Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a...
Transcript of Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a...
![Page 1: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/1.jpg)
1
April 20th, 2016
Dave Abel
Cool Applications: CS + Biology (and friends)
![Page 2: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/2.jpg)
Schedule
2
‣ Wednesday (Today): Randomness, CS + Bio!
‣ Friday (4/22): What CS to take next? Graphics!
‣ Monday (4/25): Dave’s Research
‣ Wednesday (4/27): Last Day! Whole Term Recap + Final Review
‣ March 10th: Writing Assignment Due
‣ March 15th: Python Project Due
‣ March 19th: Final Exam, 2pm in LIST 120.
![Page 3: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/3.jpg)
‣ If you want to go, email me with subject “Yurt”
‣ Specify which time you’d like to go:
- 5 slots left: Monday, May 9th from 2pm-3pm
- 1 slots left: Tuesday, May 10th from 11am-noon
Yurt, Round Two
3
![Page 4: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/4.jpg)
Writing Assignment
4
‣ Writing Assignment Rubric Released
- Find a few academic articles or papers that discuss how CS has affected a different topic of interest to you.
- Write a short reflection paper summarizing and analyzing the topic, focusing on the technical explanation and on how computer science concepts are relevant to it.
- Due May 10th.
- 800-1200 words (~2 pages)
![Page 5: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/5.jpg)
Python Project
5
‣ Python Project Rubric Released
- Due May 15th.
- Stencil Code Released.
- More than happy to help in office hours, over email.
![Page 6: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/6.jpg)
Other Notes
6
‣ No more labs! Don’t go to your lab tomorrow.
‣ No more regular homework (writing assignment is the last homework).
‣ Final Exam review session will be held closer to reading period.
‣ My office hours will be changing during reading period.
![Page 7: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/7.jpg)
Randomness
7
![Page 8: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/8.jpg)
‣ Earlier notion of randomness from Theory!
‣ The higher the Kolmogorov complexity, the more random an object is.
Randomness
8
![Page 9: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/9.jpg)
Randomness
9
‣ But how about events? Really, we want this:
![Page 10: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/10.jpg)
Randomness
10
‣ But how about events? Really, we want this:
‣ But suppose we didn’t have this block. How could we write a block to carry out random operations?
![Page 11: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/11.jpg)
Randomness
11
‣ Everything has been so deterministic:
![Page 12: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/12.jpg)
Randomness & Crypto
12
Bob
Eve
Alice
plaintext encrypted text decrypted text
![Page 13: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/13.jpg)
Randomness & Crypto
13
Eve
Randy
![Page 14: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/14.jpg)
Randomness & Crypto
14
Eve
Randy
“I have figured out a way to simulate random coins!”
![Page 15: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/15.jpg)
Randomness & Crypto
15
Eve
Randy
“I have figured out a way to simulate random coins!”
“No way…”
![Page 16: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/16.jpg)
Randomness & Crypto
16
Eve
Randy
Eve gets to see Randy’s “random” guess, and
the coin.
![Page 17: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/17.jpg)
Randomness & Crypto
17
Eve
Randy
Gets to see, lets say, 1000 answers from
both.
![Page 18: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/18.jpg)
Randomness & Crypto
18
Eve
Randy
Q: Can Eve correctly guess which box is
Randy?
![Page 19: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/19.jpg)
Randomness & Crypto
19
Eve
Randy
Q: Can Eve correctly guess which box is
Randy?
If Eve can be right more than 1/2 the time, Randy isn’t
Random
![Page 20: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/20.jpg)
(Psuedo)-Randomness
20
‣ Definition: A process is pseudorandom if an adversary, Eve, cannot distinguish the process from a truly random process!
![Page 21: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/21.jpg)
(Psuedo)-Randomness
21
‣ Definition: A process is pseudorandom if an adversary, Eve, cannot distinguish the process from a truly random process!
‣ Q: Can humans do this?
![Page 22: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/22.jpg)
Psuedorandomness
22
‣ Definition: A process is pseudorandom if an adversary, Eve, cannot distinguish the process from a truly random process!
‣ Q: So how do we achieve this?
‣ A: One Way Functions!
INPUT OUTPUT
![Page 23: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/23.jpg)
OWFs as Pseudorandom Generators
23
‣ Intuition: If it’s easy for you to figure out why something happened, then it’s not really random.
‣ One Way Function: It’s hard to figure out the input, given the output.
![Page 24: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/24.jpg)
Why Did I Cheat Before?
24
‣ An object that generates pseudorandom numbers is called a PseudoRandom Generator, or PRG
Eve
PRG
![Page 25: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/25.jpg)
seed
Why Did I Cheat Before?
25
‣ An object that generates pseudorandom numbers is called a PseudoRandom Generator, or PRG
‣ PRGs require what is called a “seed”, which is effectively the input to the OWF.
Eve
PRG
![Page 26: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/26.jpg)
‣ Once we use this seed once, we can reset the seed by combining the output of our PRG with the old seed:
Why Did I Cheat Before?
26
Eveseed
TPRG
![Page 27: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/27.jpg)
‣ Once we use this seed once, we can reset the seed by combining the output of our PRG with the old seed:
Why Did I Cheat Before?
27
Eveseed
PRG
Private Key =
![Page 28: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/28.jpg)
OWFs as Pseudorandom Generators
28
‣ Intuition: If it’s easy for you to figure out why something happened, then it’s not really random.
‣ One Way Function: It’s hard to figure out the input, given the output.
‣ Conclusion: we can extend One Way Functions to create Pseudo Random Number Generators (and not cheat)!
![Page 29: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/29.jpg)
Computation meets Biology
29
‣ Computation and:
1. Medicine
2. Genetics
3. Sustainability
4. Neuroscience
5. Evolution
![Page 30: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/30.jpg)
Digital Physics
30
![Page 31: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/31.jpg)
Computation as a Tool for Understanding Reality
31
‣ Newton: use math to model the laws of the world.
‣ Turing: “the extent and limitations of mechanistic explanations of nature”
http://www.worldofcomputing.net/wp-content/uploads/2013/01/turingMachine.gif
![Page 32: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/32.jpg)
1. Computation + Medicine
32
![Page 33: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/33.jpg)
Medical Diagnosis
33
‣ INPUT: A patient’s symptoms
‣ OUTPUT: A medical diagnosis
![Page 34: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/34.jpg)
Medical Diagnosis
34
‣ INPUT: A patient’s symptoms
‣ OUTPUT: A medical diagnosis
= symptoms= diagnosis
+ a Database!
![Page 35: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/35.jpg)
K Nearest Neighbor
35
= class one= class two= class three
K = 3
![Page 36: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/36.jpg)
‣ Labels are now diagnoses
‣ Training Data are symptoms
‣ Medical Diagnosis as ML!
K Nearest Neighbor
36
Temperature
Blood Pressure
![Page 37: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/37.jpg)
IBM’s Watson
37
![Page 38: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/38.jpg)
Kidney Donors
38
‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend.
‣ Kidneys have a “type”, similar to blood; your friend needs a kidney of the right type.
‣ So instead you donate your kidney to a donor community; you give a kidney of any type, and get a kidney back for you friend of the right type.
![Page 39: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/39.jpg)
Kidney Donors
39
‣ But once people get their kidney, they’ll often back out of the donation!
‣ So instead, surgeons have started doing simultaneous kidney transplant surgeries, all at once, between circles of people.
![Page 40: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/40.jpg)
Kidney Donors
40
‣ But once people get their kidney, they’ll often back out of the donation!
‣ So instead, surgeons have started doing simultaneous kidney transplant surgeries, all at once, between circles of people.
AB
CD
![Page 41: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/41.jpg)
41
2 min
3 min
1 min
2 min
2 min
2 min
1 min
Remember Circles + Lines?
![Page 42: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/42.jpg)
Circles + Lines!
42
2 min
3 min
1 min
2 min
2 min
2 min
1 min
Circle: an object (a location in this case)Line: a relation between objects (tram, in this case)
![Page 43: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/43.jpg)
Called a “Graph”
43
2 min
3 min
1 min
2 min
2 min
2 min
1 min
Circle: an object (a location in this case)Line: a relation between objects (tram, in this case)
![Page 44: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/44.jpg)
Kidney Donors
44
‣ But once people get their kidney, they’ll often back out of the donation!
‣ So instead, surgeons have started doing simultaneous kidney transplant surgeries, all at once, between circles of people.
AB
CD
![Page 45: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/45.jpg)
Find the Cycles!
45
AB
CD
AB
CD
AB
CD
AB
CD
![Page 46: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/46.jpg)
Find the Cycles!
46
A B
CD
A B
CDA B
CD
A B
CD
INPUT:
OUTPUT: A list of cycles
(with about x100000 more
circles)
![Page 47: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/47.jpg)
Find the Cycles!
47
A B
CD
A B
CDA B
CD
A B
CD
INPUT:
OUTPUT: A list of cycles
(with about x100000 more
circles)
Computational Solutions!
![Page 48: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/48.jpg)
Medical Imaging
48
![Page 49: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/49.jpg)
Medical Imaging
49
Understanding Brain Region Functionality
[Ng, Milazzo, Atmman, 2015]
![Page 50: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/50.jpg)
2. Genome Sequencing
50
‣ DNA: molecule for carrying genetic information
‣ Four “bit” values: A, G, T, C
![Page 51: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/51.jpg)
Genome Sequencing
51
‣ Goal: understand what is going on in the DNA.
‣ Application: Cancer Research.
![Page 52: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/52.jpg)
Genome Sequencing
52
‣ Goal: understand what is going on in the DNA.
‣ Application: Cancer Research.
AGAGATTAGCTAGCAATCGCGGGATAGCGCTAGCTAGCACGAGGGAGTTCCTAGAC
![Page 53: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/53.jpg)
Genome Sequencing
53
‣ The tool we have for reading DNA gives us snippets:
1 42 3 5AGAGATTAGCTAGCAATCGCGGGATAGCGCTAGCTAGCACGAGGGAGTTCCTAGAC
![Page 54: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/54.jpg)
Genome Sequencing
54
‣ The tool we have for reading DNA gives us snippets:
1 4
2
3
5
6
![Page 55: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/55.jpg)
Genome Sequencing
55
‣ Problem: Recreate DNA from snippets
1 4
2
3
5INPUT:
OUTPUT:
6
AGAGATTAGCTAGCAATCGCGGGATAGCGCTAGCTAGCACGA
![Page 56: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/56.jpg)
Genome Sequencing
56
‣ Problem: Recreate DNA from snippets
1 4
2
3
5INPUT:
OUTPUT:
6
AGAGATTAGCTAGCAATCGCGGGATAGCGCTAGCTAGCACGA
Computational Solutions!
![Page 57: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/57.jpg)
Computation & Genome Sequencing
57
‣ Used for better understanding cancer mutations, cancer growth, occurrences of cancer, treatment.
‣ Used for computational evolutionary biology; evaluate disorders, changes of a species over time.
‣ And more!
![Page 58: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/58.jpg)
3. Computation and Environmental Science
58
![Page 59: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/59.jpg)
RL + Sustainability
59
‣ Reinforcement Learning:
- Learn through reward/punishment
- Learn a model of the world
- Maximize long term reward
![Page 60: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/60.jpg)
Renewable Resource Allocation (RRA)
60
‣ Resource Allocation: How to distribute a resource to a variety of entities that need/want it?
‣ Renewable Resource Allocation: How should our strategy differ when the resource is renewable?
- We have 10 carrots planted.
- As of Friday, each carrot that is still planted will create two more carrots.
- 20 people each want a carrot, now.
![Page 61: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/61.jpg)
RL + RRA
61
![Page 62: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/62.jpg)
The Pacific Halibut
62
Idea: If RL can solve Mario and Go, it ought to be able to solve other problems in the real world of similar difficulty.
![Page 63: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/63.jpg)
The Pacific Halibut
63
Idea: If RL can solve Mario and Go, it ought to be able to solve other problems in the real world of similar difficulty.
1. Learn a model of fish hatchery behavior
![Page 64: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/64.jpg)
The Pacific Halibut
64
Idea: If RL can solve Mario and Go, it ought to be able to solve other problems in the real world of similar difficulty.
1. Learn a model of fish hatchery behavior
2. Simulate into the future what happens when making
certain policy decisions
![Page 65: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/65.jpg)
The Pacific Halibut
65
Idea: If RL can solve Mario and Go, it ought to be able to solve other problems in the real world of similar difficulty.
1. Learn a model of fish hatchery behavior
2. Simulate into the future what happens when making
certain policy decisions
3. Find the strategy that maximizes reward
![Page 66: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/66.jpg)
The Pacific Halibut
66
+10
Idea: If RL can solve Mario and Go, it ought to be able to solve other problems in the real world of similar difficulty.
![Page 67: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/67.jpg)
The Pacific Halibut
67
+10
+2
Idea: If RL can solve Mario and Go, it ought to be able to solve other problems in the real world of similar difficulty.
![Page 68: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/68.jpg)
The Pacific Halibut
68
+10
+2-1
Idea: If RL can solve Mario and Go, it ought to be able to solve other problems in the real world of similar difficulty.
![Page 69: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/69.jpg)
The Pacific Halibut
69
+10
-3
+2-1
Idea: If RL can solve Mario and Go, it ought to be able to solve other problems in the real world of similar difficulty.
![Page 70: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/70.jpg)
4. Computational Neuroscience
70
![Page 71: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/71.jpg)
Vision
71
![Page 72: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/72.jpg)
Diagnosing Alzheimers
72
[Rudzicz et. al 2015]
![Page 73: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/73.jpg)
Brain Computer Interfaces
73
![Page 74: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/74.jpg)
Brain Computer Interfaces
74
![Page 75: Cool Applications: CS + Biology (and friends) · Kidney Donors 38 ‣ Suppose a friend needs a kidney, and you want to donate yours to help your friend. ‣ Kidneys have a “type”,](https://reader034.fdocuments.net/reader034/viewer/2022042804/5f5be8482af6eb3a3b14ec73/html5/thumbnails/75.jpg)
And Many More!
75
‣ Computational Evolutionary Biology
‣ Biological Computation (use DNA to compute!)
‣ Computational Pharmacology, Drug Discovery
‣ Computational Epidemiology
‣ … the list goes on!