 72 hapi and further declined at 96 hapi compared to A. alternata controlplants (Fig. S3c and S3d). The results obtained from the present study were furthervalidated by principal-component analysis (PCA), as clustering of different treatmentswas observed, with the first group having healthy control and endophyte-treatedplants without pathogen, the second with pathogen-inoculated control (Control � AA),the third with single-microbe treatment (B. amyloliquefaciens or P. fluorescens) withpathogen, and the fourth with the two-microbe combination treatment with pathogen(Fig. 5). The combination treatment with pathogen formed a separate cluster in whichthe defense- and antioxidant-related parameters such as PAL, PPO, total phenoliccontent (TPC), SOD, CAT, PO, APx, GPx, and TFC were increased and LPX and plantmortality were significantly reduced (Fig. 5).

Histological detection of H2O2, O2�, and cell death. The maximum DAB (3,

3=-diaminobenzidine) polymerization (brown color deposition) was detected in theleaves of control plants challenged with pathogen, whereas no visible deposition waslocalized in the leaves of microbe-treated plants under pathogenic stress (Fig. 6a). Also,less localization was observed in single-microbe (B. amyloliquefaciens or P. fluorescens)inoculation treatments of plants infected with pathogen. Similarly, leaves stained withNitro Blue Tetrazolium (NBT) dye for the detection of the superoxide (O2

�) free radicalsshowed a significant enhancement in the level of superoxide radicals in pathogen-infected plants only, which was observed as a purple deposition on treated leaves (Fig.6b). However, the combination-treated plants showed a reduction in superoxide radical

FIG 4 Effects of endophytic bacteria B. amyloliquefaciens (BA) and P. fluorescens (PF) singly as well as in combinationon total chlorophyll a � b (a), total chlorophyll a/b (b), carotenoids (c), and anthocyanin (d) contents of W.somnifera in the presence and absence of A. alternata. Error bars represent the standard errors for six replicates.Significance of differences between treatments and pathogen control: *, P � 0.05; **, P � 0.01; NS, nonsignificant.

Mishra et al. Applied and Environmental Microbiology

April 2018 Volume 84 Issue 8 e02845-17 aem.asm.org 6

on June 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

formation. Additionally, trypan blue staining further confirmed the potential role ofendophytes in programmed cell death (PCD), as less colorization was seen in theendophyte-treated plants than in the infected control (Fig. 6c).

Detection of ROS, RNS, and callose deposition. High deposition levels of callosein guard cells were found in the leaves of plants treated with the two microbes,whereas infected controls showed only necrotic regions of infection (Fig. 7). Theindividual microbial treatments were also able to immunize the leaf tissue (by callosedeposition) against pathogenic stress (Fig. 7). Furthermore, H2DCFDA (2=,7=-dichlorodihydrofluorescein diacetate) was used to determine the level of reactiveoxygen species in treated leaves (Fig. 7). This observation demonstrated that thecombination-treated plants efficiently reduced the effect of pathogenicity, which wasevident through lesser ROS detection than in the pathogen-alone control (Fig. 7).Similarly, the detection of NOS-like activity by DAF-FM DA (4-amino-5-(N-methylamino)-2=,7=-difluorofluorescein diacetate) staining revealed an intensification of fluorescencesignal in the pathogenic control compared to healthy control (Fig. 7). The intensity ofnitric oxide (NO) was further completely abolished in the combination-treated plantsunder stress conditions, suggesting that the endophytes effectively suppressed thetoxic effects of a nitro-oxidative burst. Additionally, in the individual microbial treat-ments smaller amounts of NO were localized near the guard cell (primary site of theinfection) (Fig. 7).

Expression analysis of genes confirming defense. The expression levels ofpathogenesis-related (PR) genes were analyzed to further validate the contribution of

FIG 5 Principal-component analysis (PCA) of various defense enzymes, plant growth, and mortality with respect to different treatments, viz., B. amyloliquefaciens(BA) and P. fluorescens (PF) singly as well as in combination, in the presence and absence of A. alternata (AA) (shown by circles).

Endophyte-Mediated Disease Resistance in W. somnifera Applied and Environmental Microbiology

April 2018 Volume 84 Issue 8 e02845-17 aem.asm.org 7

on June 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

both inducers (B. amyloliquefaciens and P. fluorescens) in induction of plant resistance.Most of the defense-modulating genes showed maximum upregulation in thecombination-treated plants at 72 hapi. Among all genes, the maximum increment wasobserved in lignin-forming anionic peroxidase (39.9-fold), followed by PR-3 (a class IVchitinase), PR-3 (a class II chitinase), PR-12 (defensin), hevein-like protein (HEL), lipoxy-genase (LOX), �-1,3-glucanase, and PR-1 with 18.70-, 16.22-, 14.64-, 13.1-, 10.90-, 10.40-,and 7.23-fold-greater expression at 72 hapi in the combination-treated plants underpathogen stress (Fig. 8; see also Fig. S4, S5, S6, and S7 in the supplemental material).Furthermore, in pathogen-infected controls, a gradual reduction in fold expressionincrease was recorded as the severity of pathogenicity increased, while the othertreatments showed the reduction after 72 hapi. The expression levels of 12 defense andoxidative stress responsive marker genes in W. somnifera at different time intervals areshown as an expression matrix (Fig. 8).

FIG 6 Histochemical detection of H2O2 by DAB staining (a), superoxide radical by NBT staining (b), and pro-grammed cell death by trypan blue (c) in leaves of W. somnifera by DAB staining after treatment with endophyticbacteria inoculated with or without A. alternata (AA). Control, untreated and uninoculated; control � AA, untreated,A. alternata inoculated; BA, B. amyloliquefaciens used singly; PF, P. fluorescens used singly; BA � PF, B. amyloliq-uefaciens and P. fluorescens used in combination.

FIG 7 Microscopic detection of callose deposition and reactive oxygen and nitrogen species (magnification, �10; bar, 100 �m) in leaves of W. somnifera aftertreatment with endophytic bacteria inoculated with or without A. alternata (AA). Control, untreated and uninoculated; control � AA, untreated, A. alternatainoculated; BA, B. amyloliquefaciens used singly; PF, P. fluorescens used singly; BA � PF, B. amyloliquefaciens and P. fluorescens used in combination.

Mishra et al. Applied and Environmental Microbiology

April 2018 Volume 84 Issue 8 e02845-17 aem.asm.org 8

on June 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

DISCUSSION

This study clearly demonstrated that when applied singly and in combination, B.amyloliquefaciens and P. fluorescens enhanced the tolerance of W. somnifera plantsagainst biotic stress at both physiological and molecular levels. The enhanced seedgermination, seedling vigor index, and yield attributes along with reduced mortalityrate could be possibly due to the growth-promoting properties of endophytes. Thehigher availability of nutrients might be effectively utilized by the plant, which resultedin its enhanced growth. Similar results have been reported in previous studies in whichthe enhanced seed germination and seedling vigor index were observed in endophyte-treated seeds over the control (15, 16).

It was previously suggested that the progression of foliar disease caused a devas-tating effect on the plant’s physiological processes, i.e., net photosynthesis, stomatalconductance, transpiration rate, and water use efficiency (17). When pathogens invadethe leaves, they can either pass through the stomatal pores or breach the cuticle (18).This might lead to a decrease in net photosynthetic rate and a disruption in themetabolic pathways of pathogen control. The findings were well corroborated with aprevious report in which plant photosynthesis, transpiration rate, stomatal conductivity,and water use efficiency were found to be higher in microbe-treated chickpea plantsinfected with Sclerotium rolfsii (19). The rate of photosynthesis is interconnected withstomatal apertures and water use efficiency. The fungal infection affects the plantphotosynthetic pathway via decreasing the activity of mesophyll cells and ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) along with disruption of stomatal reg-ulation during transpiration (20). The improved rate of photosynthesis, stomatal con-ductance, transpiration rate, and water use efficiency in endophyte-treated plants maybe the explanation for the low plant mortality. The incremental rise in the photosyn-thesis rate might accelerate one or more mechanisms, such as those promoting anincrease in the concentrations of chlorophyll, anthocyanin, and carotenoids, which areaccompanied by enhanced plant growth (21).

Under various biotic stresses, a decrease in the generation of ROS and RNS initiatesprogrammed cell death and therefore performs a vital role in suppressing the patho-genic infection (22). ROS include H2O2 and O2

�, which are frequently accumulated inthe plant tissues as by-products of several biochemical reactions and whose productionis triggered by pathogen invasion (23). Alternatively, the decrease in localization of ROS,RNS, H2O2, O2

�, and PCD in endophyte-treated plants might be due to the potentialityof endophytes that enhance the antioxidant machinery, such as SOD, CAT, PO, APx,GPx, and TFC. These findings corroborated well with a previously published resultwhereby these antioxidants were found to be higher in chickpea treated with endo-phytes under pathogenic stress than in untreated chickpea (8).

FIG 8 Differential expression of pathogenesis-related genes in W. somnifera inoculated with endophytic bacteria B. amyloliquefaciens (BA) and P. fluorescens (PF)singly as well as in combination, with and without challenge with pathogen A. alternata. The heat map was generated based on the fold change values in thetreated samples compared with untreated pathogen-challenged control plants. The color scale for fold change values is shown at the top.

Endophyte-Mediated Disease Resistance in W. somnifera Applied and Environmental Microbiology

April 2018 Volume 84 Issue 8 e02845-17 aem.asm.org 9

on June 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Since our results confirmed reductions in ROS, RNS, H2O2, O2�, and PCD, which are

reported to play a role in defense mechanisms, in endophyte-treated plants, we nextstudied the level of defense enzymes in different treatments. In the present study, theselected endophytes not only reduced plant mortality and but also systemically stim-ulated tolerance via enhancing the host plant defense system. Collectively, the im-proved activities of PAL, PPO, and TPC, which are essential defense enzymes of plants,can be positively correlated with the enhanced host resistance under pathogenic stress(24). The stimulation of phenolics is directly interconnected with disease resistance aswell as plant resistance against fungal phytopathogens. Additionally, generation ofphenols is also connected with PAL activity, which is well known to stimulate resistanceto biotic stress in the host plants (25). The enhanced level of LPX in pathogen-infectedplants could also be integrated with higher plant mortality. In addition to the above-described defense enzymes, callose plays a vital function in plants’ defensive systemagainst pathogens and strengthens cell walls during pathogenic invasion (26). The PCAfurther reconfirmed maximum accumulation of defense and antioxidant-related pa-rameters such as PAL, PPO, TPC, SOD, PO, CAT, APx, GPx, and TFC in the combinationtreatment with pathogen.

Plants employ several mechanisms to protect themselves against various pathogeninfections, which include the activation of defense-related genes, resulting in thesynthesis of various antimicrobial substances (27). Most of the defense-related genesare induced by the activation of different signaling molecules such as salicylic acid (SA),jasmonic acid (JA), or ethylene (ET) to govern antimicrobial activity via hydrolysis offungal cells, synthesis of toxic substances, and stimulation of antioxidants (28). In thepresent study, the biocontrol efficiency of endophytes against leaf spot disease in W.somnifera was further validated by the expression profiling of SA- and JA-responsivegenes. The temporal upregulation of defense response genes was recorded in plantssubjected to the combination treatment under pathogenic stress, which is directly orindirectly involved in inducing the host plant immunity. Overall, the previous findingsof the lowest mortality of pathogen-infected plants after application of endophytes intomato (7), olive (29), rice (30), and chickpea (8) via SA- or JA-mediated defensemechanisms were further proved in the present study.

Results of the present investigation suggest that endophytic bacteria B. amyloliq-uefaciens and P. fluorescens in the inert tissues of W. somnifera possibly execute asignificant role in enhancing physiological performance, the expression of defensegenes, including those encoding enzymes, and callose deposition under biotic stress.Additionally, we have demonstrated that the interaction between endophytes andfungal pathogen leads to significant alterations in ROS-mitigating pathways in the hostplant. Our findings strongly highlight reduced pathogen growth in two-microbecombination-treated plants compared to growth in non-endophyte-treated controls,showing the potential of these microbes to act as resistance inducers. For futureprospects, we propose that the reduction of the pathogenicity of leaf spot disease bythe application of these endophytes can improve the health of W. somnifera undernatural conditions.

MATERIALS AND METHODSHost-pathogen-endophyte interaction under greenhouse conditions. Freshly grown cultures of

pure endophytic bacterial isolates Bacillus amyloliquefaciens KT962915 and Pseudomonas fluorescensKY630510 were incubated at 28 � 2°C on a rotary shaker (120 rpm) for 24 h for mass production, andthe pellet density was maintained in 0.85% saline to 1 � 108 CFU ml�1. We previously isolated B.amyloliquefaciens and P. fluorescens with high antifungal and chitinase activity against A. alternata (Fig.1). The fungal pathogen A. alternata was isolated from naturally infected leaves of W. somnifera (4), andits spore suspension was maintained at up to 3 � 105 spores ml�1. Surface-sterilized (with 2% NaOCl)seeds of W. somnifera (NMITLI-135) were coated with selected isolates, individually as well as incombination (1:1, vol/vol) by using 2% (wt/vol) carboxyl methyl cellulose (HiMedia, India) in 0.85% saline.Treated seeds were propagated according to the treatments in the growth chamber (12-h photoperiodat 24 � 2°C) for 15 days. After proper germination, seedlings of uniform length (7 to 9 cm; 2-leaf stage)were transplanted in plastic pots (15 cm by 10 cm) filled with 0.5 kg sandy soil. The treatments were asfollows: B. amyloliquefaciens and P. fluorescens singly and in combination were inoculated with or withoutpathogen along with two controls, one noninfected and the other infected with the pathogen, respec-

Mishra et al. Applied and Environmental Microbiology

April 2018 Volume 84 Issue 8 e02845-17 aem.asm.org 10

on June 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

tively. A spore suspension of A. alternata was applied on the aerial part of the plant 1 week aftertransplantation (4). Simultaneously, B. amyloliquefaciens and P. fluorescens individually and in combina-tion were further introduced to the aerial part of plants soon after pathogen treatment. All the treatedplants were arranged in a randomized block design under greenhouse conditions with 12 replicates, andthe experiment was repeated three times.

Physiological performance. Physiological parameters, such as root length, shoot length, freshweight, dry weight, and mortality rate, were recorded at the fruiting stage of the plant (19). Furthermore,the percentage of seed germination and the vigor index of treated seeds were determined by using the“between-paper method” (31). Fundamental plant processes such as net photosynthesis (A), stomatalconductance (gs), transpiration (E), and water use efficiency (WUE) were observed in the completeextended leaf (at the 3rd node of the plant) at the flowering stage by using the LI-COR 6400 gasexchange portable photosynthesis system (LI-COR, Lincoln, NE, USA). Subsequently, the concentrationsof anthocyanin, carotenoid, and chlorophyll in the treated plants were estimated by spectrophotometricassays (32–34).

Defense-related enzymes and antioxidant profiling. Seedlings of W. somnifera were harvestedregularly at 0, 24, 48, 72, and 96 h after pathogen inoculation (hapi). Plants were uprooted randomly fromeach pot and stored in liquid nitrogen. Plant material (1 g) from each treatment was homogenized inextraction buffer (10 mM sodium phosphate buffer, pH 6.0, containing 1% [wt/vol] polyvinylpolypyrro-lidone, 0.3 mM phenylmethylsulfonyl fluoride, and 1 mM EDTA) at 4°C. All the enzymatic assays wererepeated six times in triplicate.

Phenylalanine ammonia lyase (PAL) activity was analyzed and calculated by using the calibrationcurve of mole trans-cinnamic acid gram�1 protein hour�1 (35). The activity of phenol peroxidase (PPO)was expressed as change in optical density (OD) minute�1 gram�1 FW, and the absorbance was recordedat 495 nm at 30-s intervals up to 3 min (36). Total phenolic content (TPC) was expressed as gallic acidequivalent gram�1 of plant tissue (37). Superoxide dismutase (SOD) activity was examined by evaluatingits efficacy to inhibit photochemical reduction of NBT (Nitro Blue Tetrazolium) using the riboflavin-methionine system (38). Further, peroxidase (PO) activity was measured by the addition of enzymaticextract (50 �l) in 0.05 M pyrogallol and 1% H2O2 (39). The lipid peroxidation (LPX) activity of treatedleaves was determined using thiobarbituric acid (TBA) and was expressed as nanomole gram�1 FW (40).Catalase (CAT) activity was determined on the basis of the rate of oxidation of H2O2 (41). Ascorbateperoxidase (APx) was measured according to a previously described method (42) and was expressed asnanomole ascorbate oxidized minute�1 milligram�1 protein. Glutathione peroxidase (GPx) was measuredaccording to the protocol of Hemeda and Klein (43) and was expressed as units at 470 nm (milligramprotein)�1 minute�1. Total flavonoid content (TFC) was calculated as described earlier (44).

Histochemical detection of H2O2, O2�, and programmed cell death. DAB (3,3=-diaminobenzidine)

staining was carried out to detect the H2O2 in plant leaves (45). Leaves were collected after 72 h of A.alternata infection and stained in sodium phosphate buffer (10 mM; pH 7.0) containing DAB (1 mg ml�1)and 0.05% Tween 20. Brown depositions on the surface of leaves were localized after 4 to 5 h ofincubation in staining solution in the dark. Stained leaves were fixed in bleaching solution (ethanol-aceticacid-glycerol, 3:1:1 [vol/vol]) at 40°C until the complete elimination of chlorophyll. Leaves were visualizedagainst a contrasting background for proper documentation. For superoxide detection, leaves wereimmersed in a staining solution (10 mM potassium phosphate buffer, pH 7.8, containing 0.1% NBT and10 mM sodium azide) and were infiltrated under vacuum (�10,000 to 11,500 Pa) for 2 to 5 min andfurther incubated for 2 to 3 h in the dark (46). The reaction was stopped by the addition of bleachingsolution at 40°C. Purple depositions on leaves indicated the presence of superoxide radicals. Trypan bluestaining was carried out to detect cell death in treated leaves (47). Briefly, the leaves were placed instaining solution containing trypan blue overnight at room temperature and subsequently bleachedusing bleaching solution prior to visualization.

Detection of ROS, RNS, and callose deposition. For ROS localization, treated leaves were immersedin H2DCF-DA (Molecular Probes, Invitrogen) solution for 5 min and washed with phosphate buffer (47).Green fluorescence on the adaxial side of leaves was visualized under a confocal laser scanningmicroscope (Carl Zeiss LSM 510 META) with excitation at 480/40 nm and emission at 527/30 nm. For RNS,the treated leaves were incubated in a 20 �M solution of DAF-FM DA for 30 min in the dark. Afterincubation, the leaf samples were washed with 20 mM phosphate buffer (pH 7.0) and were visualizedunder the microscope with excitation at 488 nm and emission at 505/30 nm (48). To detect the callosedeposition, the leaves were placed in K2HPO4 (150 mM; pH 9.5) containing 0.1% aniline blue for 1 hfollowed by washing with sterile distilled water, and the stained leaves were examined under themicroscope (49).

Real-time gene expression profiling of defense-related genes. Total RNA was extracted fromleaves of different treatment groups along with their respective controls by using the plant total RNA kit(Sigma-Aldrich). The cDNA was reverse transcribed by 5 �g of total RNA with oligo(dT) primer (ThermoFisher Scientific, United States). A reverse transcription quantitative-PCR (qRT-PCR) was carried out in aStratagene Mx3005P instrument (Agilent Technologies, USA) using Brilliant III Ultra-Fast SYBR green qPCRmaster mix (Agilent Technology, USA). Actin was used as a control, and the primers used in this studyare listed in Table 2. The heat map was generated using MEV software. The various treatments areclustered according to the similarity of their gene expression using hierarchical clustering.

Statistical analysis. The results were analyzed using SPSS version 18.0 software with advancedmodels (SPSS Japan, Tokyo, Japan). Differences between means were analyzed using Tukey’s multiple-comparison test (P � 0.05). The Student t test was used for statistical analysis of the data in theexperiments of gas exchange parameters and defense enzyme/gene(s) between control and treated

Endophyte-Mediated Disease Resistance in W. somnifera Applied and Environmental Microbiology

April 2018 Volume 84 Issue 8 e02845-17 aem.asm.org 11

on June 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

plants. Linear correlation coefficients were calculated among various physiological and biochemicalparameters. The principal-component analysis (PCA) was applied to produce components suitable to beused as response variables in the present analysis.

SUPPLEMENTAL MATERIAL

Supplemental material for this article may be found at https://doi.org/10.1128/AEM.02845-17.

SUPPLEMENTAL FILE 1, PDF file, 2.0 MB.

ACKNOWLEDGMENTSThe study was supported by project “Root SF–BSC 0204” funded by Council of

Scientific and Industrial Research (CSIR), New Delhi, India.

REFERENCES1. Pan SY, Litscher G, Gao SH, Zhou SF, Yu ZL, Chen HQ, Zhang SF, Tang MK,

Sun JN, Ko KM. 2014. Historical perspective of traditional indigenousmedical practices: the current renaissance and conservation of herbalresources. Evid Based Complement Alternat Med 2014:525340. https://doi.org/10.1155/2014/525340.

2. Sangwan NS, Sangwan RS. 2014. Secondary metabolites of traditionalmedical plants: a case study of Ashwagandha (Withania somnifera), p325–367. In Nick P, Opatrny Z (ed), Applied plant cell biology: cellulartools and approaches for plant biotechnology. Springer, Berlin, Ger-many.

3. Umadevi M. 2012. Traditional and medicinal uses of Withania somnifera.Pharma J 1:102–110.

4. Sharma A, Vats SK, Pati PK. 2014. Post-infectional dynamics of leaf spotdisease in Withania somnifera. Ann Appl Biol 165:429 – 440. https://doi.org/10.1111/aab.12148.

5. Pati PK, Sharma M, Salar RK, Sharma A, Gupta AP, Singh B. 2008. Studieson leaf spot disease of Withania somnifera and its impact on secondarymetabolites. Indian J Microbiol 48:432– 437. https://doi.org/10.1007/s12088-008-0053-y.

6. Shivanna MB, Parashurama TR, Achar KGS, Vasanthakumari MM. 2014.Fungal foliar diseases in Withania somnifera and its effect on secondarymetabolites. Plant Biosyst 148:907–916. https://doi.org/10.1080/11263504.2013.845266.

7. Shahzad R, Khan AL, Bilal S, Asaf S, Lee IJ. 2017. Plant growth-promotingendophytic bacteria versus pathogenic infections: an example of Bacillusamyloliquefaciens RWL-1 and Fusarium oxysporum f. sp. lycopersici intomato. Peer J 5:e3107. https://doi.org/10.7717/peerj.3107.

8. Singh SP, Gaur R. 2017. Endophytic Streptomyces spp. underscore induc-tion of defense regulatory genes and confers resistance against Sclero-tium rolfsii in chickpea. Biol Control 104:44 –56. https://doi.org/10.1016/j.biocontrol.2016.10.011.

9. Soares MA, Li J-Y, Bergen M, da Silva JM, Kowalski KP, White JF. 2015.Functional role of an endophytic Bacillus amyloliquefaciens in enhancinggrowth and disease protection of invasive English ivy (Hedera helix L.).Plant Soil 405:107–123. https://doi.org/10.1007/s11104-015-2638-7.

10. Daayf F, El Hadrami A, El-Bebany AF, Henriquez MA, Yao Z, Derksen H,El-Hadrami I, Adam LR. 2012. Phenolic compounds in plant defense andpathogen counter-defense mechanisms, p 191–208. In Cheynier V, Sarni-Manchado P, Quideau S (ed), Recent advances in polyphenol research, vol3. Wiley-Blackwell, Hoboken, NJ. https://doi.org/10.1002/9781118299753.ch8.

11. Rogers H, Munne-Bosch S. 2016. Production and scavenging of reactiveoxygen species and redox signaling during leaf and flower senescence:similar but different. Plant Physiol 171:1560 –1568. https://doi.org/10.1104/pp.16.00163.

12. Ghosh Dasgupta M, George BS, Bhatia A, Sidhu OP. 2014. Characteriza-tion of Withania somnifera leaf transcriptome and expression analysis ofpathogenesis-related genes during salicylic acid signaling. PLoS One9:e94803. https://doi.org/10.1371/journal.pone.0094803.

13. Singh AK, Dwivedi V, Rai A, Pal S, Reddy SG, Rao DK, Shasany AK,Nagegowda DA. 2015. Virus-induced gene silencing of Withania som-nifera squalene synthase negatively regulates sterol and defence-relatedgenes resulting in reduced withanolides and biotic stress tolerance.Plant Biotechnol J 13:1287–1299. https://doi.org/10.1111/pbi.12347.

14. Singh G, Tiwari M, Singh SP, Singh S, Trivedi PK, Misra P. 2016. Silencingof sterol glycosyltransferases modulates the withanolide biosynthesisand leads to compromised basal immunity of Withania somnifera. SciRep 6:25562. https://doi.org/10.1038/srep25562.

15. Cope-Selby N, Cookson A, Squance M, Donnison I, Flavell R, Farrar K.2017. Endophytic bacteria in Miscanthus seed: implications for germina-tion, vertical inheritance of endophytes, plant evolution and breeding.GCB Bioenergy 9:57–77. https://doi.org/10.1111/gcbb.12364.

16. Hardoim PR, van Overbeek LS, Berg G, Pirttila AM, Compant S, Campi-sano A, Doring M, Sessitsch A. 2015. The hidden world within plants:ecological and evolutionary considerations for defining functioning ofmicrobial endophytes. Microbiol Mol Biol Rev 79:293–320. https://doi.org/10.1128/MMBR.00050-14.

17. Wang M, Sun Y, Sun G, Liu X, Zhai L, Shen Q, Guo S. 2015. Water balancealtered in cucumber plants infected with Fusarium oxysporum f. sp.cucumerinum. Sci Rep 5:7722. https://doi.org/10.1038/srep07722.

TABLE 2 Details of primer pairs for pathogenesis-related genes in W. somnifera used for qRT-PCR data

Gene Protein Forward/reverse primer sequences, 5=–3= Reference

WsAct Actin AGATATTCAGCCTCTTGTCTGTG/ATTGAGCCTCATCACCAACATA Dasgupta et al. (12)WsPR1 PR-1-type pathogenesis-related protein GCTTCTCATCGACCCACATCTT/GGAAAGCGGCGGCTAGA Singh et al. (13)WsB13G �-1,3-Glucanase (WsB13G) ACATTGCTTCGTCTATCAAAGTTTC/CACCATGAGGTAAGAACCAGTT Dasgupta et al. (12)WsCHTN1 JA-dependent-class I chitinase (PR-3) CCCCATGAATAGGGACCATCT/GAGAAGTCTGAGCCAGAAAGGC Singh et al. (13)WsCHTNII Class II chitinase (PR-3) CACAAGACAACAAGCCATCATG/TAGAATCCAATTCGATCATCCACTT Dasgupta et al. (12)WsCHTNIV Class IV chitinase (PR-3) CTTCAAGCAATAATGGAGGTTCAG/CTCACGCTTAGAATCATCAGTAGA Dasgupta et al. (12)WsTHAU Thaumatin-like protein (PR-5) ACGTCTTTGACACCGATGAATA/ACATAGTCAGTAGAAGAGCAAGTG Dasgupta et al. (12)WsSPI Serine protease inhibitor-like protein (PR-6) ATGCCCGTCAAATTCATTAAGTTT/TCCTCCAGTCTCCAACAATCTA Dasgupta et al. (12)WsHEL JA-dependent hevein-like protein (PR-4) AATGTTGATCCTGGGGAAAAC/GCATCGACCTCATTCAAACAT This studyWsPRX Lignin-forming anionic peroxidase (PR-9) TCCACATTCTATGATCGCACTT/AACGCAGTCTTCTCACTAACAA Dasgupta et al. (12)WsPR10 JA-dependent PR-10-type pathogenesis

related-protein (PR-10)AGTTGCTCATATAGAAGTCAAGTGT/TCCATCATAGTTCAATCTCCATTCA Dasgupta et al. (12)

WsDFSN Defensin (PR-12) TGCTGGTTTTTGCTACTGAGGCA/CAGAAGCAACGGCGACGGAATC Dasgupta et al. (12)WsLOX JA-dependent lipoxygenase (LOX) GCTGAATGGACAAAGGACAAA/CACCTTCACTTGTTGGGAAAA This study

Mishra et al. Applied and Environmental Microbiology

April 2018 Volume 84 Issue 8 e02845-17 aem.asm.org 12

on June 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

18. Grimmer MK, John Foulkes M, Paveley ND. 2012. Foliar pathogenesis andplant water relations: a review. J Exp Bot 63:4321– 4331. https://doi.org/10.1093/jxb/ers143.

19. Singh SP, Gaur R. 2016. Evaluation of antagonistic and plant growthpromoting activities of chitinolytic endophytic actinomycetes associatedwith medicinal plants against Sclerotium rolfsii in chickpea. J App Micro-biol 121:506 –518. https://doi.org/10.1111/jam.13176.

20. Dallagnol LJ, Rodrigues FA, Chaves ARM, Vale FXR, DaMatta FM. 2013.Photosynthesis and sugar concentration are impaired by the defectiveactive silicon uptake in rice plants infected with Bipolaris oryzae. PlantPathol 62:120 –129. https://doi.org/10.1111/j.1365-3059.2012.02606.x.

21. Zhang H, Zhong H, Wang J, Sui X, Xu N. 2016. Adaptive changes inchlorophyll content and photosynthetic features to low light in Physo-carpus amurensis Maxim and Physocarpus opulifolius “Diabolo”. PeerJ4:e2125. https://doi.org/10.7717/peerj.2125.

22. Das K, Roychoudhury A. 2014. Reactive oxygen species (ROS) and re-sponse of antioxidants as ROS-scavengers during environmental stressin plants. Front Environ Sci 2:53. https://doi.org/10.3389/fenvs.2014.00053.

23. Chavan SB, Deshpande MV. 2013. Chitinolytic enzymes: an appraisal asa product of commercial potential. Biotechnol Prog 29:833– 846. https://doi.org/10.1002/btpr.1732.

24. Araji S, Grammer TA, Gertzen R, Anderson SD, Mikulic-Petkovsek M,Veberic R, Phu ML, Solar A, Leslie CA, Dandekar AM, Escobar MA. 2014.Novel roles for the polyphenol oxidase enzyme in secondary metabo-lism and the regulation of cell death in walnut. Plant Physiol 164:1191–1203. https://doi.org/10.1104/pp.113.228593.

25. Cheynier V, Comte G, Davies KM, Lattanzio V, Martens S. 2013. Plantphenolics: recent advances on their biosynthesis, genetics, andecophysiology. Plant Physiol Biochem 72:1–20. https://doi.org/10.1016/j.plaphy.2013.05.009.

26. Luna E, Pastor V, Robert J, Flors V, Mauch-Mani B, Ton J. 2011. Callosedeposition: a multifaceted plant defense response. Mol Plant MicrobeInteract 24:183–193. https://doi.org/10.1094/MPMI-07-10-0149.

27. Wang Y, Bouwmeester K, van de Mortel JE, Shan W, Govers F. 2013.Induced expression of defense-related genes in Arabidopsis upon infec-tion with Phytophthora capsici. Plant Signal Behav 8:e24618. https://doi.org/10.4161/psb.24618.

28. van Loon LC, Rep M, Pieterse CM. 2006. Significance of inducibledefense-related proteins in infected plants. Annu Rev Phytopathol 44:135–162. https://doi.org/10.1146/annurev.phyto.44.070505.143425.

29. Gomez-Lama Cabanas C, Schiliro E, Valverde-Corredor A, Mercado-Blanco J. 2014. The biocontrol endophytic bacterium Pseudomonas fluo-rescens PICF7 induces systemic defense responses in aerial tissues uponcolonization of olive roots. Front Microbiol 5:427. https://doi.org/10.3389/fmicb.2014.00427.

30. Shahzad R, Waqas M, Khan AL, Asaf S, Khan MA, Kang SM, Yun BW, LeeIJ. 2016. Seed-borne endophytic Bacillus amyloliquefaciens RWL-1 pro-duces gibberellins and regulates endogenous phytohormones of Oryzasativa. Plant Physiol Biochem 106:236 –243. https://doi.org/10.1016/j.plaphy.2016.05.006.

31. Abdul-Baki AA, Anderson JD. 1973. Vigor determination in soybean seedby multiple criteria. Crop Sci 13:630 – 633. https://doi.org/10.2135/cropsci1973.0011183X001300060013x.

32. Arnon DI. 1949. Copper enzymes in isolated chloroplasts. Polyphenoloxi-dase in Beta vulgaris. Plant Physiol 24:1–15.

33. Lichtenthaler HK, Ac A, Marek MV, Kalina J, Urban O. 2007. Differences inpigment composition, photosynthetic rates and chlorophyll fluores-cence images of sun and shade leaves of four tree species. Plant PhysiolBiochem 45:577–588. https://doi.org/10.1016/j.plaphy.2007.04.006.

34. Nakata M, Mitsuda N, Herde M, Koo AJK, Moreno JE, Suzuki K, Howe GA,Ohme-Takagi M. 2013. A bHLH-type transcription factor, ABA-induciblebHLH-type transcription factor/JA-associated Myc2-like1, acts as a re-pressor to negatively regulate jasmonate signaling in Arabidopsis. PlantCell 25:1641–1656. https://doi.org/10.1105/tpc.113.111112.

35. Nagarathna KC, Shetty SA, Shetty HS. 1993. Phenylalanine ammonialyase activity in pearl millet seedlings and its relation to downy mildewdisease resistance. J Exp Bot 44:1291–1296. https://doi.org/10.1093/jxb/44.8.1291.

36. Mohammadi M, Kazemi H. 2002. Changes in peroxidase and polyphenoloxidase activities in susceptible and resistant wheat heads inoculatedwith Fusarium graminearum and induced resistance. Plant Sci 162:491– 498. https://doi.org/10.1016/S0168-9452(01)00538-6.

37. Ainsworth EA, Gillespie KM. 2007. Estimation of total phenolic contentand other oxidation substrates in plant tissues using Folin-Ciocalteureagent. Nat Protoc 2:875– 877. https://doi.org/10.1038/nprot.2007.102.

38. Fridovich I. 1974. Superoxide dismutases. Adv Enzymol Relat Areas MolBiol 41:35–97.

39. Hammerschmidt R, Nuckles EM, Kuc J. 1982. Association of enhancedperoxidase activity with induced systemic resistance of cucumber toColletotrichum lagenarium. Physiol Plant Pathol 20:73– 82. https://doi.org/10.1016/0048-4059(82)90025-X.

40. Schmidt A, Kunert KJ. 1986. Lipid peroxidation in higher plants: the roleof glutathione reductase. Plant Physiol 82:700 –702. https://doi.org/10.1104/pp.82.3.700.

41. Aebi HE. 1983. Catalase, p 273–286. In Bergmeyer HU (ed), Methods ofenzymatic analysis, vol 2. Academic Press, New York, NY.

42. Nakano Y, Asada K. 1981. Hydrogen peroxide is scavenged byascorbate-specific peroxidase in spinach chloroplasts. Plant CellPhysiol 22:867– 880.

43. Hemeda HM, Klein BP. 1990. Effects of naturally occurring antioxidantson peroxidase activity of vegetable extracts. J Food Sci 55:184 –185.https://doi.org/10.1111/j.1365-2621.1990.tb06048.x.

44. Chang CC, Yang MH, Wen HM, Chern JC. 2002. Estimation of totalflavonoid content in propolis by two complementary colorimetric meth-ods. J Food Drug Anal 10:178 –182.

45. Bindschedler LV, Dewdney J, Blee KA, Stone JM, Asai T, Plotnikov J,Denoux C, Hayes T, Gerrish C, Davies DR, Ausubel FM, Bolwell GP. 2006.Peroxidase-dependent apoplastic oxidative burst in Arabidopsis re-quired for pathogen resistance. Plant J 47:851– 863. https://doi.org/10.1111/j.1365-313X.2006.02837.x.

46. Wohlgemuth H, Mittelstrass K, Kschieschan S, Bender J, Weigel HJ,Overmyer K, Kangasjärvi J, Sandermann H, Langebartels C. 2002. Acti-vation of an oxidative burst is a general feature of sensitive plantsexposed to the air pollutant ozone. Plant Cell Environ 25:717–726.https://doi.org/10.1046/j.1365-3040.2002.00859.x.

47. Pogany M, von Rad U, Grun S, Dongo A, Pintye A, Simoneau P, BahnwegG, Kiss L, Barna B, Durner J. 2009. Dual roles of reactive oxygen speciesand NADPH oxidase RBOHD in an Arabidopsis-Alternaria pathosystem.Plant Physiol 151:1459 –1475. https://doi.org/10.1104/pp.109.141994.

48. Piterková J, Petrivalský M, Luhová L, Mieslerová B, Sedlárová M, LebedaA. 2009. Local and systemic production of nitric oxide in tomato re-sponses to powdery mildew infection. Mol Plant Pathol 10:501–513.https://doi.org/10.1111/j.1364-3703.2009.00551.x.

49. Gupta R, Singh A, Srivastava M, Singh V, Gupta MM, Pandey R. 2017.Microbial modulation of bacoside A biosynthetic pathway and systemicdefense mechanism in Bacopa monnieri under Meloidogyne incognitastress. Sci Rep 7:41867. https://doi.org/10.1038/srep41867.

Endophyte-Mediated Disease Resistance in W. somnifera Applied and Environmental Microbiology

April 2018 Volume 84 Issue 8 e02845-17 aem.asm.org 13

on June 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from