CROMATINA EE CROMOSOMI - .cromatina. Tipicamente un Tipicamente un nucleosoma nucleosoma ¨...

download CROMATINA EE CROMOSOMI - .cromatina. Tipicamente un Tipicamente un nucleosoma nucleosoma ¨ costituito

of 27

  • date post

    16-Feb-2019
  • Category

    Documents

  • view

    224
  • download

    0

Embed Size (px)

Transcript of CROMATINA EE CROMOSOMI - .cromatina. Tipicamente un Tipicamente un nucleosoma nucleosoma ¨...

CROMATINACROMATINA

E E E E

CROMOSOMICROMOSOMI

UNAUNA SCALA SCALA DIDI GRANDEZZE (GRANDEZZE (E. coliE. coli))

4,64 Mb4,64 Mb

RNA + proteine RNA + proteine HistonHiston--likelike+ + DNADNA

TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCTGAGACCAGTGTTCCTGTAGTTACCCCTACAGCTAGCACAGCCCCTCCGGTTCCCGCAACTGCTCCTTCTCCTGCTCCTGCCGTTGCAGCTGCTGCTGCTGCCACTACTGCTGCCACCGCCGCTGCCACCACCACTACCACCACCTCCGCTGCCACCGCCACCACTGCTCCTCCTGCTCTAGATATCTTTGGTGATTTATTTGAGTCCACTCCTGAAGTTGCTGCAGCGCCTAAGCCAGATGCTGCTCCTAGCATAGACCTGTTTAGTACAGATGCTTTCTCCTCTCCACCACAAGGGGCCTCTCCTGTGCCTGAGAGTTCTCTCACTGCTGACCTCTTATCTGTGGATGCATTTGCAGCACCATCTCCTGCAACCACTGCCTCGCCAGCAAAGGTGGATTCTTCAGGTGTCATAGACCTTTTTGGGGATGCATTTGGAAGTAGCGCTTCTGAACCCCAACCTGCATCTCAGGCTGCTTCTAGTTCATCAGCATCGGCAGACCTACTAGCTGGATTTGGGGGTTCTTTCATGGCGCCTTCCCCATCTCCAGTGACTCCAGCTCAGAATAACCTGCTACAGCCCAATTTTGAGGCAGCTTTTGGGACAACGCCTTCAACTTCCAGCAGCAGCTCCTTTGATCCATCAGTGTTTGATGGTCTAGGTGATCTTTTGATGCCAACCATGGCACCAGCTGGGCAGCCTGCACCTGTCTCAATGGTACCACCCAGTCCTGCAATGGCAGCCAGCAAAGCCCTTGGAAGTGATCTTGATTCATCTCTTGCCAGCTTAGTAGGCAATCTTGGAATTTCTGGTACCACAACAAAAAAGGGAGATCTTCAGTGGAATGCTGGAGAGAAAAAGTTGACTGGTGGAGCCAACTGGCAGCCTAAAGTAGCTCCAGCAACCTGGTCAGCAGGCGTTCCACCAAGTGCACCTTTGCAAGGAGCTGTACCTCCAACCAGTTCAGTTCCTCCTGTTGCCGGGGCCCCATCGGTTGGACAACCTGGAGCAGGATTTGGAATGCCTCCTGCTGGGACAGGCATGCCCATGATGCCTCAGCAGCCGGTCATGTTTGCACAGCCCATGATGAGGCCCCCCTTTGGAGCTGCCGCTGTACCTGGCACGCAGCTTTCTCCAAGCCCTACACCTGCCAGTCAGAGTCCCAAGAAACCTCCAGCAAAGGACCCATTAGCGGATCTTAACATCAAGGATTTCTTGTAAACAATTTAAGCTGC

3*109

150*106

UNAUNA SCALA SCALA DIDI GRANDEZZE (GRANDEZZE (H. sapiensH. sapiens))= ca. 1,7 mt.

(devono rientrare in unospazio ristretto di 5 um)

TCAGAGTCCCAAGAAACCTCCAGCAAAGGACCCATTAGCGGATCTTAACATCAAGGATTTCTTGTAAACAATTTAAGCTGCAATATTTGTGACTGAATAGGAAAATAAATGAGTTTGGAGACTTCAAATAAGATTGATGCTGAGTTTCAAAGGGAGCCACCAGTACCAAACCCAATACTTACTCATAACTTCTCTTCCAAAATGTGTAACACAGCCGTGAAAGTGAACATTAGGAATATGTACTACCTTAGCTGTTATCCCTACTCTTGAAATTGTAGTGTATTTGGATTATTTGTGTATTGTACGATGTAAACAATGAATGGATGTTACTGATGCCGTTAGTGCTTTTTTGGACTTCACCTGAGGACAGATGATGCAGCTGTTGTGTGGCGAGCTATTTGGAAAGACGTCTGTGTTTTTGAAGGTTTCAATGTACATATAACTTTTGAACAAACCCCAAACTCTTCCCATAAATTATCTTTTCTTCTGTATCTCTGTTACAAGCGTAGTGTGATAATACCAGATAATAAGGAAAACACTCATAAATATACAAAACTTTTTCAGTGTGGAGTACATTTTTCCAATCACAGGAACTTCAACTGTTGTGAGAAATGTTTATTTTTGTGGCACTGTATATGTTAAGAAATTTTATTTTAAAAAATATAAAGGTTAACGTCCATAATAAATACTTCTCTTTGAAGCTACCTTATCAAGAACGAAAAATCGTATGGGAAGAATCCCCTATTTATCACTGCTATATTAAAATATATATATTTTAATTATATTTGACAGGTTTTGCATCTAAATTGACCTATTTATTCATTCTTGATTAAATGCACTGAAAAGTAAAGGGTCTGTTTGTGTCATGTTCATGAAAATGCGGTTAGAGAGGTGCTATTCAAGTGATTCTGAAGGCACCCCAAGGTATATCTGTAATTTAAAGATTACTGCAAATATCTTTACTTTACTGTGGGTTTTTAGTACATCTGTTAATTTAGTGTTTCTTTGTGTGTTTTGTAGACTAGTGTTCTTCCATCCTTCAACTGAGCTCAAAGTAGGTTTTGTTGTAACATTGTGATTAGGATTTAAACTAATTCAGAGAATTGTATCTTTTACTGTACATACTGTATTCTTTAAGTTTTAATTTGTTGTCATACTGTCTGTGCTGATGGCTTGGCTTAAGATTTTGATGCATAAATGAGGTCACTGTTGATCAGTGTTGCTAGTAGCTTGGCAGCTCTTCATAAAAGCATATTGGGTTGGAAAGGTGTTTGCCTATTTTTCAAATTATTTAATAGATGTATGGTACCATTTAAAAGTGGTTGTATCTGAATTTACTGTGGGGATAACATACACTGTAATGGGGAAAAATTACCTAAAACCAATTTCAAAATGGCTTTCTTTGTATTTCAGTTTAAAAACCCAGTGCATGTACGCCCTCTGAGATGCAATAAACACCTTGAACAAAG

150*106

1-5*106

La cromatina

La cromatina una costruzione sovramolecolare costituita sovramolecolare costituita

dalle molecole di DNA genomicoe

da due diverse classi di proteine

Le proteine della cromatina sono:

Gli istoni

Proteine non istoniche

Gli istoniGli istoniSono presenti nel nucleo in quantit

pressoch uguale a quella del DNA

Sono proteine ricche di carica elettrica Sono proteine ricche di carica elettrica

positiva perch ricche di aminoacidi basici

(lisina e arginina)

Possono essere suddivise in 2 classi

Classi di istoniClassi di istoni

Classe 1: H2A H2B H3 H4(Formano strutture ottameriche rocchetti intorno ai quali

si avvolge il DNA- che permettono la prima fase di

compattamento: collana di perle)compattamento: collana di perle)

Classe 2: H1

NOTA: Gli Istoni H2A H2B H3 H4 sono tra le proteine pi

conservate dal punto di vista evolutivo: la loro sequenza aminoacidica

estremamente simile in tutti gli esseri viventi

I I nucleosominucleosomiI I nucleosominucleosomi sono lunit fondamentale dellasono lunit fondamentale della

cromatina. cromatina.

Tipicamente un Tipicamente un nucleosomanucleosoma costituito da un costituito da un corecore di di istoni (istoni (ottameroottamero composto da due tetrameri, ciascunocomposto da due tetrameri, ciascuno

dei quali costituito dagli istoni H2A, H2B, H3 ed H4).dei quali costituito dagli istoni H2A, H2B, H3 ed H4).

intorno al quale si avvolge il DNA per circa 146 intorno al quale si avvolge il DNA per circa 146 bpbp..

Lorganizzazione base della cromatina una struttura a collana di perle

Un segmento di DNA della lunghezza di 140 bp si avvolge attorno ad ogni ottamero di istoni (la

perla), formandovi circa due giri che aderiscono stabilmente alla superficie dellottamero

mediante legami ionici

La molecola di DNA (il filo) si estende con continuit per tutta la sua lunghezza da un

nucleosoma allaltro, lasciando tra loro un tratto di collegamento di circa 60 bp (DNA DNA linkerlinker)di collegamento di circa 60 bp (DNA DNA linkerlinker)

La presenza dellistone H1 d origine ad

una struttura pi compatta di 30nm

(Fibra di 30 nm)(Fibra di 30 nm)

ISTONI + DNA + ISTONI + DNA + PROT. NON ISTONICHE =PROT. NON ISTONICHE =CROMATINACROMATINA. [NOTA: GLI. [NOTA: GLI

ISTONI, OLTRE A ISTONI, OLTRE A NEUTRALIZ=NEUTRALIZ=ZARE LE CARICHE NEGATIVE ZARE LE CARICHE NEGATIVE

DEL DNA DEL DNA COSA CHE PERMETTECOSA CHE PERMETTEA DIVERSE MOLECOLE A DIVERSE MOLECOLE DIDIDNA ADDOSSATE LUNA DNA ADDOSSATE LUNA

ALLALTRA ALLALTRA DIDI NON RESPINGERSINON RESPINGERSI--,,SONO LE PROTEINESONO LE PROTEINE

RESPONSABILI DEL GRADO RESPONSABILI DEL GRADO DIDICOMPATTAMENTO DELLA COMPATTAMENTO DELLA

CROMATINA STESSACROMATINA STESSACROMATINA STESSACROMATINA STESSA

eucromatina: meno condensata e corrisponde a zone in cui vi un'intensa attivit di trascrizione per la sintesi proteica(ossia di copiatura delle molecole di DNA in molecole di RNAmessaggero, mRNA)eterocromatina: pi condensata, non presenta attivit ditrascrizione.

LLeucromatinaeucromatina sempre attiva da un punto di sempre attiva da un punto di

vista vista trascrizionaletrascrizionale..

LLeterocromatinaeterocromatina si distingue in:si distingue in:

CostitutivaCostitutiva (resta sempre allo stato di (resta sempre allo stato di I.I. CostitutivaCostitutiva (resta sempre allo stato di (resta sempre allo stato di

massimo compattamento in tutte le cellule, massimo compattamento in tutte le cellule,

non viene mai trascritta);non viene mai trascritta);

II.II. FacoltativaFacoltativa (viene inattivata in modo specifico (viene inattivata in modo specifico

in alcune fasi della vita dellorganismo)in alcune fasi della vita dellorganismo)

Le differenze strutturali tra i due tipi di Le differenze strutturali tra i due tipi di

cromatina possono essere imputate acromatina possono essere imputate a::

A.A. Una diversa interazione tra il DNA Una diversa interazione tra il DNA linkerlinker e e

listone H1;listone H1;

B.B. Un diverso stato di acetilazione degli istoni;Un diverso stato di acetilazione degli istoni;B.B. Un diverso stato di acetilazione degli istoni;Un diverso stato di acetilazione degli istoni;

C.C. Un diverso stato di fosforilazione che interessa Un diverso stato di fosforilazione che interessa

in particolare listone H2B;in particolare listone H2B;

D.D. Metilazione degli istoni;Metilazione degli istoni;

E.E. UbiquitinazioneUbiquitinazione o o sumolazionesumolazione degli istonidegli istoni

Si definisce Si definisce cromosomacromosoma una struttura una struttura

molto compatta e colorabile,molto compatta e colorabile,

visibile al microscopio ottico durante la visibile al microscopio ottico durante la

divisione cellulare, in particolaredivisione cellulare, in particolare

durante la metafase, quando viene durante la metafase, quando viene

raggiunto il massimo livello di raggiunto il massimo livello di

compattamento della cromatina (spessore compattamento della cromatina (spessore

di circa 1400 di circa 1400 nmnm))

Braccio corto (p)

Braccio lungo (q)

I cromosomi sono I cromosomi sono dicromatidicidicromatidici, fatti da , fatti da 2 cromatidi fratelli2 cromatidi fratelli (duplicati in (duplicati in

fase S), associati a livello del centromero.fase S), associati a livello del centromero.

Le proteine Le proteine centromerichecentromeriche che tengono uniti tra di loro i cromatidi fratelli che tengono uniti tra di loro i cromatidi fratelli

prendono il nome di prendono il nome di coesinecoesine..

NellaNella Specie Specie UmanaUmana Il Il CorredoCorredo CromosomicoCromosomico paripari a 46. a 46.

CromosomiCromosomi OmologhiOmologhi: : NellaNella specie specie umanaumana sonosono presentipresenti due due copiecopie per per ciascunciascun

cromosomacromosoma, , pertantopertanto ii 46 46 cromosomicromosomi corrispondonocorrispondono a 23 a 23 coppiecoppie. .

L'UltimaL'Ultima coppiacoppia didi CromosomiCromosomi (23) (23) CromosomiCromosomi SessualiSessuali, , determinadetermina ilil sessosesso

dell'Individuodell'Individuo. La . La coppiacoppia XX XX determinadetermina la la femminafemmina, , mentrementre la la coppiacoppia XY XY

determinadetermina