Critical Role of Endogenous Akt/IAPs and MEK1/ERK Pathways ... · extracellular signal-regulated...

Critical Role of Endogenous Akt/IAPs and MEK1/ERK Pathways

in Counteracting ER Stress-Induced Cell Death

Ping Hu 1*,Zhang Han 2*, Anthony D. Couvillon1 and John H.Exton1+

1Howard Hughes Medical Institute, Department of Molecular Physiology and Biophysics,

Vanderbilt University Medical Center, Nashville, TN 37232 2Department of Urologic

Surgery, Vanderbilt University Medical Center, Nashville, TN 37232

* These authors contributed equally to this work.

+To whom correspondence should be addressed:

John H. Exton, M.D. Ph.D.

702 Light Hall, Department of Molecular Physiology and Biophysics, Vanderbilt University

Medical center, Nashville, TN 37232-0615, Phone:615-322-6494, Fax: 615-322-4381

[email protected]

Running Title: Survival responses to ER stress

Key words: Akt; ERK; IAP; ER stress; unfolded protein response

JBC Papers in Press. Published on August 31, 2004 as Manuscript M407700200

Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on July 13, 2020http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

ABSTRACT

Endoplasmic reticulum (ER) stress has been implicated in the pathogenesis of many diseases

and in cancer therapy. Although the unfolded protein response (UPR) is known to alleviate

ER stress by reducing the accumulation of misfolded proteins, the exact survival elements

and their downstream signaling pathways that directly counteract ER stress-stimulated

apoptotic signaling remain elusive. Here, we have shown that endogenous Akt and

extracellular signal-regulated protein kinase (ERK) are rapidly activated and act as

downstream effectors of phosphatidylinositol 3-kinase (PI-3K) in thapsigargin- or

tunicamycin- induced ER stress. Introduction of either dominant-negative Akt or MEK1 or

the inhibitors LY294002 or U0126 sensitized cells to ER stress- induced cell death in different

cell types. RT-PCR analysis of gene expression during ER stress revealed that cIAP-2 and

XIAP, members of inhibitor of apoptosis proteins (IAPs) family of potent caspase

suppressors, were strongly induced. Transcription of cIAP-2 and XIAP was upregulated by

the PI-3K/Akt pathway as shown by its reversal by dominant-negative Akt or LY294002.

Ablation of these IAPs by RNA interference sensitized cells to ER stress- induced death

which was reversed by the caspase inhibitor zVAD-fmk. The protective role of IAPs in ER

stress coincided with Smac release from mitochondria to cytosol. Furthermore, it was shown

that mTOR was not required for Akt-mediated survival. These results represent the first

demonstration that activation of endogenous Akt/IAPs and MEK/ERK plays a critical role in

controlling cell survival by resisting ER stress- induced cell death signaling.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

INTRODUCTION

The endoplasmic reticulum (ER) is a highly dynamic organelle that synthesizes and folds

intra-organellar, secretory and transmembrane proteins. Disruption of ER homeostasis

interferes with protein folding and leads to the accumulation of unfolded and misfolded

proteins in the ER lumen. This condition has been designated “ER stress” (1). ER stress can

be triggered by a number of stimuli that perturb ER function, such as Ca2+ depletion from the

ER lumen, inhibition of asparagine (N)-linked glycosylation, reduction of disulfide bonds,

overexpression of certain proteins, and nutrient/glucose deprivation (2). ER stress has been

implicated in the pathogenesis of a variety of human diseases, including neuronal

degenerative diseases, such as Alzheimer's disease (3), Parkinson’s disease (4), and diabetes

(5), viral pathogenesis (6); and some genetic diseases (2). It is also related to cancer therapy

(7). The balance between cellular survival responses and cellular death responses decides the

occurrence and development of these diseases. Thus a better understanding of cellular

survival responses to ER stress can aid understanding and development of new therapies for

these diseases.

The unfolded protein response (UPR) is a important adaptive response to ER stress which

includes transcriptional induction of UPR genes, translational attenuation of global protein

synthesis and ER-associated protein degradation (ERAD) (8). In mammals, three ER

transmembrane proteins, Ire1, ATF6, and PERK mediate the UPR. Activated Ire1 and ATF6

stimulate transcription of ER chaperone genes (9). PERK, on the other hand, phosphorylates

the translation initiation factor eIF2a, which halts translation and prevents the continual


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

accumulation of newly synthesized proteins into the ER (10). ERAD stimulates the

degradation and clearance of unfolded proteins in the ER lumen (11,12). However, if these

adaptive responses are not sufficient to relieve the ER stress, the cell dies through apoptosis.

Apoptosis is primarily mediated by a family of caspases. Two separable pathways leading to

caspase activation have been characterized. The extrinsic pathway is initiated by ligation of

transmembrane death receptors to activate caspase-8 and -10. The intrinsic pathway requires

disruption of the mitochondrial membrane and release of mitochondrial proteins including

Smac/DIABLO, HtRA2, and cytochrome c. Cytochrome c functions with Apaf-1 to induce

activation of caspase-9, thereby initiating the apoptotic caspase cascade, while

Smac/DIABLO and HtrA2 bind to and antagonize inhibitor of apoptosis protein (IAPs) (13).

It has been reported that activation of caspase-3, -4, -8, -9, -12 is required for ER stress-

induced cell death (14,15,16,17,18). The UPR rescues cells mainly through removing

unfolded proteins. It has not been reported that the UPR has a direct inhibitory effect on the

extrinsic and intrinsic apoptotic pathways. Here, we hypothesize that ER stress activates in

parallel UPR and cellular survival mechanisms which counteract apoptotic signals and

facilitate UPR function.

In the present study, we evaluate the hypothesis that certain survival elements directly

counteract ER stress- induced apoptotic signaling. We demonstrate that endogenous PI-

3K/Akt and MEK1/ERK are acutely activated in ER stress and subsequently prevent the

apoptosis response. We examine the possible interaction between the survival elements and

anti- or pro-apoptotic genes. We demonstrate that endogenous Akt is required for


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

transcriptional regulation of specific IAPs. Furthermore, we show that ablation of these IAPs

sensitizes stressed cell to death and that this can be reversed by a caspase inhibitor.

SmacDIABLO are indeed released during ER stress. These finding reveal a previously

unrecognized important response that controls cell survival in ER stress.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

MATERIALS AND METHODS

Materials- Tunicamycin, thapsigargin, Hoechst33342, 3-(4,5-dimethylthiazol-2-yl)-2,5-

diphenyl tetrazolium bromide (MTT) were purchased from Sigma-Aldrich. The broad-

spectrum caspase inhibitor zVAD-fmk, MEK1 inhibitor U0126, PI-3K inhibitor LY294002

were obtained from CalbioChem. The mTOR inhibitor rapamycin was purchased from Cell

Signaling Technology.

Cell Culture- The human breast cancer cell line MCF-7 and its stable transfectants, the

human prostate cancer cell line PC-3, and the human neuroblastoma cell line SH-SY5Y were

grown in DMEM culture medium. The human lung cancer cell line H1299 was cultured in

RPMI 1640 medium. All media were supplemented with 10% FCS (vol/vol), 2mM L-

glutamine,100U/ml penicillin, and 100ug/ml streptomycin (Invitrogen). Before being

challenged with tunicamycin or thapsigargin, the cells were serum-starved for 24 h.

Plasmids and Establishment of Stable Cell Lines- pCMV6-Akt (K179M) encoding

dominant negative Akt (K179M) (a gift of Dr. Carlos L. Arteaga, Vanderbilt University) was

digested with EcoRI and XbaI and cloned into a pcDNA3.1(+) HA vector. The pMCL(+)HA-

tagged MEK1(K97M) construct containing dominant negative MEK1(K97M) (gift of Dr.

Natalie. Ahn, University of Colorado, Boulder) was digested with KpnI and HindIII and

subcloned into the pcDNA3.1(-) plasmid (Invitrogen). pcDNA3.1(+)HAAkt(K179M),

pcDNA3.1(-)HA-MEK1(K97M) or empty vector tranfectants were produced by sequentially

transfecting MCF-7 and H1299 cells with each construct using Lipofectamine Plus

(Invitrogen). The stably expressing cells were selected in the presence of G418 (800 µg/ml)


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

for 4 weeks and the surviving clones were pooled (mass culture). The transfectants were

identified by Western blotting by anti-HA antibody. For each construct, three mass cultures

were used for the further experiments.

Western Blotting and Antibodies- After treatment as indicated, cells were washed once

with PBS and extracted with SDS-sample buffer. Equal amounts of protein were subjected to

Novex Tris-Glycine gels (Invitrogen) and transferred to PVDF membranes (Millipore). After

blocking, the membranes were incubated with each primary antibody, followed by incubation

with an HRP-conjugated secondary antibody. The protein bands were visualized using an

ECL detection system (Amersham Biosciences). The following antibodies were used in our

study: anti-eIF2apAb, anti-phospho-eIF2a (Ser 51) pAb, anti-Akt pAb, anti-phospho-Akt

(Ser 473) pAb, anti-ERK1/2 pAb, anti-phospho-ERK1/2 (Thr202/Tyr204) pAb, anti-

SAPK/JNK pAb, anti-phospho- SAPK/JNK (Thr183/Tyr185) pAb, anti-p38 pAb, anti-

phospho-p38 (Thr180/Tyr182), anti-phospho-mTOR (Ser2448) pAb, anti-XIAP pAb all from

Cell Signaling Technology, anti-cIAP-2 mAb (CHEMICON), anti-ß-actin mAb (Sigma), and

anti-hemagglutinin (anti-HA) mAb (Covance).

RT-PCR- Cells were treated with the indicated reagents and total RNA was extracted by the

Trizol® method (Invitrogen). It was subjected to RT-PCR in a two-step protocol using

SuperScript™ II Reverse Transcriptase and Taq polymerase. The number of cycles and

annealing temperature were adjusted depending on the genes amplified. Primer sequences are

available upon request.

Ablation of Endogenous cIAP-2 and XIAP by RNAi- 21-nucleotide siRNA duplex with

3'dTdT overhangs corresponding to cIAP-2 mRNA (AACAGTGGATATTTCCGTGGC) (19)


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

and to XIAP mRNA (AAGTGGTAGTCCTGTTTCAGC) (20) were synthesized

(Dharmacon), and control siRNA was purchased from Dharmacon. SiRNA transfections were

performed using Oligofectamine reagent (Invitrogen). 2×105 MCF-7 cells or 1×106 SH-

SY5Y cells plated in 6-well plates were transfected twice using the manufacturer's protocol

(Invitrogen) at 24 h intervals. 48 h after the second transfection, the cells were treated and

used for Western blot analysis or MTT assay.

MTT Assay- Cell viability was evaluated by using a MTT reduction conversion assay

(21,22). Briefly, cells grown in 6-well plates were treated as required. Then, 100 µl of MTT

at 5 mg/ml was added to each well, and incubation was continued for 2 h. The formazan

crystals resulting from mitochondrial enzymatic activity on MTT substrate were solubilized

with DMSO. Absorbance was measured at 570 nm by using a microplate reader (Molecular

Devices). Cell survival was expressed as absorbance relative to that of untreated controls.

Immunofluorescence Analysis- Thapsigargin- and tunicamycin-treated MCF-7 cells were

stained with MitoTracker first (Molecular Probes), then washed, fixed with 3.7%

formaldehyde, and permeabilized in 0.2% Triton X-100. A rabbit polyclonal anti-Smac

antibody (IMGENEX) diluted 1:500 was used to detect the respective proteins. After washing,

FITC-conjugated secondary antibody (1:1,000; Molecular Probes) was added for 1 h,

followed by a 5 min treatment with Hoechst 33342. As a negative control, cultures were

incubated with the secondary antibody only. Fluorescence was observed using a Zeiss

Axiovert 135 inverted microscope using a Zeiss F-Fluar 40×/1.3 oil immersion objective and

the appropriate filter sets (Chroma Technology Corp.). Digital images were acquired with a

Zeiss Axiocam and Axiovision software.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

TUNEL Assay- The in situ terminal deoxynucleotidyltransferase-mediated dUTP nick end

labeling (TUNEL) cell death detection kit (Roche Applied Science) was used according to

the instructions. Briefly, cells were fixed with 4% paraformaldehyde and permeabilized with

0.1% Triton X-100, and DNA breaks were labeled by incubation (60 min; 37 °C) with

terminal deoxynucleotidyltransferase and nucleotide mixture containing FITC-conjugated

dUTP. Fluorescence was observed using a fluorescence microscope as mentioned above.

Subcellular Fractionation- Thapsigargin- and tunicamycin-treated MCF-7 cells were

collected at the indicated time points. Cell pellets were resuspended in sucrose-supplemented

cell extraction buffer (250mM sucrose, 20mM Hepes-KOH,pH7.5, 10mM KCl, 1.5mM

MgCl2, 1mM EDTA, 1mM EGTA, 1mM dithiothreitol and 0.1mM PMSF), supplemented

with protease inhibitors (5mg/ml pepstatin, 10mg/ml leupeptin, 2mg/ml aprotinin). After

sitting on ice for 15 min, the cells were homogenized with 15 strokes, and the homogenate

was centrifuged at 1,000×g for 10 min to remove unbroken cells and nuclei. The supernatant

was further spun at 15,000×g for 15 min. The supernatant containing the cytoplasmic fraction

was then isolated from the pellet containing the mitochondrial fraction. The purity of the

cytoplasmic fraction was assessed by confirming the absence of cytochrome c oxidase by

Western blotting.

Statistics- Data are given as means± SEM. t test was used to determined the significance of

differences. P values smaller than 0.05 were considered to be statistically significant.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

RESULTS

Thapsigargin or Tunicamycin Induces Unfolded Protein Response and Apoptosis-

Incubation of human breast cancer MCF-7 cells with ER stressors thapsigargin and

tunicamycin rapidly induced mRNA expression of two known UPR target genes, namely the

ER resident molecular chaperone BiP and the transcription factor CHOP ( Fig.1A).

Phosphorylation of the translation initiation factor eIF2a also occurred under the same

conditions (Fig.1B). Despite these adaptive responses, prolonged ER stress induced apoptosis.

TUNEL staining showed that apoptosis occurred after thapsigargin or tunicamycin treatment

for 18 h, and Hoechst staining showed an apoptotic phenotype with condensed nuclei.

(Fig.1C). On the basis of a quantitative cell viability assay (MTT assay), ER stress induced

cell death in MCF-7 cells (Fig.1D) and human lung cancer H1299 cells (data not shown) in a

time-dependent manner. Furthermore, co- incubation of MCF-7 cells with the broad spectrum

caspase inhibitor zVAD-fmk significantly decreased thapsigargin- induced cell death from

48% to 29%. Similar results were obtained in tunicamycin-treated cells (Fig.1E). These data

indicate that ER stress- induced cell death is caspase-dependent.

ER Stress-Induced Activation of Endogenous PI-3K/Akt is a Cellular Survival

Response- In addition to the unfolded protein response, it remains unclear whether cellular

survival mechanisms which can directly resist ER stress-activated apoptotic signals are

activated in parallel by ER stress. Akt, which has been identified a critical survival factor that

can protect cells from different kinds of apoptotic stimulation (23), appeared a likely

candidate. To test this, extracts from thapsigargin- or tunicamycin- treated MCF-7 cells were

immunoblotted with antibody specific to phosphorylated Akt (Ser473). As shown in Fig.2A,


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

phosphorylation activation of Akt was observed at 2h with thapsigargin and at 4h with

tunicamycin. The activation returned to basal levels by 12 h. The activation was completely

blocked by the PI-3K inhibitor LY294002 (Fig.5B). These results reveal that ER stress

acutely induces PI-3K-mediated Akt activation.

Thapsigargin and tunicamycin are two pharmacologically distinct ER stress inducers.

Activation of Akt pathway by both thapsigargin and tunicamycin in MCF-7 cells

demonstrated that ER stress- induced Akt activation was not restricted to one ER stressor. To

further explore whether ER stress- induced Akt activation is a general event among different

cells, we investigated ER stress- induced Akt activation in cells originating from different

human organs. Thapsigargin or tunicamycin also acutely induced phosphorylation of Akt in

human lung cancer H1299 cells (Fig.2B) and human prostate cancer PC-3 cells (data not

shown). These results indicate acute activation of Akt pathway is a rather general cellular

response to ER stress.

To elucidate whether activation of the PI-3K/Akt pathway was required to protect cells from

ER stress- induced cell death, we first assessed the effect of the PI-3K inhibitor LY294002. As

shown by phase contrast microscopy and a cell viability (MTT) assay in Fig.2C and 2D, co-

incubation with LY294002 significantly sensitized MCF-7 cells to thapsigargin- or

tunicamycin- induced cell death. LY294002 treatment alone had no effect on cell viability.

Similar results were obtained when the same experiments were performed with H1299 cells

(Fig. 2D). To further confirm that Akt signaling was protective to cell survival during ER

stress, we established MCF-7 cell pools stably expressing a hemagglutinin (HA)-tagged


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

dominant-negative Akt in which a point mutation (K197M) was introduced at a site required

for kinase activity. Control cells were transfected with empty vector. Stable transfectants

were identified by Western blotting with a HA specific monoclonal antibody. A cell viability

assay showed that ectopic expression of DN-Akt significantly increased thapsigargin and

tunicamycin- induced cell death (Fig.2E). Similar results were obtained in H1299 cell

expressing DN-Akt (data not shown). All these results provide evidence that activation of the

PI-3K/Akt pathway is a critical cellular survival response to ER stress.

Akt-Dependent Activation of mTOR is not Required for Akt-Mediated Survival

Signaling in ER Stress- Recent research has shown that mTOR, an established Akt effector,

is essential for Akt-mediated survival signaling (24,25). There is also much evidence that

mitogens and growth factors stimulate phosphorylation of mTOR at Ser 2448 (26,27). It was

therefore interesting to investigate the role of mTOR in the regulation of ER stress

considering its critical controlling role in protein synthesis. Acute phosphorylation of mTOR

at ser 2448 was found in MCF-7 cells treated with thapsigargin or tunicamycin, which was

blocked by either LY249002 or expression of dominant-negative Akt (Fig.3A). Next, we

tested whether activated mTOR contributed to cell survival during ER stress. As shown in

Figure 5B, co- incubation MCF-7 cells with rapamycin, an inhibitor of mTOR, did not

increase ER stress- induced cell death (Fig.3B). Our data indicate that ER stress induces

phosphorylation of mTOR in an Akt-dependent manner, however this is not involved in cell

survival.

ER Stress-Induced Endogenous ERK Activation Protects Cells from ER Stress-Induced


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Cell Death- In addition to the PI-3K/Akt pathway, the mitogen-activated protein kinase

(MAPK) family comprising extracellular signal-regulated kinase (ERK), c-jun N-terminal

kinase (JNK), and p38MAPK also mediates many stress responses. Although in mammalian

cells the role of the ERK pathway in regulation of apoptosis is controversial, it is well

established in Drosophila that the activated Ras/Raf/MEK/ERK pathway promotes survival

through phosphorylating head involution defective protein (28). The exact role of ERK in ER

stress has not been characterized. Activation of ERK occurs through phosphorylation of Thr

and Tyr residues by an upstream MAP kinase kinase (MEK1). To investigate the role of the

MAPK family in ER stress, we first tested whether MAPK is activated upon ER stress.

Phosphorylation of ERK1/2 was induced in MCF-7 cells after exposure to thapsigargin or

tunicamycin. JNK was also phosphorylated, consistent with previous reports (29,30), but the

phosphorylation of p38 was not induced (Fig.4A). Confirming the activation of the ERK

pathway, the MEK1 inhibitor U0126 completely inhibited thapsigargin- induced ERK1/2

phosphorylation (Fig.5B). ER stress- induced activation of ERK was also observed in H1299

cells (Fig.4B).

Next, we examined whether activation of MEK1/ERK pathway could protect cells from ER

stress-induced cell death. As shown by phase contrast microscopy and MTT assay in Fig.4C

and 4D, the MEK1 inhibitor U0126 increased thapsigargin- and tunicamycin- induced cell

death in MCF-7 and H1299 cells. Treatment with U0126 alone had no effect on cell viability.

To further confirm the protective role of the MEK1/ERK pathway, we generated stable MCF-

7 cell pools expressing a HA-tagged dominant-negative MEK1 mutant. In control cells the

empty vector was transfected. Stable transfectants were identified by Western blotting with a


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

HA antibody. MTT assay showed that expression of dominant negative MEK1 increased

thapsigargin- and tunicamycin- induced cell death (Fig. 4E). Similar results were obtained in

H1299 cells expressing DN-MEK1 (data not shown). All these results suggest that activation

of MEK1/ERK pathway is also a cellular survival response to resist ER stress.

PI3K Mediates ER Stress-Induced ERK Activation- The aforementioned results

demonstrated that ER stress activated both the PI-3K/Akt and MEK1/ERK pathways, so it

was interesting to investigate whether there was cross talk between the two pathways. MTT

assay revealed that in MCF-7 cells, inhibition of PI-3K with LY294002 resulted in more ER

stress-induced cell death compared with treatment with U0126 (Fig.5A). The effect of co-

treatment with both LY294002 and U0126 on ER stress-induced cell death was similar to

LY294002 alone (Fig.5A). These results suggested that PI-3K may be an upstream signal to

activate ERK during ER stress. To explore the relationship between PI-3K and ERK, MCF-7

cells were incubated with thapsigargin in the presence of LY294002, U0126 or vehicle

(DMSO) respectively. Western blotting showed that U0126 totally inhibited ERK activation,

but had little or no effect on thapsigargin- induced phosphorylation of Akt (Fig.5B). On the

other hand, LY294002 completely blocked Akt activation, but also significantly decreased

thapsigargin- induced phosphorylation of ERK1/2 (Figure.5B). Similar results were obtained

in tunicamycin- treated cells (data not shown). All these results reveal that in MCF-7 cells ER

stress-induced activation of ERK is PI-3K-dependent.

ER Stress-Induced Expression of cIAP-2 and XIAP is Required for Sustaining the

Survival of Cells under ER Stress- Several lines of evidence indicate that caspase activation


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

is an important component of ER stress- induced cell death (14,15,16,17,18). Our previous

data showed that a broad-spectrum caspase inhibitor zVAD-fmk reduced ER stress- induced

cell death (Fig.1E). Since bcl-2 and IAP family proteins play a critical role in the regulation

of caspase-dependent cell death, we investigated the expression pattern of genes for both the

bcl-2 and IAP families during ER stress. As indicated in Figure.6A, high level transcription

of cIAP-2 and XIAP, two members of the IAP family, rapidly occurred in thapsigargin-

treated MCF-7 cells, while the transcription of cIAP-1 and survivin was not significantly

induced. However, RT-PCR could not detect altered transcription of Bcl-2 family members

under the same conditions, including the pro-apoptosis genes Bax, Bak, Bik, Bid, Bim and

the anti-apoptosis genes bcl-2, bcl-xL, Mcl-1. Similar results were found in human

neuroblastoma SHSY5Y cells (data not shown). Increased expression of cIAP-2 and XIAP

proteins were readily detected in MCF-7 and SH-SY5Y cells treated with thapsigargin or

tunicamycin (Fig. 6B).

If induction of cIAP-2 and XIAP is a critical survival response to ER stress, decreasing the

levels of endogenous cIAP-2 or/and XIAP should increase ER stress- induced cell death. To

suppress the expression of cIAP-2 or/and XIAP, MCF-7 and SH-SY5Y cells were transfected

with either cIAP-2 or/and XIAP specific interfering RNA oligonucleotides (cIAP-2-siRNA,

XIAP-siRNA) or a control-siRNA. As shown in Fig.6C, after two consecutive transfections,

cIAP-2-siRNA or XIAP-siRNA selectively ablated basal and thapsigargin-stimulated

induction of cIAP-2 or XIAP proteins, while the level of a control protein (ß-actin) remained

same. Similar results were observed in tunicamycin-stimulated cells (data not shown).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Next, we examined the effect of ablation of cIAP-2 or/and XIAP on ER stress- induced cell

death. Transfection of cIAP-2-siRNA or XIAP-siRNA alone had no effect on cell viability.

As shown in Fig 6D and 6E, phase-contrast microscopy and MTT assay demonstrated that in

MCF-7 cells after treatment with thapsigargin and tunicamycin for 13h both cIAP-2-siRNA

and XIAP-siRNA transfected cells were susceptible to ER stress- induced cell death. To test

whether ablation of IAPs increases the sensitivity to cell death through promoting activation

of caspases, we co-incubated MCF-7 cells with the general inhibitor of caspases zVAD-fmk.

Phase-contrast microscopy and MTT assay data showed that zVAD-fmk reversed the

sensitization effect caused by knockdown of the IAPs (Fig.6D,6E). Similar results were

obtained with SHSY5Y cells (data not shown). Our data indicate that cIAP-2 and XIAP are

essential for cells to survive ER stress by inhibiting caspase activation.

One important function of IAPs in the prevention of apoptosis is to bind RHG motif-

containing proteins, such as Smac/DIABLO and HtrA2/Omi which are released from

mitochondria to the cytosol to promote apoptosis (31,32). The critical protective role of IAPs

in ER stress led us to investigate whether Smac is released from mitochondria during ER

stress. For this purpose, subcellular location of Smac was examined by immunofluorescence.

As shown in Fig.7A in MCF-7 cells, Smac staining showed a punctate perinuclear pattern

which matched to Mitotracker staining. Thapsigargin treatment for 12 h induced

redistribution of Smac to a diffused cytosolic pattern. Subcellular fractionation analysis of

Smac protein further supported the immunostaining results. Smac protein was detected in the

soluble cytosolic fraction in response to thapsigargin treatment (Fig.7B). Similar results were

found with tunicamycin (data not shown). Our results suggest that Smac release from


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

mitochondria may play a key role in ER stress- induced cell death, and that the IAP proteins

protect cells through inhibiting caspase activation by neutralizing Smac. All these data

indicate that induction of IAP proteins is an important cellular survival response to ER stress.

Induction of c-IAP2 and XIAP Depends on Activation of PI-3k/Akt- The aforementioned

results suggested that PI-3K-dependent activation of Akt and the ERK pathway is a cellular

survival response. It was therefore interesting to determine a possible role for activated Akt

and ERK in ER stress–stimulated expression of cIAP-2 and XIAP. Co-treatment with

LY294002 or overexpression of DN-Akt significantly decreased thapsigargin- induced

transcription of cIAP-2 and XIAP (Fig.8A), and the expression of cIAP-2 and XIAP protein

was also inhibited (Fig.8B), as shown respectively by RT-PCR and Western blotting. Similar

results were obtained in tunicamycin-treated cells (data not shown). In contrast, we failed to

detect a significant effect of the dominant negative MEK1 on the expression level of cIAP-2

and XIAP (Fig. 8B). The MEK inhibitor U0126 also failed to suppress the expression of

cIAP-2 and XIAP (Fig.8B). These results indicate that the PI-3K/Akt survival pathway, not

the ERK pathway, increases cIAP-2 and XIAP function by regulating their transcription in

response to ER stress.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

DISCUSSION

The fate of cells under ER stress is dependent on the balance between cellular adaptive

responses and cellular death responses. Much progress has been made recently to gain insight

into the mechanisms of ER stress-induced cell death. Caspase-3, -4, -9, -12 , and Bax, Bak,

PUMA from the bcl-2 family have been demonstrated to mediate ER stress- induced

apoptosis (14,15,16,17,18,33). However, studies of cellular adaptive responses have mainly

focused on the unfolded protein response (UPR) which allows cells to survive through

removal of misfolded proteins. In this paper we present evidence that in addition to the UPR,

ER stress activates in parallel some endogenous cellular survival mechanisms which directly

prevent apoptotic signals to provide time for the UPR to function. These mechanisms involve

Akt, the ERK pathway, and the anti-apoptotic proteins cIAP-2 and XIAP.

Akt is a serine/threonine protein kinase that is mainly regulated by PI-3K. An important

function of activated PI3K/Akt in cells is the inhibition of apoptosis. Activated Akt can

protect cells from different kinds of apoptotic stimulations, inc luding growth factor

withdrawal, Fas ligand interaction, oxidative stress, N-methyl-D-aspartate, UV irradiation,

matrix detachment, cell cycle discordance, DNA damage, TGF-beta and chemotherapeutic

agents (23,25). A number of pro-apoptosis proteins have been identified as direct Akt

substrates, including BAD, caspase-9, Forkhead transcription factors, and the apoptosis

signal-regulating kinase 1 (ASK1), which are inactivated upon phosphorylation by Akt

(23,34). The role of Akt in regulation of ER stress- induced cell death has not been


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

characterized. We found that Akt was activated early in several cell lines MCF-7, PC-3, and

H1299 during ER stress. The activation was shown to be mediated by PI-3K, since the PI-3K

inhibitor LY294002 completely blocked its phosphorylation in MCF-7 cells. More

importantly, inhibiting the PI-3K/Akt pathway by either LY294002 or overexpression of

kinase dead mutant Akt significantly sensitized cells to ER stress- induced cell death. We

therefore speculate that ER stress- induced activation of endogenous PI-3K/Akt pathway is a

cellular survival response.

How do the cells sense ER stress to activate PI-3K? Perk and IRE1 are two ER-residence

kinases involved in regulation of ER stress. However, previous studies indicate that PI-3K

activation requires the binding of the p85 regulatory subunit to tyrosine-phosphorylated

molecules (35). Considering that both Perk and IRE1 are Ser/Thr kinases, it seems that they

are probably not directly responsible for ER stress- induced PI-3K activation. Ca2+ is an

important second messenger that is required for numerous cellular functions. ER is the main

intracellular storage compartment for Ca2+, and disruption of Ca2+ homeostasis is one of the

most important characteristic of ER stress (33,36,37,38). A recent study shows that Ca2+ and

calmodulin play important roles in activation of PI-3K (39), and activation of calmodulin and

calcineurin is necessary for long–term survival of cells undergoing ER stress (40). Therefore,

we speculate that activation of PI-3K is a cellular response to ER stress- induced increase of

intracellular Ca2+, and that Ca2+ is a potential linker between ER stress and PI-3K activation.

mTOR, an established target of Akt, regulates translation in response to nutrients and growth

factors by phosphorylating key components of the protein synthesis machinery, including the


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

ribosomal protein S6 kinase, p70s6k and the eIF4E binding protein, 4E-BP1 (41). It has been

suggested that mTOR is involved in regulation of cell survival. (24,25). However, another

study has shown that the negative regulator of mTOR, TSC2, protects cells from glucose

depletion-induced apoptosis (26). This discrepancy is likely due to differences in stress and

cell types. Our results showed that although Akt-dependent phosphorylation of mTOR was

induced in ER stress, it was not be involved in regulation of cell death, because the mTOR

inhibitor rapamycin had no effect on thapsigargin- or tunicamycin- induced cell death. We

therefore propose that mTOR is not required for Akt-mediated survival signaling in ER stress.

The MAPK family comprising JNK, p38MAPK, and ERK mediates stress responses.

Activation of JNK during ER stress is mediated by IRE1(29), and primary neurons from

ASK1-knockout mice are defective in ER stress- induced JNK activation and cell death (30).

Unlike in Drosophila, the role of ERK in regulation of cell death in mammalian cells is

controversial. In some cases ERK activation exerts a pro-apoptotic influence (42,43), but in

most cases it provides anti-apoptotic signals (44,45). It is probable that the kinetics and

duration of ERK activation determine whether it acts in a pro-apoptotic or anti-apoptotic

manner. In our study, we found that ER stress early activated the ERK pathway in different

cell types. We further provide evidence that ER stress- induced activation of ERK exerts

survival signaling. For example, either the MEK1 inhibitor U0126 or expression of dominant

negative MEK1 made cells vulnerable to ER stress- induced cell death. We therefore propose

that activation of the endogenous MEK1/ERK signaling pathway in ER stress is a cell

survival response.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Crosstalk between the PI-3K and Raf/MEK1/ERK pathways has been reported to occur at

multiple levels. Some research indicates that PI-3K activity is essentia l for activation of the

Raf/MEK1/ERK cascade (46).Other studies suggest that the PI-3K pathway enhances and/or

synergizes with the Raf/MEK1/ERK pathway to provide a more robust signal (47). In our

studies, we demonstrated that in MCF7 cells U0126 had no effect on thapsigargin- induced

phosphorylation of Akt, but LY294002 significantly inhibited phosphorylation of ERK1/2.

We therefore speculate that PI-3K is an upstream signaling pathway mediating activation of

ERK in ER stress. It has been reported that members of the PAK family may play a role in

regulation of PI-3K-mediated activation of the Raf/MEK1/ERK cascade (48,49). Recently

MEK1 has been proved to be directly phosphorylated by PAK1 to regulate ERK activation

(50). However, PI-3K also can attenuate Ra f activity through Akt (51). In our experiments,

we found that in contrast to LY 294002 expression of kinase dead Akt had no effect on ER

stress-induced ERK activation. According to these results we propose that in ER stress,

signals from activated PI-3K diverge to activate both Akt and the Raf/MEK1/ERK cascade.

Whether Rac1 and PAK are involved in PI-3K-dependent activation of ERK in ER stress

needs further investigation.

Caspases are the primary mediators of apoptosis. It has been reported that activation of

caspase-3,-4,-8,-9,-12 plays a central role in ER stress –induced cell death (14,15,16,17,18).

The members of the IAP family are the only known cellular caspase inhibitors. The IAP

family includes XIAP, cIAP-1, c-IAP2, survivin, neuronal apoptosis inhibitory protein,

melanoma IAP, and Bruce, all of which contain one or more repeats of the characteristic

baculovirus IAP repeat BIR domain. IAPs block apoptosis in many cells exposed to different


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

kinds of apoptotic stimulations (52,53). Our data showed that in ER stress the expression of

c-IAP2 and XIAP was significantly induced at the mRNA and protein levels in different

human cells. It is interesting to note that the expression of IAPs is induced by ER stress,

because the synthesis of XIAP is controlled by a unique mechanism. The 5' untranslated

region of XIAP mRNA contains an internal ribosome initiation site or IRES element (54).

IRES-containing transcripts can continue to direct protein synthesis under a number of

cellular stress conditions in which cap-dependent translation is shut down. A recent paper

shows that an IRES element also exists in the transcript of cIAP-1 (55). The IRES element

seems to be a general feature in IAPs.

In our experiments, reduction of the level of cIAP-2 or XIAP in MCF-7 and SH-SY5Y cells

by RNA interference sensitized the cells to ER stress- induced cell death. The IAPs can

regulate caspase activity by binding directly to activated caspases and inhibiting their

function (52,56). On the other hand, some IAPs, such as XIAP, have anti-apoptotic activities

unrelated to their ability to inhibit caspases (57). Our data show that the general caspase

inhibitor zVAD-fmk reversed the effect of knockdown of the IAPs on ER stress-induced cell

death. This indicates that ablation of these IAPs increases ER stress-induced cell death by

promoting caspase activation. The fact that ablation of IAPs induces only a partial decrease

in cell viability suggests that some other signaling pathways may exist. Both c-IAP2 and

XIAP can bind to mammalian RHG motif-containing proteins, such as Smac/DIABLO and

HtrA2/Omi, which promote apoptosis (23,24). The E3 ubiquitin ligase activity of IAPs also

can down-regulate Smac through protein degradation (58). A proposed model of IAP

inhibition of the amplification of caspase activation is through binding and neutralizing


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

released Smac. The critical protective role of IAPs in ER stress may indicate the important

role of Smac release from mitochondria in ER stress- induced cell death.

We further showed that enhanced transcription and translation of cIAP-2 and XIAP is

mediated by activated Akt in MCF-7 cells. The transcription factor which is responsible for

Akt-dependent induction of cIAP-2 and XIAP needs further investigate. The inhibition of the

PI3K/Akt pathway does not completely block ER stress- induced expression of IAPs. It is

therefore possible that other mechanisms might operate. It has been reported that NF-kappa B

and the cAMP/CREB pathway activate induction of cIAP-2 and XIAP (59,60). Whether

these pathways are involved in ER stress- induced expression of IAPs needs further study.

Except for regulation at the level of transcription, modulation of the abundance of IAPs also

occurs at the translational and post-translational levels. Fibroblast growth factor 2 (FGF-2)

increases expression of XIAP and cellular IAP-1 principally through translational regulation

in an ERK dependent manner (61). A recent paper shows that Akt phosphorylates XIAP at

serine-87, and that phosphorylated XIAP is more resistant to ubiquitination- induced

degradation (62). Post-translational modification might play an important role in the

induction of IAPs during ER stress.

In summary, we provide evidence that acute activation of endogenous Akt/IAPs and

MEK/ERK governs cell survival in ER stress by directly counteracting ER stress- induced

cell death (Fig 9). We propose that this is an important physiological response to ER stress.

We have presented evidence that the IAPs induction required for suppressing of cell death is

regulated by Akt. The Akt/IAPs can protect against cell death by directly interfering with the


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

postmitochondrial apoptosis pathway. The activation of Akt/IAPs and ERK was observed in

different cell types, suggesting that this is a common response during ER stress in mammals.

The critical protective role of the IAPs in ER stress relates to the fact that they bind or

stimulate degradation of Smac, which is released from mitochondria to cytosol to promote

caspase activation. These results provide significant novel insights into the molecular

mechanisms for antiapoptotic behavior in ER stress. The present study appears to be the first

identification of endogenous Akt/IAPs and ERK signaling pathways in the regulation of cell

fate in ER stress.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

REFERENCE:

1. Kaufman, R.J. (1999) Genes Dev. 13,1211-1233.

2. Kaufman, R.J. (2002) J. Clin. Invest. 110,1389-1398.

3. Katayama, T., Imaizumi, K., Sato, N., Miyoshi, K., Kudo, T., Hitomi, J., Morihara, T.,

Yoneda, T., Gomi, F., Mori, Y., Nakano, Y., Takeda, J., Tsuda, T., Itoyama, Y.,

Murayama, O., Takashima, A., St George-Hyslop, P., Takeda, M., and Tohyama, M.

(1999). Nat. Cell Biol. 1, 479-485.

4. Imai, Y., Soda, M., Inoue, H., Hattori, N., Mizuno, Y., and Takahashi, R. (2001) Cell.

105, 891-902.

5. Harding, H.P., Zeng, H., Zhang,Y., Jungries, R., Chung, P., Plesken, H., Sabatini,

D.D., and Ron, D. (2001) Mol.Cell. 7, 1153-1163.

6. Tardif, K.D., Mori, K., Kaufman, R.J., and Siddiqui, A. (2004) J. Biol. Chem. 279,

17158-17164.

7. Adams, J. (2002) Curr. Opin. Oncol. 14, 628-634.

8. Liu, C.Y., and Kaufman, R.J. (2003) J. Cell. Sci. 116, 1861-1862.

9. Breckenridge, D.G., Germain, M., Mathai, J.P., Nguyen, M., and Shore, G..C. (2003)

Oncogene. 22, 8608-8618.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

10. Harding, H.P., Zhang, Y., Bertolotti, A., Zeng, H., and Ron, D. (2000) Mol. Cell. 5,

897-904.

11. Wiertz, E.J., Tortorella, D., Bogyo, M., Yu, J., Mothes, W., Jones, T.R., Rapoport,

T.A., and Ploegh, H.L. (1996) Nature. 384, 432-438.

12. Plemper, R.K., Bohmler, S., Bordallo, J., Sommer, T., and Wolf, D.H. (1997) Nature.

388, 891-895.

13. Johnstone R.W., Ruefli, A.A., and Lowe, S.W. (2002) Cell. 108, 153-164.

14. Nakagawa, T., Zhu, H., Morishima, N., Li,E., Xu, J., Yankner, B.A., and Yuan, J.

(2000) Nature. 403, 98-103.

15. Song, L., De Sarno, P., and Jope, R.S. (2002) J. Biol. Chem. 277, 44701-44708.

16. Reimertz, C, Kogel, D., Rami, A., Chittenden, T., and Prehn, J.H. (2003) J. Cell Biol.

162, 587-597.

17. Jimbo, A., Fujita, E., Kouroku, Y., Ohnishi, J., Inohara, N., Kuida, K., Sakamaki, K.,

Yonehara, S., and Momoi, T. (2003) Exp. Cell. Res. 283, 156-166.

18. Hitomi, J., Katayama, T., Eguchi, Y., Kudo, T., Taniguchi, M., Koyama, Y., Manabe,

T., Yamagishi, S., Bando, Y., Imaizumi, K., Tsujimoto, Y., and Tohyama, M. (2004) J.

Cell Biol. 165, 347-356.

19. Wen, L., Zhuang, L., Luo, X., and Wei, P. (2003) J. Biol. Chem. 278, 39251-39258.

20. Burstein, E., Ganesh, L., Dick, R.D., Van De Sluis, B., Wilkinson, J.C., Klomp, L.W.,

Wijmenga, C., Brewer, G.J., Nabel, G.J., and Duckett, C.S. (2004) EMBO.J. 23, 244-

254.

21. Xiao, G.H., Jeffers, M., Bellacosa, A., Mitsuuchi, Y., Vande Woude, G.F., and Testa,

J.R. (2001) Proc. Natl. Acad. Sci. U S A. 98, 247-252.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

22. Baranano, D.E., Rao, M., Ferris, C.D., and Snyder, S.H. (2002) Proc. Natl. Acad. Sci.

U S A. 99, 16093-16098.

23. Datta, S.R., Brunet, A., and Greenberg, M.E. (1999) Genes Dev. 13, 2905-2927.

24. Chung, J., Bachelder, R.E, Lipscomb, E.A., Shaw, L.M., and Mercurio, A.M. (2002)

J. Cell Biol. 158,165-174.

25. Wendel, H.G., De Stanchina, E., Fridman, J.S., Malina, A., Ray, S., Kogan, S.,

Cordon-Cardo, C., Pelletier, J., and Lowe, S.W. (2004). Nature. 428, 332-337.

26. Inoki, K., Zhu, T., and Guan, K.L. (2003). Cell. 115, 577-590.

27. Kam, Y., and Exton, J.H. (2004) FASEB. J. 18, 311-319.

28. Bergmann, A., Agapite, J., McCall, K., and Steller, H. (1998) Cell. 95, 331-341.

29. Urano, F., Wang, X., Bertolotti, A., Zhang, Y., Chung, P., Harding, H.P. and Ron, D.

(2000) Science. 287, 664-666.

30. Nishitoh, H., Matsuzawa, A., Tobiume, K., Saegusa, K., Takeda, K., Inoue, K., Hori,

S., Kakizuka, A., and Ichijo, H. (2002) Genes Dev. 16, 1345-1355.

31. Du, C., Fang, M., Li, Y., Li, L., and Wang, X. (2000) Cell. 102, 33–42.

32. Suzuki, Y., Imai, Y., Nakayama, H., Takahashi, K., Takio, K., and Takahashi, R. (2001)

Mol. Cell. 8, 613–621.

33. Zong W.X., Li, C., Hatzivassiliou, G., Lindsten, T., Yu, Q.C., Yuan, J., and Thompson,

C.B. (2003) J. Cell Biol. 162, 59-69.

34. Kim, A.H., Khursigara, G., Sun, X., Franke, T.F., and Chao, M.V. (2001) Mol. Cell.

Biol. 21, 893-901.

35. Backer, J.M., Myers, M.G. Jr., Shoelson, S.E., Chin, D.J., Sun, X.J., Miralpeix, M.,

Hu, P., Margolis, B., skolnik, E.Y., and Schlessinger, J. (1992) EMBO.J. 11,3469-


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

3479.

36. Buckley, B.J., and Whorton, A.R. (1997) Am.J.Physiol. 273, 1298-1305.

37. Scorrano, L., Oakes, S.A., opferman, J.T., Cheng, E.H., Sorcinelli, M.D., Pozzan, T.,

korsmeyer, S.J. (2003) Science. 300, 135-139.

38. Chae, H.J., Kim, H.R., Xu, C., Baily-Maitre, B., Krajewska, M., Krajewski, S.,

Banares, S., Cui, J., Digicaylioglu, M., ke, N., Kitada, S., Monosov, E., Thomas, M.,

Kress, C.L., babendure, J.R., Tsien, R.T., Lipton, S.A., and Reed, J.C. (2004)

Mol.Cell. 15, 355-366.

39. Perez-Garcia, M.J., Cena, V., de Pablo, Y., Llovera, M., Comella, J.X., and Soler, R.M.

(2004) J.Biol.Chem. 279, 6132-6142.

40. Bonilla, M., Nastase, K.K., and Cunningham, K.W. (2002) EMBO.J. 21, 2343-2353.

41. Schmelzle, T., and Hall, M.N. (2000) Cell. 103, 253-262.

42. van den Brink, M.R., Kapeller, R., Pratt, J.C., Chang, J.H., and Burakoff, S.J. (1999)

J. Biol. Chem. 274, 11178-11185.

43. Persons, D.L., Yazlovitskaya, E.M., and Pelling, J.C. (2000) J. Biol. Chem. 275,

35778-35785.

44. Miyazaki, T., Katagiri, H., Kanegae, Y., Takayanagi, H., Sawada, Y., Yamamoto, A.,

Pando, M.P., Asano, T., Verma, I.M., Oda, H., Nakamura, K., and Tanaka, S. (2000) J.

Cell Biol. 148, 333-342.

45. Whitlock, B.B., Gardai, S., Fadok, V., Bratton, D., and Henson, P.M. (2000)

J.Cell.Biol. 151, 1305-1320.

46. Wennstrom, S., and Downward, J. (1999) Mol. Cell. Biol. 19, 4279-4288.

47. von Gise, A., Lorenz, P., Wellbrock, C., Hemmings, B., Berberich-Siebelt, F.,


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Rapp,U.R., and Troppmair, J. (2001) Mol Cell Biol. 21, 2324-2336.

48. King, A.J., Sun, H., Diaz, B., Barnard, D., Miao, W., Bagrodia, S., Marshall, M.S.

(1998) Nature. 396, 180-183.

49. Sun, H., King, A.J., Diaz, H.B., and Marshall, M.S. (2000) Curr. Biol. 10, 281-284.

50. Slack-Davis, J.K., Eblen, S.T., Zecevic, M., Boerner, S.A., Tarcsafalvi, A., Diaz, H.B.,

Marshall, M.S., Weber, M.J., Parsons, J.T., and Catling, A.D. (2003) J. Cell Biol. 162,

281-291.

51. Zimmermann, S., and Moelling, K. (1999) Science. 286, 1741-1744.

52. Deveraux, Q.L., and Reed, J.C. (1999) GenesDev.13, 239-252.

53. Potts, P.R., Singh, S., Knezek, M., Thompson, C.B., and Deshmukh, M. (2003) J. Cell

Biol. 163, 789-799.

54. Holcik, M., Lefebvre, C., Yeh, C., Chow, T., Korneluk, R.G.. (1999) Nat. Cell Biol. 1,

190-192.

55. Warnakulasuriyarachchi, D., Cerquozzi, S., Cheung, H.H., and Holcik, M. (2004) J.

Biol. Chem. 279, 17148-17157.

56. Salvesen, G.S., and Duckett, C.S. (2002) Nat. Rev. Mol. Cell Biol. 3, 401–410.

57. Silke J., Hawkins, C.J., Ekert, P.G., Chew, J., Day, C.L., Pakusch, M., Verhagen, A.M.,

and Vaux, D.L. (2002) J.Cell.Biol. 157,115-124.

58. Hu, S., and Yang, X. (2003) J. Biol. Chem. 278, 10055-10060.

59. Wang, C.Y., Mayo, M.W., Korneluk, R.G., Goeddel, D.V., and Baldwin, A.S. Jr. (1998)

Science. 281,1680-1683.

60. Nishihara, H, Kizaka-Kondoh, S., Insel, P.A., and Eckmann, L. (2003) Proc. Natl.

Acad. Sci. U S A. 100, 8921-8926.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

61. Pardo, O.E., Lesay, A., Arcaro, A., Lopes, R., Ng, B.L., Warne, P.H., McNeish, I.A.,

Tetley, T.D., lemoine, N.R., Mehmet, H., Seckl, M.J., and Downward, J. (2003)

Mol.Cell.Biol. 23, 7600-7610.

62. Dan, H.C., Sun, M., Kaneko, S., Feldman, R.I., Nicosia, S.V., Wang, H.G., tsang, B.K.,

and Cheng, J.Q. (2004) J.Biol.Chem. 279, 5405-5412.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

FOOTNOTES

1. The abbreviations used are: ERK, extracellular signal-regulated protein kinase;

HA, hemagglutinin; IAP, inhibitor of apoptosis protein; MTT, 3-(4,5-

dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide; PI-3K,

phosphatidylinositol 3-kinase; UPR, unfolded protein response.

2. The percent viability in figure 6E was detected after ER stress for 13h. The

change is less than in previous figures in which the stress was for 30h.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

FIGURE LEGENDS

Figure 1. ER stress induces unfolded protein response and apoptosis. A) Induction of

BiP by ER stress. MCF-7 cells were treated with thapsigargin (TG, 2µM) or tunicamycin

(TU, 2µg/ml) for the indicated times. Total cellular RNA was isolated and analyzed by

semiquantitative RT-PCR. GAPDH served as control. B) ER stress- induced phosphorylation

of elf2a. MCF-7 cells were incubated with thapsigargin and tunicamycin as above. Whole-

cell extracts were analyzed by Western blot analysis for phosphorylated elF -2a (P- elF-2a )

and total elf-2a protein. C) ER stress- induced apoptosis. MCF-7 cells were stimulated with

thapsigargin (2µM) or tunicamycin (2µg/ml) for 24h. Cells were fixed and analyzed by

TUNEL (green) and Hoechst (blue) staining as described in Materials and methods. TUNEL-

positive cells were detected by fluorescence microscopy. Bar, 10µm. D) Time course of ER

stress-induced cell death. MCF-7 cells were treated with thapsigargin (2µM) or tunicamycin

(2µg/ml) for the indicated times, and cell death was quantified by MTT assay. Results were

expressed as the means ± SEM for three independent experiments. Cell death was expressed

as absorbance relative to that of DMSO-treated controls. E) Caspase-dependent cell death

induced by ER stress. MCF-7 cells were exposed to thapsigargin (2µM) or tunicamycin

(2µg/ml) with or without a broad-spectrum caspase inhibitor zVAD-fmk (100µM) for 28h.

The percentage of cell death was measured by MTT assay, as in panel D.

Figure 2. ER stress-induced acute activation of endogenous PI-3K/Akt pathway is a

cellular survival response to resist ER stress. A) Kinetics of ER stress- induced Akt

activation. MCF-7 cells were treated with 2µM thapsigargin, 2µg/ml tunicamycin or vehicle

(DMSO) for the indicated times. Cells were lysed and analysed by immunoblotting with


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

antibodies specific to phosphorylated Akt (Ser-473). Gel loading was controlled by

immunoblotting for Akt. B) ER stress- induced activation of Akt in human lung cancer

H1299 cells were incubated with thapsigargin, tunicamycin or vehicle, and cell lysates were

probed for phosphorylated Akt and total Akt as in (A). C) Phase contrast photomicrography.

MCF-7 cells were treated with thapsigargin (2µM) in the presence or absence of LY294002

(LY, 20µM) for 24 h and assessed by phase contrast microscopy. Bar, 50µm. D) Inhibition of

PI-3K results in increased ER stress- induced cell death. MCF-7, and H1299 cells were

exposed to thapsigargin (2µM) or tunicamycin (2µg/ml) with or without LY294002 (20µM)

for 30h. Cell viability was assessed by MTT assay. Results were expressed as the means ±

SEM for three independent experiments. Cell survival was expressed as absorbance relative to

that of DMSO- or DMSO plus LY-treated controls. E) Overexpression of dominant-negative

Akt sensitizes MCF-7 cells to ER stress- induced cell death. MCF-7 were transfected with a

vector encoding a dominant negative HA-tagged Akt (K179M) or an empty vector

(pcDNA3.1HA). Pooled transfectants (MCF Neo mass and MCF DN-Akt mass 5) were

stimulated with thapsigargin (2µM) or tunicamycin (2µg/ml) for 30h. Cell viability was

quantified by MTT assay.

Figure 3. mTOR is not essential for Akt-mediated survival in ER stress. A) ER stress-

induced Akt-dependent phosphorylation of mTOR. MCF-7 cells were treated with

thapsigargin (2µM) or tunicamycin (2µg/ml) in the presence or absence of 20µM LY294002

for the indicated times. MCF Neo mass (MCF Neo) and MCF DN-Akt mass 5 cells (MCF

DN-Akt ) were incubated with thapsigargin or tunicamycin for the indicated times. The

phosphorylated form of mTOR was analyzed by an antibody specific for phospho-mTOR


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

(Ser 2448). Total mTOR levels were determined in whole cell lysates as shown in the bottom

panel. B) Effect of rapamycin on ER stress- induced cell death. MCF-7 cells were exposed to

thapsigargin (2µM) or tunicamycin (2µg/ml) with or without the mTOR inhibitor rapamycin

(50nM) for 30h. Cell survival was detected by MTT assay. Cell survival was expressed as

absorbance relative to that of DMSO-treated controls.

Figure 4. ER stress-induced activation of endogenous ERK plays a protective role in ER

stress-induced cell death. A) ER stress-induced activation of ERK and JNK, but not

p38MAPK. MCF-7 cells were incubated with thapsigargin (2µM), tunicamycin (2µg/ml) or

vehicle (DMSO) for the indicated times. Cell lysates were monitored by Western blotting

with antibodies specific for ERK1/2, JNK, p38MAPK and their phosphorylated forms as

indicated. B) ER stress- induced activation of ERK in H1299 cells. The experiments were

performed by using the same procedure as in panel A. C) Phase contrast photomicrography.

MCF-7 cells were treated with thapsigargin (2µM) in the presence or absence of U0126

(20µM) for 24 h and assessed by phase contrast microscopy. Bar, 50µm. D) Inhibition of

MEK1/ERK activation sensitizes cells to ER stress-induced cell death. MCF-7 and H1299

cells were exposed to thapsigargin (2µM) or tunicamycin (2µg/ml) with or without U0126

(20µM) for 30h. Cell viability was scored by MTT assay. Results were expressed as the

means ± SEM for three independent experiments. Cell survival was expressed as absorbance

relative to that of DMSO- or DMSO plus U0126-treated controls. E) Expression of dominant-

negative MEK1 makes MCF-7 cells vulnerable to ER stress- induced cell death. MCF-7 cells

were transfected with a vector encoding a dominant negative HA-tagged MEK1 (K97M) or

an empty vector (pcDNA3.1HA). Pooled transfectants MCF Neo mass and MCF DN-MEK

mass 2 cells were stimulated with thapsigargin (2µM) or tunicamycin (2µg/ml). After 30h,


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

cell survival was assessed by the MTT assay as in panel D.

Figure 5. PI-3K mediates ER stress-induced activation of ERK. A) MCF-7 cells were

exposed to thapsigargin (2µM) or tunicamycin (2µg/ml) with DMSO as a control, LY294002

(20µM), U0126 (20µM) and LY294002 plus U0126 for 30h. Cell viability was scored by

MTT assay. Results were expressed as the means ± SEM for three independent experiments.

Cell survival was expressed as absorbance relative to that of the relevant controls, namely DMSO,

DMSO plus LY, DMSO plus U0126, or DMSO plus LY and U0126. B) MCF-7 cells treated 1h

with vehicle (DMSO), LY294002 (20µM), and U0126 (20µM) were exposed to thapsigargin

(2µM) for the indicated times. The whole cell lysates were subjected to Western blotting with

the antibodies indicated.

Figure 6. ER stress-stimulated induction of cIAP-2 and XIAP is required for cell

survival in ER stress. A) ER stress- induced transcription of cIAP-2 and XIAP. MCF-7

cells were incubated with thapsigargin (2µM) for the indicated times. Total RNA was

prepared. The mRNA levels of the indicated genes were analyzed by semi-quantitative RT-

PCR, GAPDH served as control. B) Protein expression of cIAP-2 and XIAP induced by ER

stress. MCF-7 and SHSY5Y cells were treated with 2µM thapsigargin, 2µg/ml tunicamycin

or vehicle (DMSO). At the indicated time points, cells were extracted. 10ug of total protein

was separated on Novex Tris-Glycine gels and probed using the indicated antibodies. ß-actin

served as a loading control. C) Ablation of cIAP-2 or/and XIAP protein by RNAi. MCF-7

and SH-SY5Y cells were transfected with 21-nucleotide siRNA duplex to cIAP-2 (cIAP-2

siRNA) and/or XIAP (XIAP siRNA) or control siRNA (100nM) using oligofectamine. After

two consecutive transfections with 24 h intervals, cells were treated with thapsigargin (2µM)


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

for the indicated times. Cells were harvested for Western blotting analysis. ß-actin was used

as a loading control. D) Knockdown of cIAP-2 or/and XIAP by RNAi sensitizes cells to ER

stress-induced cell death. MCF-7 cells were transfected with the indicated siRNAs as in

panel C. Cells were incubated with thapsigargin (2µM) or tunicamycin (2µg/ml) in the

presence or absence of zVAD-fmk (100µM), and assessed by phase contrast microscopy. Bar,

50µM. E) After 13h, cell viability was quantified by MTT assay. Cell survival was expressed

as absorbance relative to that of DMSO- or DMSO plus zVAD-fmk-treated controls.

Figure 7. Smac is released during ER stress. A) Immunostaining of Smac/DLABLO.

MCF-7 cells grown on slides were treated with thapsigargin (2µM) for 12 h and incubated

with MitoTracker, then stained using anti-Smac antibodies after fixing. Nuclei were

visualized by Hoechst 33342. Bar, 10µM. B) Subcellular fractionation of Smac. Subcellular

fractionation was performed on MCF-7 cells before and after thapsigargin (2µM) treatment.

The levels of Smac and cytochrome c oxidase IV (Cox IV) in the cytosol fraction were

examined by Western blo tting. ß-actin was used as the loading control.

Figure 8. PI-3K/Akt mediates induction of c-IAP2 and XIAP in ER stress. A) MCF Neo

mass and MCF DN-Akt mass 5 cells were treated with thapsigargin (2µM) for the indicated

times, Total RNA was extracted and analyzed by RT-PCR. B) MCF-7 cells were treated with

thapsigargin (2µM) in the presence of DMSO, LY294002 and U0126, respectively. MCF neo

mass, MCF DN-Akt mass 5, and MCF DN-MEK1 mass 2 (MCF DN-MEK1) cells were

incubated with thapsigargin (2µM) for the indicated times. The cells were extracted and 10µg

of total protein was separated on Novex Tris-Glycine gels and probed with the indicated

antibodies. ß-actin served as a loading control.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Figure 9. Proposed model for ER stress-induced survival responses. ER stress activates

in parallel the UPR and survival mechanisms. UPR prevents cell death through removing

misfolded proteins. Survival mechanisms including Akt, ERK and IAPs counteract ER stress-

induced apoptotic signaling. The balance of survival responses and cell death responses

determines the fate of cells during ER stress.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Acknowledgements We thank Dr.Carlos L. Arteaga for the dominant negative Akt plasmid and Dr.

Natalie. Ahn for the dominant negative MEK1 plasmid.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Ping Hu, Zhang Han, Anthony D. Couvillon and John H. Extonendoplasmic reticulum stress-induced cell death

Critical role of endogenous Akt/IAPs and MEK1/ERK pathways in counteracting

published online August 31, 2004J. Biol. Chem.

10.1074/jbc.M407700200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M407700200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M407700200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/08/31/jbc.M407700200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2004/08/31/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/08/31/jbc.M407700200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

Critical Role of Endogenous Akt/IAPs and MEK1/ERK Pathways ... · extracellular signal-regulated...

Documents

Transcript of Critical Role of Endogenous Akt/IAPs and MEK1/ERK Pathways ... · extracellular signal-regulated...