CONSTRUCTION AND CHARACTERIZATION HYPOXIA...
Transcript of CONSTRUCTION AND CHARACTERIZATION HYPOXIA...
THE CONSTRUCTION AND CHARACTERIZATION OF HYPOXIA
RESPONSAE REPORTER GENES FOR USE IN TRANSGENIC MICE
Lorraine Tarnar Howard
A thesis submitted in conformity with the requirements for the degree of Master of Science
Graduate Department of Molecular and Medical Genetics University of Toronto
O Copyright by Lorraine Tamar Howard 2001
---- * - ..2 uisi@ns and Acq$sitiom et ~ o g n p h i Sewices se-s 6BTo(lraphtqu8s
The author has granted a non- exclusiw licence aUowing the National Library of Canada to reproduce, loan, distniute or sell copies of this thesis in microform, paper or electronic formats.
The author retains ownership of the copyright in ÜUs thesis. Neither the
L'auteur a accordé une Licence non exclusive pemetiant à la Biôli0thé:que nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la forme de microfiche/nlm, de reproduction sur papier ou sur format Clectronique .
L'autew conserve la propriété du droit d'auteur qui protège cette thèse.
thesis nor substantial extracts fkom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son penni ssion . autorisation.
Abstract
-=-A
THE CONSTRUCTION AND C H ~ C T E ~ Z A T I O N OF HYPOXIA RESPONSIVE
REPORTER GENES FOR USE IN TRANSGENIC MICE
Lorraine Tamar Howard
Master of Science 200 1
Molecuhr and Meàical Genetics
University of Toronto
Evidence in the literature suggests that conditions of low oxygen may have a role in the
development of the vasculature. To examine the areas of hypoxia in a deviloping mouse
embryo, traasgenes were developed coupling hypoxia responsive elements (HRE) to exogenous
promoter-reporter cassenes. Transient expression assays with these constructs show that HRE
sequences fiom different sources provide significantly different levels of induction in constant
backgrounds. Furthemore, evidence is presented to show that an HRE is not always sufficient
to confer hypoxia-sensitive activity to a transgene. Finally, preliminary evidence demonstrates
that two HRE transgenes show activity under physiologically relevant oxygen concentrations.
The use of HRE-based transgenes in the determination of embryonic hypoxia is discussed.
Acknowledgements
"You look-attrees ancf tabefttiemjust sa, (for trees are 'trees' and growing is 'to grow')"
"Yet trees are not 'trees', until so named and seen" "He sees no stars who does not see hem f h t of living silver.. ."
-- J.R.R. Tolkien, "Mythopoeia"
There are so many people that 1 would like to thank for helping me over the course of this
degree, but foremost among them is my supervisor Janet Rossant. Janet, thank you for your
support and guidance over the past three years - it bas been an incredible experience workiog in
your lab, and I consider myself extremely fortunate to have had the chance to leam from you.
Thank you also for giving me the chance to figure out what it is that 1 want to do: the most
strongly held ideas are not always the best ones. Many thanks also go to my cornmittee members
Alan Cochrane and Andras Nagy for their advice and guidance, especially when 1 hit the tough
parts. Th& you for helping me leam to become a better student.
Thanks also to al1 of the members of the Rossant lab for your fkiendship, advice, and
encouragement-you guys are great! Special thanks go to Masatsugu Ema, Laura Corson, Dan
Strumpf, and Perry (Tex?) Liao for helping me to leam several techniques, and providing
reagents, but especially for giving me moral support, advice, and encouragement!
My thesis could not be complete without mentioning the bunch at Knox College who have
made the last three years unforgettable. Among these are "Third East", including veteran
damsels Jen, Doma, Jess, and Kim, "the Crafiers" Susan, Claudia, and Rebecca, and al1 of the
people past and present who believed in the wonders of blue mice. Thanks to Daniela D'Anie110
for going above and beyond countless times. To my friend and fellow lab rat Albert Chang,
thanks for keeping me sane, especially when "sane" was somewhat relative. To my good nlend
Sheela Rupal thank you for being there, 1 kaow that you will go far along whatever path you
choose.
Finally, thank you to my family for al1 of your love, encouragement, and support. Whether it
came in the form of cwkies, a c raq phone call, deep thoughts, or a holiday visit, 1 appreciate it.
I love you-this one is for you.
iii
TABLE OF CONTENTS
................................................................................................................ II . Literature Suwey .4
...................................................................................................... 1 . Vascular Embryology 4
2 . The Drosophila trachea as a mode1 of branching morphogenesis ................................... 13
3 . Molecular determinants of mammalian vascular patteming ............................................ 25
4 . The hypoxic response in mammalian vascular development .......................................... 39
................................................................... III. Introduction to the experimental approach ..O4
CHAPTER 2: THE CONSTRUCTION AND CHARACTERIZATION OF HYPOXIA
RESPONSIVE REPORTER GENES FOR USE IN TRANSGENIC MICE
II . Discussion ..................................... ~ . o o ~ ~ o o o * o o ~ o a m ~ ~ ~ o o o o * * * o * o * o o m ~ ~ ~ m o a ~ m ~ ~ o m ~ ~ ~ o ~ m o o ~ ~ o o o ~ ~ ~ m ~ ~ ~ ~ o m o o o o o m o o o m m o o o o o ~ o 9 3
ILI. Conclusions .................................................................................m................................... 102
IV, Materials and Methods .....a.............. .... ..........................................................m........ 103
V . References ............................m........................................................m.m................................. 108
CHAPTER 3: FUTURE DIRECTIONS
............................................................................................................................ 1. Summary 112
1 I. Future Directions ............................................................................................................. 113
............................................................ 1 . An examination of HRE structure and fhction 113
............................... 2 . The optimization and implementation of an HRE based transgene 114
3 . Identification of areas of hypoxia during normal embryonic development ................... 117
III . Final Commenfg.. ......mm.................................................m...m.............................................. 120
N . References ....................................................................................................................... 121
CHAPTER 1
INTRODUCTION
1. General Introduction and Rationale: - .. . .. - - - - - -
The vasculature is one of the most important and complex organs in the mammalian body.
The first fuactional organ to form during embryonic development, the intricately branched
nehkrork of endothelial, and supporting periendothelial cells is essential for the transportation of
oxygen and nutrients to, and the removal of waste products nom the tissues. Serious dismptions
in the formation of the vascular network are lethal early in post-implantation development, while
the maintenance of vessel integrity and the control of vessel physiology and hemodynamics have
important consequences throughout embryonic and adult life.
The identification and characterization of genes involved in the development and maintenance
of the vasculature is a diverse and rapidly expanding field with numerous applications to medical
research, and the treatment of disease. Several hereditary conditions, including venous
malformations, and the Alagille syndrome have been shown to be caused by defects in genes
involved in the development of the vasculature; other diseases such as diabetic retinopathy,
ischemia, and arthritis, also have important vascular components. Especially interesthg is the
discovery that growing tumours and their metastases cospt host blood vessels to allow growth
beyond a defined size; clinical trials of anti-angiogenic cancer therapies are ongoing, with many
more to be tested in the near fiiture.
Clearly the development of a healthy, fuoctioning vasculature is of critical importance to the
survival of both embryo and adult; despite this fact, many questions remain unanswered. How
are vessels pattemed? What mechanisms ensure that al1 tissues have access to the blood? What
genes are involved in the differentiation, development, and maturation of the vascular network?
Examination of the development of other branched structures, such as the mammalian lung, and
Drosophila trachea show that both intriasic programs and extrinsic cues are required to ensure
correct delivery of oxygen to the tissues. 1s the mammalian vasculahire pattemed solely by
intrinsic developmental programs, or cm it respond to extrinsic cues encountered over the course
of embryogenesis? 1s then a role for hypoxia in normal vascular development?
The idea that hypoxia may have a role in the developing embryo is intuitively attractive. In
the early (pre-implantation) stages of development embryonic cells obtain oxygen and nutrients
3 by diffusion. As the embryo continues to grow, it reaches a point where diffision is insufficient
to supply the tissues, forcing it to develop a more efficient method of transport. The formation a - - - -
of the yolk sac, with its extensively branched vasculatwe, is one method by which a growing
embryo can obtain oxygen and nutrients; the large surface area of the yolk sac allows diffision
of oxygen into the vasculatwe, for transport into the embryo. As the embryo continues to grow,
this too becomes insufficient, and later stages of development connect the embryo to the
matemal circulatory system through the placenta. Given this context, it is reasonable to
hypothesize that hypoxic conditions arising nahually during development might have a role in
initiating the early stages of differentiation, or guiding some of the later branching events which
occur in the developing embryo. In this thesis is descnbed the construction and in vitro analysis
of a senes of transgenes designed to examine the extent and localization of hypoxic tissues in the
developing mouse embryo.
II. - - Literature Survey 1. Vascular Embryology
Throughout human history, man bas speculated on the role of the circulatory system. Once
thought as a seat for emotion and reason, later as the source of a body's "humours", work
throughout the twentieth cenhüy has shown the cardiovascular system to be a complex,
intricately branched network. Developed through a combination of intrinsic developmental
programs, extrinsic adaptation, and hemodynamic constraints, a functioning vasculature is
essential to ensure sufficient oxygen and metabolites to al1 of the tissues in the body.
Although many groups are currently working to identiQ the specific molecular mechanisms
involved in mammalian vascular development, the fundamental principles of vesse1 growth were
discovered using the chick. Light and electron micrograph analyses, coupled with the
production of quaii-chick chimeras, pioneered by F. Dieterlen-Lievre, and N. Le Douarin, have
been critical to understanding the basic processes, morphogenetic movements and lineages that
occur to produce the vasculature lo4. Current ideas hold that a primaty capillary plexus, formed
by vasculogenesis, is remodeled through sprouting angiogenesis to form a mature branched
network (Figure 1). Furthemore, observations made on chick vascular development, coupled
witb recent embryological work by the lab of Dieterlen-Lievre have shown a close association
between the endothelial and hematopoietic lineages in specific areas of the developing chick.
This observation is one of several pieces of evidence supporting the existence of the
hemangioblast, a bipotential precursor capable of forming bodi the endothelial and hematopoietic
Iineages.
Early work on vascular development was performed by Florence Sabin in the early 1900s
I .~rom ber detailed studies of the chick blastoderm she proposed the existence of angioblasts,
specialized cells easily distinguishable fkom the surroundhg mesencbyme, that could
differentiate into cells of both the endothelial and hematopoietic lineages. She also observed
"masses of cells that.. . develop hemoglobin and become eythroblasts," which she terrned blood
islands. Interestingly, Sabin concluded that vascular lumiiia were derived fkom cytolysis and the
production of an intracellular space, rather than h m an extracellular origin.
Figure 1 : A schematic o v e ~ e w of vascular developrnent
Hematopoietic
precursor
Hematopoietic
lineages
Hemangioblast
Endothelial precursor
Primary capillary plexus
Mature branched network
- . 6
Figure 1 :An ovewiew of the stages in vascular development. A multipotential precursor cell, the
a -- hemangioblast, - produces cells - of both - the hematopoietic and endothelial lineages. Endothelhl cells migrate and divide to form the primary capillary plexus. This primitive
vascular network is remodeled to form a branched network. The association between the
endothelium and smooth muscle cells is omitted for clarity. 39
Further detail on vascular development - - would wait until the advent of electron microscopy
and the work of Gonzalez- Crussi, Hiruma, and Hirakow 295. Study of thin sections of 6-16
somite stage embryos confirmed the formation of angioblastic clusters, with lumina existing as
regions of extracellular space, gradually enclosed by endothelial cells. Gonzalez-Cmssi also
described the formation of vascular plexi, onginally lacking a basement membrane, that are
remodeled as development progresses 2. Furthemore, arterial pressure caused by flowing blood
was detected in vessels formed solely fiom endothelial cells; arguments were made that later
changes in vessel structure could be caused in part by hemodynamic pressure.
Observations made of endothelial ce11 biology have shown that immature endothelial cells
have a rounded morphology, with a small surface-area to volume ratio 2,596. As the vesse1
matures, the endothelial cells elongate to fom thin-walled tubes. These new vessels are fragile,
and gradually becorne smunded by periendothelial support cells. Detailed study of vessel
morphology has s h o w that the endothelium fashions two types of tubes. Larger vessels have
lumina originally derived fiom extracellular space, bounded by junctions behveen neighbouring
endothelial cells, or an endothelial ce11 with itself. Such contact results in a "seamed" vessel. It
has been s h o w that "unseameà" capillaries lack these areas of cell-ce11 contact, and are thought
to have intracellular lumina. The formation of multicellular and unicellular endothelial branches
is not unlike the formation of the Dmsophila tracheal network described by Shilo and Krasnow
798 (described below).
A new tool for dissecting apart the mechanisms behind vascular growth was described by the
lab of Fmcois Dieterlen-Livre in 1987 9. The QH1 monoclonal antibody was found to bind to
quail, but not chicken endothelial and hematopoietic cells. At the time of this study, it had been
shown that clusters of endothelial and hematopoietic cells, known as blood islands, arose in the
extraembryonic tissues (area opaca), and that vessels were later observed in the developing
embryo (area pellucida) 10. Pardanaud et al. used QHI immunohistochemistry on quai1
blastodiscs, to confirm that: 1) ~ ~ l ' c e l l s could be fomd in blood islands, which interconnected
to fonn the extraembryonic vasculature. 2) The embryonic vasculature fomed separately fiom
that of the extraembryonic regions, eventually connecthg to form a complete network. These
8 results confirmed, and extended earlier work on quail-chick yok sac chimeras, that had shown
tbat the embryonic and extraernbryonic vasculahire formed independently of one another.
A second important experimental tool had its roots several years earlier. In the late 1960's,
Nicole Le Douarin observed that the interphase nuclei of quai1 cells had a large aggregation of
heterochromatin in the nucleus, making them easily distinguishable nom chick cells 3. This
difference laid the foundation for a vast array of quail-chick grafting experiments; by replacing,
or inserting a piece of quai1 tissue into a chick embryo, and allowing it to develop, one could
determine to which tissues the descendants contributed. Orthotopic or heterotopic grafis could
be performed allowing cornparisons to be made between different graft tissues in a standard
environment 1 1 . Additionally, the heritable label provided by the quai1 nucleoli was
advantageous for fate mapping experiments, as it would not be diluted through ce11 divisions,
unlike the conventional fluorescent dyes 12.
By the late 1980's it was known that that endothelial cells could differentiate in situ to fom
vascular plexi, through a process termed vascuiogenesis. Additionally, Judah Folkman had
observed a second process of vascular modeling, in which new endothelial tubes sprouted fiom
existing vessels 13. This phenomenon, termed sprouting angiogenesis, had been extensively
snidied in tumours, but it was not as well understood in the embryonic context. Some models of
vascular development held that the bone marrow, brain, and kidney were vascularized by
angiogenesis, but it was not known if vasculogenesis occurred concurrently with angiogenesis in
the developing embryo 4. A paper published in 1989 by the Dieterlen-Lievre lab took advantage
of the Q H ~ ' antibody and the nucleolar propertîes of quai1 cells to address some of these
questions, and examine the methods by which tissues were vascularized 4.
With these points in mind, Dieterlen-Lievre's group performed a series of chicldquail grafts
to examine the "angiogenic potential" of different types of tissue. In the first experiments pieces
of chick limb bud, representative somatopleute (ectoderm/mesodemi) derived tissue, were
grafted onto a quai1 embryo 4 (Figure 2). Interestingly, when the embryos were sacrificed a few
days later, the graft tissue was vascularized by QH 1 + endothelial cells. Clearly the chick explant
had been vascularized almost exclusively by quai1 host endothelium. The reverse experiment, a
quail graft into a chick host confhed these observations, as the somatopleuric quai1 grafi was
Figure 2: Schematic diagram of chick embryo (transverse section)
-.Lw-.- -A.. - - -
1 Ec todem
Neural tube
Somatic lateral plate
mesodenn
Coelom
Splanchnic lateral plate mesoderm
Endodenn
Dorsal aorta - Notochord
10 Figure 2: Transverse section of a chick embryo, (Stage 11) showing the arrangement of
-A--- - splanchnic and somatopleuric - lateral - plate mesoderm relative to the endoderm, ectordem, and donal aorta. Figure is adapted fkom Plate 1 Id, Bellairs and Osmond
1998. 142
vascularized by the QH1' chick endothelium. Expenrnents performed with splanchnopleuric - - - - - - - =' - - -
(endoderm/mesodem) organ rudiments gave the opposite result. Embryos with sections of chick
splanchnopleure in a quai1 host gave a chick-denved vascular network; a quail gr& produced a
~ ~ l ' ( q u a i 1 denved) network in chick. A final experiment using a splenic graft (mesodennal
origin) showed similar results to that of the splanchnopleure grafts; the vasculature was able to
extend out fiom the graA and form chimeric vessels with the host endothelium. In al1 cases,
quail endothelial cells were visualized by QHI+ immunoreactivity, while non-endothelial grafted
tissue could be differentiated through the nucleolar stain. In the conclusion of their 1989 paper,
Pardanaud et al. claimed that, "rudiments composed of mesoderm and ectodenn are sites for
angiogenesis.. .while mesodermal/endodermal rudiments undergo vasculogenesis.
By the early 1990s, it had become clear that vasculogenesis and angiogenesis were processes
that occurred in parallel during development to produce the mature vasculature. Extending this
idea, the lab of Francois Dieterlen-Lievre demonstrated that the mechanism of vascularization
depended on the origins of the tissue 14915. Somatopleural tissues, such as the body wall and
limbs, were vascularized by external angioblasts, which migrated into the tissue to form a
vascular network. Intemal organs of splanchnopleuric origin (heart, h g , digestive organs)
would be vascularized by intrinsic endothelial precursors. In the mid 1990s, Pardanaud et al.
worked to M e r dissect the mechanisms of vascular development and their relationship to
hematopoiesis.
A year later, Pardanaud et al. examined the vasculogenic potential of segmental plate
mesoderm, taterat plate mesodem, and tait bnd grafts, concindmg that there were two separate
lineages of angioblastic cells which contributed to the embryo vasculature 16. The tust lineage,
a line of angioblastic cells derived fiom the sornites, and paraxial mesodem, were capable of
produciag endothelial cells, that colonized the body wall, the kidney, and die wall and roof of the
dorsal aorta. A second cell lineage, produced fkom the splanchnopleuric mesoderm was capable
of forming both endothelial and, in specific regions, hematopoietic cells; splanchnopleure-
derived angioblasts were capable of colonizing the visceral organs, and floor of the dorsal aorta,
in addition to the areas of the somatopleure. It bad long been known that the dorsal aorta was
one of the intraembryonic sites of hematopoiesis; micrographs and other studies of the vesse1
12 showed that the ventral (floor) of the vessel produced clusters of cells, which changed
morphology,-and took on some of thecharacteristics of hematopoietic cells 2. The finding that
splanchnopleuric, but not somatopleuric mesoderm could contribute to these lineages was an
important step towards understanding the origins of the vasculature, and the relationship between
the endothelial and hematopoietic lineages.
A fmal piece of work combined some of the accumulating data on molecular replators of
vascular development with the (now-classic) embryological techniques. In the most recent
experiments, the lab of Dieterlen-Lievre bave used the observation that only splanchnopleure-
derived angioblasts cm colonize the visceral organs and floor of the dorsal aorta, to assay the
developmental potential of treated somitic tissue '. As shown previously, angioblasts fkom
somitic tissue were only capable of colonizing somitopleunc tissues; such angioblasts were
unable to colonize the visceral organs, nor were they found to contribute to the endothelial or
hernatopoietic lineages on the floor of the dorsal aorta. By transiently culturing somitic tissue
with endodenn ptior to grafting, Pardanaud et al. found that they were able to change the
properties of the angioblasts, making them capable of colonizing the visceral organs, and the
floor of the dorsal aorta. Interestingly, a similar effect was observed when somitic tissue was
cultured in the presence of VEGF, TGFBl, or bFGF.
Conversely, when Pardanaud et al. transiently cultured splanchnoplewic tissue with ectodenn,
EGF, or TGFa they reduced the potential of angioblasts to migrate fiom the explant 17.
Splanchnopleuric grafts treated in this way were unable to colonize visceral organs, nor were
they capable of contributing to the hematopoietic clusters on the floor of the dorsal aorta.
Currently there are believed to be two separate sources of endothelial cells in the chick embryo,
which have differeat potentials for invasion and hematopoiesis. in one lineage, angioblasts
derived fiom somatopleural and axial mesodem produce endothelial cells that can invade the
body wall and somatopleural tissues. A second lineage, derived h m the splanchnopleure, and
dependent on a transient contact with endoderm, vascularizes the visceral organs, and is capable
of contributing to hematopoiesis in specific regions of the dorsal aorta.
While electron microscopie analysis of the developing chick vasculature has provided some
useful information on the ultrastnictwe of a vessel, it was the work of Francois Dieterlen-Lievre
13 and CO-workers that has laid the foundations towards understanding the mechanisms in vascular
forqation and patteming. Through the c l ~ s i c embryological techniques of grafting and lineage
mapping, Dieterlen-Lievre et al. have described some of the g e m layer interactions,
differentiation, and migration, that must occur to form the endothelial network. From these
origins have sprung many of the studies of the marnmalian vasculature. The terni vasculogenesis
has corne to describe the mechanism by which endothelial cells differentiate and interact to form
networks in the extraembryonic tissues, and some areas of the embryo 18. Angiogenesis, a terni
originally describing the sprouting of branches fiom pre-existing vessels, has been expanded to
include the stages of branching, remodeling, and occasionally the maturation of the vessel; in
essence the changes that occur in the vascular plexus to produce the mature branched vascular
tree.
2. The DrosophiIu trachea as a mode1 of branching morphogenesis
While much work has been done to understand the fiuidaxnental principles behind vascular
development, many problems remain to be solved. Although we have an understanding of the
origins of endothelial precursors, it is not yet known how the vasculature is pattemed, how
lumina are fomed, or how the vasculature is remodeled to ensure that oxygen is delivered to al1
of the tissues. To address these issues, the labs of Mark Krasnow, Ben-Zion Shilo 8919 and
others have turned to Drosophila. The stereotyped pnmary branches, and intricate arborization
of the Drosophila trachea have proven to be valuable models for dissecting the formation of
branched networks in nature.
The Drosophila trachea is an intricately branched network of tubes used to convey oxygen
from the spiracles to the tissues of the Drosophila larvae; like the mammalian vasculature, the
Drosophila trachea is characterized by a series of stereotyped branches, and variable tracheole
formation. Growth and patternhg of the Drosophila trachea begins with the differentiation of
ten ectodermal clusters on each side of the developing embryo 8.20. These clusters invaginate to
form sacs comprised of approximately 80 cells; subsequent ce11 migration and branch formation
occurs without proüferation or apoptosis. Primary branch formation occurs with the migration of
tracheal cells to form the six major branches of each metamete: the dorsal branch, lateral tnink,
and ganglionic branches migrate along the dorsiventral axis, while the dorsal trunk and visceral
14 branches migrate anteriorally. Secondary branches form with the expression of pantip markers
in the terminal cells; these temiinal cells differentiate to fonn unicellular branches that invade the - -+L- - - - - --- - -- - - - - - - - - -
surrounding tissue. Finally, a finely ramified network of tubules are fomed nom the secondary
branches to become the terminal branches of the trachea. The formation of these seamless
tracheoles has been shown to be responsive to conditions of low oxygen in the surrounding
tissues. (Figure 3)
Three major types of cells comprise the Drosophilu trachea. Terminal cells form the
extensive network of intracellular tubes required to ensure oxygen delivery to the tissues 2 1.
Stalk cells provide the channels through which oxygen can pass, while fusion cells are required
to comect the segmented tracheal network 22. At least two fusion cells, located in the dorsal
trunk and dorsal branches send out fine processes to contact the fusion ce11 of an adjacent
tracheal metamere. In this way tracheal segments can fonn an interconnected network
throughout the embryo 23.
While early models of tracheal development proposed that modifications made to an iterative
genetic program could account for the formation of the complete tracheal network 24, current
ideas hold that several different pathways are required to produce a correctly branched,
functional, trachea. Furthetmore, work perfomed in the labs of Affolter, Shilo, and Krasnow
have shown that three distinct patteming mechanisms are active in tracheal development.
Firstly, it is known that tracheal cells are assigned to a specific branch, and that fusion cells are
specified prior to the onset of migration 22,23325. This intriasic control of tracheal branching is
produced through a combination of Dpp, EGF, and Notch signaling, resulting in the specification
of tracheal ce11 fate, and an alteration of the cellular response to directional cues. A second
method of conîrol is provided by the Brealless (btl) and Branchless ( h l ) genes. Tracheal cells
expressing the Breuihless FGF receptor migrate toward dynamic sources of the Brarchless FGF
ligand provided by the surrounding ectoderm 24; ectopic expression of Branchless results in
migration of tracheal branches towards the expressing cells. The chemotactic response of btl
expressing tracheal cells towards bnl expressing tissues shows that the trachea can be pattemed
by extrinsic cues. A third method of tracheal patternhg is a specialized form of extrinsic
response important in the migration of terminal branches. Tracheoles will grow toward areas of
low tissue oxygenation, through a modification of the bnllbtl pathway 2 1.
--A----- - - - Figure . .- . 3: An overview of the Drosophila trachea
A.
Dorsal Branch
Dorsal T d (anterior) Dorsal Trunk
(posterior)
Visceral branch
Ganglionic branc h Lateral
Tnink
Figure-% A-)A schematicdiagram ofmegmeat of thstncheaI- network. Differentiating tracbai
precmors form a cluster of approxiamately 80 cells, temed the tnicheal placode. In the
early stages of tracheal development, cells migrate nom the placode to produce a series
of stereotyped primary branches. The major branches produced from one such placode
are shown and labelled in A). The Drosophila tracheal network fonns from the
19 intercomection of 20 placodes. B) The formation of secondary and tertiary tracheal
branches. Terminal cells of a primary brancb form a pair of unicellular secondary
branches, tbat can rami@ into a network of subcellular tertiary branches. (Adapted fkom
Krasnow 1997). 8
i. Intrinsic patterning of the Drosophila trachea
The idea that tracheal ce11 fate was detemined pcior to branch formation began with the
observation that mutations in the Dpp receptors punt and thick vein (th) resulted in defects in
specific branches of the developing trachea 25. Embryos lacking tkv orpunt were able to
produce normal anterior-posterior branches, such as the visceral branch and dorsal trunk, but
were unable to produce a dorsal branch, and had defects in the branches migrating ventrally.
Ectopic expression of Dpp prevented the antenor growth of the dorsal trunk, and increased the
number of cells available to migrate dorsally. Studies of tkv and punt expression showed that
both genes were expressed in the placode prior to tracheal ce11 migration; conversely, the Dpp
ligand was expressed as a pair of stripes in the ectoderm dorsal md ventral to the tracheal pits.
Expenments performed with constitutively active and dominant negative tkv receptor confimed
that Dpp activation was necessary for tracheal cell migration. Interestingly, the time of Dpp
activity was important: ectopic Dpp receptor activation had no effect on tracheal patteming
during ce11 migration. From these data, Vincent et al. proposed that Dpp acts to regionalize the
tracheal placode, not as a chemoattractant.
A paper published by Ben Shilo's group a few months later reported that antagonism between
the EGF and Dpp pathways regionalized the tracheal placode 22. In basic EGF signaling, the
EGF receptor, der is b o n d by an active f o m of the spitz ligand. Inactive spitz is ubiquitously
expressed, and becomes functional only after cleavage by rhomboid (rho) and star; specificity of
the EGF signaling is conferred in part by the tightly regulated expression pattern of rho.
Interestingly, EGF signaling was implicated in üacheal patternhg when it was observed that rho
was expressed in tracheal pits; it was later found that mutations in rho resulted in tracheal
defects. Similarly, an examination of spi& group mutants showed that the dorsal trunk and
visceral branches were poorly developed, if not entirely absent. Finally, embryos deficient for
the EGF receptor (der&-'-) did not have correct dorsal tnink migration, and showed fusion
defects. By transgenically expressing the EGF receptor (der) in the trachea of embryos deficient
in der function, Wappner et al. were able to rescue dorsal trunk migration and fusion.
18 Several experiments demonstrated that Dpp and EGF act antagonistically to pattern the
@achea. Firstly ectopic local or trachea1 specific Dpp activation resulted in the loss of the dorsal
tnink, and a reduction in the visceral branch; furthemore, instead of remaining in the tracheal
placode, these cells contribute to the dorsal branch. In the converse experiment, activated spi&
did not alter branch identity in wild-type embryos. When the experiment was repeated in
embryos with reduced levels of Dpp signalhg (tkv +/O), Wappner et al. observed normal dorsal
trunk and visceral branch formation, with a corresponding reduction in the dorsal and visceral
branches. If the EGF and Dpp pathways were antagonistic to one another, then one would expect
the phenotype caused by a hypomorphic mutation in one pathway to be rescued by a reduction in
signaling by the other. To test this prediction, Wappner et al. examined the trachea of embryos
carrying hypomorphic alleles of punt and flb. Double mutant embryos had general
abnonnalities, but were able to produce a continuous dorsal t d . From these data Wappner et
al. concluded that the EGF pathway was essential to assign tracheal cells to the dorsal trunk and
visceral branch fate; the Dpp pathway detennined the cells that would form the dorsal and lateral
tnink branches. Thus the EGF and Dpp pathways act antagonistically to one another to confer
branch identity and pattern the cells of the tracheal placode.
A second exarnple of intriasic patteming came fiom the Sarnakovlis lab 23. In this paper, it
was reported that the decrease in dorsal bmch production in tkv " embryos was accompanied by
a decrease in expression of the fusion ce11 markers headcuse (hdc) and escargot (ex), and fusion
ce11 defects. To m e r examine this phenornenon, Steneberg et al. specifically disrupted Dpp
signaling in fusion cells, and found an increase in fusion defects. Conversely, ectopic activation
of Dpp in tracheal cells resulted in the production of extra fusion cells in a few of the dorsal, and
dorsaI trunk branches studied; fiom this work Steneberg et al. concluded that Dpp was capable of
inducing fusion ce11 fate in the trachea. Interestingly, Notch signaling became implicated in the
detemination of fusion ce11 fate an en'ancer trap screen for genes expressed in fusion cells
identified Delta (a Notch ligand). Using a temperature sensitive Notch mutant, it was observed
that trachea deficient in notch signaling produced additional fusion cells at the expense of stalk
cells. Conversely, ectopic expression of the notch receptor throughout the trachea resulted in
conectly branched metameres that were unable to fuse. Such trachea lacked the expression of
fusion ce11 markers. From these data, Steneberg et al. concluded that Notch-Delta signaling was
essential for the correct specificatioa of the nision cell. In this case, the Delta-expressing fusion
ce11 is thought to activate the Notch receptor on neighbouring cells, preventing them fiom
19 adopting the fusion ce11 fate. Samakovlis' group M e r hypothesize that activated Notch
prevents - - - stalk cells fiom responding to the - Dpp - signal. Although fùrther experiments must be
performed to test this model, it is clear that inûinsic responses to Dpp, Spitz, and Notch signaling
are essential to pattern the tracheal placode, and eaable fuiun branch cells to respond to the
correct developmental cues.
ii. Extrinsic patterning of the Drosophila trachea
While intrinsic mechanisms clearly play a role in establishing ceIl fates, they do not determine
the position of a branch relative to the suiroundhg tissue. Extrinsic patteming mechanisms, such
as the chernotactic responses mediated by Branchless/Breathless interactions are critical for the
correct development of the trachea. The Breathless gene was first identified by Shilo's group,
who noticed that embryos lacking the Breathless gene product were unable to produce a
branched trachea 26. Further studies of the btl locus showed that it encoded a homologue of
mammalian FGFR-1; homozygous mutations at this locus inhibited the correct migration, but not
the early differentiation of tracheal cells, in addition to causing defects in the glial cells of the
midline and the salivary glands 27,*8. Studies of downstream effectors of Breathless signaling
showed that the FGF receptor activates the RaslRaf pathway through DoflStumps 20. Further
work with embryos expressing mutant and cbimeric foms of btl demonstrated that 1 ) btl was
required for the onset of tracheal migration, but not for the determination of the tracheal placode;
2) btl was not required continuously for tracheal morphogenesis, but appeared to be required at
specific stages in the branching sequence 27. Finally, Reichman-Fned et al. concluded that btl
bad a "permissive" but wt an " i n s ~ t i v e " role in patterning the trachea.
While work to this point had demonstrated that btl was necessary for the formation of
primary, secondary, and terminal branches, it was not known if this requirement was for the
correct quantitative or spatial regulatioa of the receptor. Further studies on btl fùnction
demonstrated that constitutively active btl receptor expressed at high levels could not rescue
defects in btl deficient embryos 28. In fact, while tracheal-specific expression of wild-type btl
was sufiicient to rescue the tracheal defects in btl " embryos, expression of constitutively active
btl interfered with the rescue of such embryos. It was also obsewed that the trachea of wild-type
embryos were formed incorrectly on the addition of constitutively active btl receptor. Lee et al.
20 concluded fiom these and other experiments that the Breathless receptor tyrosine kinase is
requued for the cell migration fonning the primary, secondary, and terminal branches. In this - -- -- - - - .
paper, it is also speculated that Breathless activity may be required in a space-specific manner,
since hi@ levels of active Breathless are not sufficient to pattern the trachea.
Evidence for btl-mediated chernotaxis was described with the discovery and characterization
of the Branchless ligand, published by the lab of Mark Krasnow in 1996 24. Identified through
an enhancer-trap screen, embryos carrying strong bnl mutant alleles produced tracheal sacs, but
were unable to complete normal branching. Furthemiore, the bnl locus was haploinsufficient,
with heterozygotes also missing some branches. Sequence information, coupled with genetic
and biochemical tests suggested that bnl was an FGF homologue that could act through the btl
receptor to stimulate branching. The possibility of bnl mediated chemotaxis arose when it was
observed that bnl was expressed by ectodemal (and some mesodennal) cells surrounding the
tracheal sec, at the positions of fùture branch outgrowth. Further analysis of the Bnl expression
pattern has shown it to be highly dynamic: as tracheal branches grow toward bnl expressing
clusters, bnl expression is decreased in the original cells, and is activated in new areas.
Experiments in which bnl was ectopically expressed in wild type and bnl deficient embryos
showed that tracheal branches grew toward the source of bnl in most of the segments of the
embryo. While much more work needs to be perfomed to understand the genetic control of bnl,
it is clear that bnl-btl mediated chemotaxis is essential for the correct patteming of the
Drosophila trachea (Figure 4).
Wolf and Schuh have recently published an interesting twist on the idea of chemotactic
responses in the Drosophila trachea 2 . in theu paper, they observe that a single hunchback (hb)
expressing ceIl could be observed at the posterior-lateral margin of each tracheal cluster. In situ
analyses of this ceIl over several stages of branching morphogenesis suggest that it could connect
the posterior and anterior branches of the dorsal mink, behaving as a "bridge" to ensure proper
comection of the two branches. This hypothesis was supported by the finding that ectopic
expression of hunchback in a cell near the tracheal placode resulted in the misdirection of the
dorsal trunk branch, and the incomct fusion of the anterior and posterior branches. Further
support for an alternate chemotactic mechanism comes fiom studies of trachea formation in bnl,
Figure 4: Extrinsic patternhg of the Drosophila trachea
Figure 4: The tnicheal placode is patterned by extnnsic mechanisms. Branchless (black) is
- - - - -= expressed in cells surrounding the tracheal placode (white). As the tracheal branches
begin to grow toward areas of Branchless expression, Branchless is down regulated in the
original cells (broken lines), and upregulated in a new population of cells (black). 8
Figure adapted fiom Krasnow 1997. 8
23 btl, and hb embryos. Firstly, areas of dorsal tmnk formation have been observed in embryos
lacking h l OF btl funetim, dorsal tnink- bim defetts-have been noted in irb deficient embrycm.
Secondly bnllbtl expression is unaffected in hb deficient embryos, just as hb expression is
normal in bnl or btl deficient embryos. Finally, tunel staining of hb deficient embryos show that
the bridge cells form bnefly, and rapidly undergo apoptosis. From these data, Wolf and Schuh
propose that a hunchbuck expresshg bridge ce11 guides the migration and fusion of the dorsal
txunk, irrespective of the areas of bnl or btl expression; the absence of functional hb results in
bridge cell apoptosis and dorsal mi& fusion defects. While further work must be done to
support or refute the bridge ce11 hypothesis, it does provide new and intriguing possibilities for
the extriasic regulation of tracheal patteming.
iii. Hypoxia and extrinsic patteming
How is an organ modified to fulfill the specific requirements of the organism? Int~itively we
recognize that muscle structure and function can be altered by exercise, and that erythrocyte
content in blood is altered by chronic exposure to reduced oxygen levels *1,3*. How do organs
respond to chemical and physical cues fiom the surrounding environment? A seminal paper
published in 1999 demonstrated that conditions of low oxygen act to pattern the terminal
branches of the trachea; such a mechanism may have important implications for the patteming of
other branched organs, including the mammaüan vasculature 2 1.
To examine the effect of oxygen concentration on the production of terminal branches
exnbryos were grown tmâer 5%, 2t%, and 60.h oxygen and scored for the number of tenninal
branches 21. Through this work, Jarecki et al. demonstrated an inverse correlation between the
concentration of oxygen and the number of terminal branches; 68% more branches were formed
in embryos grown under 5% oxygen compared with those grown under 21% oxygen.
Additionally, branches produced in embryos grown under low oxygen tended to be long, highly
branched, and tortuous when compared witb branches produced under normoxia. By creating
tracheal clones deficient in terminal branching (blistered 3 or lumen formation (synuptobrevin - '-1, Jarecki et al. obsewed that branches fiom neighbouriog segments grew into areas that were
insufficiently oxygeaated by the mutant trachea. To begin to elucidate a mechanism, bnl
expression was examined during the stages of terminal branching. In situ analysis of bnl
24 expression during terminal branching showed that it was nomally expressed in a few cells in al1
tracheated tissues; ubiquitous expression of bnl resulted in tangled masses of tracheal branches. - -- - - -
These observations were consistent with the idea that bnl might be acting as a chemoattractant
for trachea terminal branches. Further expenments demonstrated that bnl protein is upregulated
in larva grown under 5% oxygen compared with siblings grown at 21%. More convhcingly,
areas of poor tracheation, presumed to be hypoxic, expressed increased levels of bnl. Although
more work must be done to understand the mechanisms by which bnl expression is up-regulated
by hypoxia, Jarecki et al. have demonstrated that conditions of low oxygen are instrumental in
patterning the terminal branches of the Drosophifu trachea. Such a finding may be important to
understanding the formation of the mammalian vasculahire.
Over the past decade, the Drosophila trachea has proven to be a valuable mode1 of the
formation of branched networks in vivo. Like the tracheal network, the mammalian vasculature
is comprised of large, multicellular primary, unicellular secondary, and subcellular tertiary
branches. Both the Drosophila trachea and the mammalian vasculature have structures that are
stereotyped between organisms, in addition to more variable components. From a physiologic
perspective, both systems use a semi-iterative tree structure to ensure an extensive area of
coverage, for the delivery of oxygen, and recovery of carbon dioxide. Furthemore, the
formation of a functional lumen of defined size is required for each system. Finally, both
systems are able to adjust to the tissue requirements of the organism after the organ has begun to
fuaction. While it is not yet known if the genetic mechanisms controlling tracheal development
will have direct parallels with those controlling mammalian vascular development, it is clear that
the general mechanisms of intrinsic, extrinsic, and possibly hypoxic regulation are important in
vascular dwelopmcnt and pattcrning. Thm rcprtstntative signaling pathways: VEGF, hg-Tic,
and Ephtin, will be discussed as examples of the current understanding of mammalian vascular
patteminp.
3. Mdecular determinants of mammalian vascular patternhg - =L - A -
i. The VEGF pathway
Originally identified as a vascular permeability factors, the VEGF family of growth factors
are a group of homodimeric glycoproteins whose carefully regulated activity is essential for the
formation and modeling of the vasculahire 31332. Four VEGF genes (A-D) have been identified
in humans, with a fiAh (VEGF-E) produced by members of the poxviridae 31933. Five isofonns
of the VEGF-A gene are produced by altemate splicing in humans; the mouse VEGF gene has
been shown to produce three isofonns of 120, 164, and 1 88 amino acids (a.a.) 34335. Of these
the 120, and 164 a.a. proteins are the most abundant, witb the 164 a.a. isoform acting as the
strongest mitogen. Additionally, it bas been found that the VEGF isoforms differ in the ability to
interact with heparin sulfate proteoglycans; the larger VEGF isoforms can bind heparin, and
associate with the extracellular matrix, while the smallest isoform has been shown to diffuse
freely (discussed in 31). It has been hypothesized that the different isoforms could act in
combination to mediate endothelial ce11 mitogenesis, differentiation, and proliferation.
VEGF ligands have been shown to bind to three major receptors, VEGFR-l/flt-1, VEGFR-
2 / f k 1, and VEGFR-3/flt4, in addition to at least one "accessory receptor", Neuropilin- 1 3 132.
The VEGFRI -3 receptors are characterized by the presence of seven immunoglobulin-like
domains used for binding to the VEGF ligand, and an inhacellular kinase domain (Figure 5).
VEGF binding induces homodimerization of the VEGFR-I and VEGFR-2 receptors 32, followed
by autophosphorylation and activation of the downstream signaling cascade. A single report
claims to show VEGF-mediated heterodimerization of soluble VEGFR-1IFlt-1, and the
extracellular domain of VEGFR-2/Flk-1, however, this finding is unsubstantiated, and its
relevance in vivo is unclear 36. Of the two most-well characterized teceptors, VEGFR-I and 2,
it bas been shown that VEGFR-1 has a ten-fold higher affiity for VEGF than VEGFR-2 32.
Interestingly, WGFR-1 undergoes little detectable phosphorylation when bound to VEGF, whiie
VEGF binding to WGFR-2 results in autophosphorylation at four major sites, followed by the
activation of the Raf/MapK pathway 31.32. In terms of the other receptors, Neuropilin-1 is
thought to act as a CO-receptor with VEGFR-2, while VEGFR-3 signaling is not well understood.
26 Figure 5: Schematic oveMew of the interactions between the VEGF receptors and their ligands
VEGF-A VEGF-A VEGF-A (121,165) (121, 145,165) (165)
VEGF-C VEGF-B VEGF-D
VEGF-C VEGF-D
VEGFR- 1 VEGFR-2 Neuropilin- 1 VEGFR-3 (Flt- 1) W. 1) (Flt-4)
Figure 5: Interactions between the VEGF ligands, and their recepton. The VEGF receptors are
, -- shown with white circles representing the seven immunoglobulin domains, and black
boxes representing the intracellular kinase domains. Listed are some of the different
VEGF ligands that are known to interact with the receptors. This figure was adapted
from Neufeld et al. 1 999. 32
- White it had long been known that VEGF pathway was involved with the differentiation,
proliferation, migration, swival, and pemeability of the vasculature, it is only recently that
researchers have begun to understand how VEGF mediates such a diverse array of effects 1937-
39. Studies of mice with targeted deficiencies in VEGF, VEGFR-1, and VEGFR-2 have shed
some light on this subject. Embryos lacking a single copy of the VEGF gene die very early in
embryonic development with poorly developed dorsal aortae, a reduced density of mesenchymal-
and intersornitic vessels, and defects in remodeling the vasculature 40,41. Embryos homozygous
for the targeted allele had an even more severe phenotype, often lacking the dorsal aortae
altogether, in addition to other major problems forming the vasculature. Mice with targeted
mutations in VEGFR-2 are unable to produce endothelium, and have a marked deficiency in
hematopoiesis 42. Although some expression of VEGFR- 1, and VEGFR-3 was observed in
these mutants, Lac2 expressing cells were found to have a cell-autonomous defect preventing
them fiom fomiing mature endothelial cells, or a vasculature. VEGFR-1 deficient mice differ in
phenotype fiom both the VEGF, and VEOFR-2 knock-out mice 43. In these cases, homozygous
mutant ernbryos make endothelial and hematopoietic cells, but fonn disorganized vessels, dying
by day 9.5. Closer examination of these mutants has shown that the VEGFR-1 mutant
phenotype stems &om a non-ceIl autonomous defect in which extra mesenchymal cells take on a
hemangioblastic fate 44. Interestingly, mice homoygous for a kinase deficient VEGFR-1 show
defects in monocyte migration, but not in vascular development 45.
Currently there are several models proposed to account for the activity of VEGF and its
receptors m vascular development. O h diat VEGFR-I binds VEGF with htgh affhity, and
acts non-ce11 autonomously, it has been proposed that VEGFR-1 expressing cells "soak up"
VEGF, preventing smounding cells fiorn acquinng a hemangioblastic fate 44946. VEGFR-1
deficient cells are less able to bind VEGF, and are unable to prevent neighbouring cells fkom
responding to the signal, resulting in the formation of excess hemangioblasts, and the resultant
"overcrowded" vessels. While this mechanism is not a direct parallel with the intrinsic
patternhg mechanisms elucidated from the Dmophila trachea, there are some similarities. The
use of the VEGFR-1 receptor to prevent neighbouring cells from adopting the hemangioblast
fate, and ultimately responding to developmental cues has a similar effect to the Delta-expressing
29
fusion cells of the trachea preventing neighbouring stalk cells fkom adopting fusion ceIl fate 23.
- Aithoughthe mechanimu d i f f ~ ~ b a t h cases involve a specinc cell type (mesenchymdstalk cell)
undergohg an intrinsic response that renders it unable to respond to later patteming cues.
A second model for VEGF activity stems fiom the observations that VEGF acting through the
VEGFR-2 receptor can stimulate endothelial ce11 chemotaxis; this finding parallels the
chernotactic effects of Branchless FGF on tracheal cells. It has long been known that endothelial
cells could proliferate in response to VEGF, and would migrate toward a point source of VEGF
in vitro 3734'. In one ceIl culture model, in which glomerular endothelial cells were cultured
with rat metanephnc explants, it was found that the endothelium "aligned" and invaded the
explant. Addition of a VEGF, but aot a PBS soaked glass bead resulted in directional migration
of the endothelial cells toward the point source 48. Evidence for a role of VEGF mediated
chemotaxis in vivo was reported by Cleaver and Krieg 49. In Xenopus, the hypochord, an
endodem derivative induced by the notochord, is known to produce a low weight isofonn of
VEGF, thought to stimulate the formation of the dorsal aorta. Through lineage tracing, Cleaver
and Krieg demonstrated that aagioblast precursors arose in the lateral plate mesodemi, and
migrated toward the hypochord, to f o m the dorsal aorta. Removal of the lateral plate mesoderm
fkom both sides of the embryo resulted in the loss of the dorsal aorta, while removal of the lateral
plate mesoderm fiom a single side resulted in defects in the dorsal aorta specific to the operated
side. Although this group did not ablate the hypochord, or block the system with anti-VEGF
antibodies to test their hypothesis, they did show that when angioblast-fiee tissue expressing
VEGF was implanted near to the hypochord, the angioblasts migrated to the site of ectopic
expression. Thus, the VEGF pathway can act to pattern the vasculature through chemotaxis in
vivo.
Just as the hypoxic regdation of Branchless activity was shown to be important to patteming
the Drosophila trachea, hypoxic activation of the VEGF pathway may be important to the
development of the vasculature. Certain observations are suggestive. Firstly, VEGF was
originally identified as a vascular permeability factor expressed in tumour cells; later studies on
tumour development and in a vast array of ce11 lines has shown that VEGF is up-regulated in
cells exposed to hypoxic conditions 50. Work perfomed to dissect the process has shown that
VEGF is upregulated at the transcriptional level through the activity of the HIF pathway
. 30 (described below); additionally, the transcript is stabilized through the binding of the HuR
- - protein 5 1 - 5 3 Given the knowledge that the &ueloping embryo is exquisitely sensitive to
changes in VEGF expression, it is reasonable to hypothesize that areas of embryonic hypoxia,
and associated upregulation of VEGF, may be important to vascular development. In this vein, it
bas been shown that levels of VEGFR-1 mRNA, and VEGFR-2 protein, are also increased in
cells experiencing hypoxia 54955.
Studies of Drosophikr tracheal morphogenesis have demonstrated that both intrinsic and
extrinsic patteming are required to form a mature branched network. Similar mechanisms are
being elucidated in the mammalian vasculature; VEGF-mediated differentiation, chemotaxis, and
hypoxia-responsiveness are three methods by which the VEGF pathway models the vasculature.
Despite this work, many more experiments will have to be done to determine exactly how VEGF
mediated endothelial survival, proliferation, tube formation, and hemangioblast differentiation
are used in the developing endothelium.
ii. Angiopoietins and Tie receptors in mammalian vascular patteming
While the VEGFNEGFR pathway is a major player in mammalian vascular development, the
activities of the Tie receptors and angiopoietin ligands illustrate other mechanisms by which the
vasculature is pattemed. Tie-1 and Tie-2 were onginally identified by Martin Breitman's group,
in a screen for tyrosine kinase receptors expressed by endothelial cells 56. Sequence analysis
showed the receptors to have a pair of immunoglobulin domains flanking three EGF-like repeats
in the extracellular region, with a split kinase domain intracellularly 57958. Work on the
biochemistry of the Tie receptors has shown that Tie-2 forms homodimers on binding the
Angiopoietin- 1 ( h g - 1, see below) ligand, upon which it becomes autophosphorylated and
interacts with a docking protein (Dok-R) 58-60. Several other proteins have been shown to
interact with Tie-2 including Grb7, Grb 14, p85, Grb2, and Shp2 60. Recent work performed in
human, porcine, and bovine ceIl culhue systems suggests that activated Tie-2 might activate Akt
through PI3 Kinase 61. Much less is known about signalhg through the Tie- 1 receptor, and the
identity of the Tie-1 ligand(s) remains unknown 59.
31 In 1996, George Yancopoulos and colleagues published a set of papers describing the cloning
aiibchatacterizatioo of A n g i ~ p o i e ~ L, a ligand for Tie-2 62263. Ang-1 was f d to be a
secreted glycoprotein containing a novel N-terminus, a coiled-coiled domain, and a fibrinogen-
like motif 62. Yancopoulos' group reported 97.6% identity between the human and mouse ORF.
Later papers described the discovery of three other true angiopoietins: proteins containing the
coiled-coil, and fibrinogen domains that possess the ability to bind to the Tie-2 receptor 64965.
Several other proteins have been identified which have homology to the angiopoietins, but lack
the capability to bind Tie-2 65. The function of these angiopoietin-related proteins is under
scrutiny.
Studies of the interactions between Ang-1-4 and the Tie-2 receptor have shown that Ang- 1
and Ang-4 can act as agonists, siimulating Tie-2 autophosphorylation and activity of downstream
pathways 65966. h g - 2 and Ang-3 have been s h o w to mediate little receptor activation in
endothelial cells, and cm antagonize Ang-1 mediated Tie-2 activation (Figure 6). While much
of the activation data was obtained through ce11 culture systems, experiments performed with
Ang-2 transgenic mice have suggested a role for h g - 2 antagonism in vivo 64. Interestingly,
several groups have observed that both Ang-1 and Ang-2 can activate Tie-2 receptor ectopically
expressed in fibroblast cells 66'6'. The in vivo relevance of this fuiding is unclear, and it has
been suggested that the contradictory tindings are due to the activity of an as-yet-unidentified
accessory protein. Dissection of the fuoctional domains of h g - 1 and Ang-2 indicated that Ang-
1 may act as a homotrimer, and Ang-2 as a homodimer; in both cases, interactions are mediated
by the coiled-coi1 and N-terminal domains 68. Studies of chimeric proteins have demonstrated
that agonist/antagonist activity is coaferred by the receptor binding fibrinogen-like domain 68.
Studies of transgenic mice clearly show a role for the Tie receptors and angiopoietin ligands
in the development of the vasculature 58369. Unlike the VEGFR mice, which had problems
forming the primary vascular network, Dumont et al. report that embryos deficient in Tie-2 die
by day 9.5-10 with heart and vesse1 remodeling defects58. Specifically, the endocardiurn of Tie-
2 4 embryos had reduced trabeculation, and areas in which the endothelial cells had
disassociated fiom the myometrium. Blood vessels appeared to be enlarged, with fewer
branches, and abnormally homogeneous large and mal1 branches 58369. Micrograph analyses of
32 Figure 6: Schematic overview of the interactions between the Tie-1 and Tie-2 receptors and the
Tie-2 Tie- l
33 Figure 6: As described in the text, Angiopoietin-1 (Ang-1) has been shown to bind to the Tie-2
recepfot te act as an egonisthendocheüaC cells. An@ acts as an antagonia to Ang-l
mediated activation in endothelial cells, although it has been shown to act as an agonist in
Tie-2 expressing fibroblast cells. Ang-3 and Ang-4 are thought to be divergent
counterparts of the same gene in mouse and human. Interestingly, while both Ang-3 and
Ang-4 bind to the Tie-2 receptor, Ang-3 acts to antagonize, and Ang-4 acts to stimulate
the activity of the Tie-2 receptor. The major domains of the Tie-1 and Tie-2 are
represented in the diagram: black boxes correspond to the intracellular split kinase
domains, gray boxes correspond to the EGF-like repeats, and the circles represent the
imrnunoglobulin-like domains. Figure adapted from Yancopoulos et al. 2000. 75
34 ~ie-2-/- vessels showed that ~ie-2-'- endothelial cells were more rounded in appearance, and were
less associaîed with either the periendothehi suppoacells, or with the extracellular matrix 6.
Dumont et al. also comment upon a reduced number of endothelial cells in Tie-2 mutant
embryos, but did not conclude whether such a difference was due to a decrease in proliferation,
or an increase in apoptosis of the endothelial cells 58. Other studies by Dumont and others
suggests that the Tie-2 receptor does not play a role in stimulating endothelial ce11 proliferation
58960,67970. Instead, Tie-2, and the angiopoietins may encourage endothelial ce11 swival by
preventing apoptosis due to anoikis (detachment fiom extraembiyonic support) 60,61967969,
~ie-1' targeted transgenic mice demonstrated a different role for the receptor in vascular
development. Unlike the Tie-2 and VEGFR phenotypes, most Tie-1 knockout mice die between
day 13.5 and P l with localized hemorrhaging and tissue edema 69971972. ~ie-1'" pups die
shortly after birth due to breathing difficulties, possibly caused by the failure of alveolar
expansion. Closer examination of the Tie 1-" embryos revealed an excm of vascular branches
formed with no apparent increase in ce11 proliferation (as estimated by PECAM staining).
Stained sections sbowed a 1.5 to 2.5 fold increase in vesse1 number, with micrograph analyses
revealing abnormal endothelial filopodia projecting into the vascular lumen 6369. Studies of
chimeras made between Tie-1 -/- ES cells and wild-type morulae demonstrate that Tie-1 is
required ce11 autonomously during the later stages of development 72. Tie-1 deficient
endothelial cells were capable of contributing to the dorsal aorta, hem, and lung, between day
10.5 and 15.5, but were unable to contribute to the vasculature of the midbrain, kidney, adrenal
gland, bladder, or intestine at this time. Interestingly, studies of high percentage adult chimeras
rhowed the absence of Tie-1 -1- endotheliak eells in the capillaries. These findinp extend the
observations made on the original Tie-1 -/- mouse, in which large vessels were normal in
appearance, with defective morphology only at the sites of hemorrhage 71. Interestingly, both
Tie-1 -/- and Tie 2 -1- mice show abnormal tissue fold architecture; this finding will become
important in the later discussion of tie-mediated interssusceptive growth as a mechanism by
which Tie/Ang interactions cm pattern the vasculature.
Transgenics overexpressing or abrogating angiopoietin fiuiction have also demonstrated a role
in vascular remodeling and maturation 63. Like the ~ ie -2" embryos, h g l " are capable of
35 forming the primary capillary plexus, but die around day 12.5 with heart and cardiovascular
defects. - AI@" embryos have growth retarded endocardium, with some areas in which the -- - -- - - - - - - - z--- -- -
endothelial lining had collapsed fiom the myocardium. PECAM staining of the heart showed a
reduction in PECAM positive cells. Ang-1" embryos had dilated vessels with fewer branches,
and less of a difference between the diameter of large and small vessels. Micrograph analyses
show that endothelial cells have a rounded morphology and are poorly associated with the
periendothelium and the extracellular membrane. Like ~ie-2" embryos, h g - 1'" vessels have
abnormal tissue folds. As a corollary to the Tie-2 and ~ n ~ ~ 1 - I - experiments, targeted
overexpression of h g - 2 in endothelial cells had similar, or even more severe defects than the
Ang-1 knockout mouse 64. Ang-2 overexpressing embryos were smaller than wild-type siblings,
with "moth-eaten" vessels, collapse of the heart endocardium, and defects in branching. Like the
h g - 1 knockout, endothelial cells overexpressing Ang-2 had a rounded morphology, and a
tendency to detach fiom the mesenchyme. Interestingly, the converse experiment has provided a
new inroad towards the treatment of ischemia, and other problems of circulation.
Overexpression of h g - 1 in skin results in an increase in vessel density. Unlike VEGF
overexpression, which results in long, tortuous vessels prone to leakage, vessels stimulated by
h g - 1 overexpression have increased lumen diameters, and are impervious to leakage induced
by severai reagents 73.74.
Current ideas on Ang-Tie activity suggest that h g 4 mediates interactions between
endothelial cells and periendothelial support cells through the Tie-2 receptor, acting as a
permissive rather than aa instructive signal in vascular remodeling. Ang-2 is thought to act
through Tie-2 as a destabilizing signal, possibly through antagonism of h g - 1 binding. In the
absence of VEGF, and the presence of hg-2 , vessels destabilize, and endothelial cells apoptose,
resulting in vessel regression. In the presence of VEGF, endothelial cells binding Ang-2 will
undergo sprouting angiogenesis, allowing the formation of new vessels. Through in vitro and in
vivo assays, the Tie-Ang pathways have been s h o w to mediate endothelial ce11 chemotaxis, ce11
survival/apoptosis protection, endothelial-ECM interactions, and stimulation of vessel
organization and sprouting. Given this diverse assortment of effects, how are the Angiopoietins
and Tie receptors involved in vascular patteming? Two examples are presented to examine bow
Angiopoietins and the Tie receptors pattern the vasculature in interssusceptive growth and
tumow angiogenesis 75.
While - --- many labs have studied the - formation A - p of branches through sprouting, and receptor-
mediated chemotaxis, it has long been known that large vessels cm have smaller vessels split off
to form new branches 2,596. This process, tenned interssusceptive growth is often overlooked in
reviews of vascular development. Micrograph analyses pioneered by Patan and others have
demonstrated that large sinusoidal vessels, such as the dorsal aorta have folds of tissue that grow
into the lumen of the vessel, and connect with the far wall6. Normal tissue folds, comprised of
an endothelial layer bounding periendothelial cells and bundles of collagen fibers, fuse with the
vessel endothelium, resulting in the formation of a new vessel. Micrograph analysis of the Tie-2-
" vasculature shows the formation of rudimentary tissue folds, comprised of rounded endothelial
cells, and a few scattered collagen fibers. Patan hypothesizes that these folds are unable to split
the vessel properly, resulting in fewer branches. Certainly the abnormal morphology of ~ie-2"'
tissue folds, and the previously documented observations that endothelial cells fail to interact
witb the periendothelium and extracellular matrix are consistent with this model. While more
work must be done in this area, it is intnping that endothelial-mesenchymal interactions,
mediated by the Tie-hg pathway may have a role in vascular patteming.
While much has been done to study Tie-Ang activity in embryonic development, studies on
tumour vascularization have also provided important insights as to the role of the Tie-Ang
pathway in the patteming of the vasculature. One widely held model of tumour development
stated that in early stages of tumour growth cells fulfill their metabolic needs through difision,
and are unable to grow past a certain size (c 1 mm3) without a more efficient system 70976. For
a tumour to grow past this stage, it must "switch on" a vascular response, often through the
expression of VEGF and other angiogenic factors 47977. At this stage, the tumour induces the
growth of host vessels to its margin, and is able to continue its growth. This model, pioneered by
Judah FouUnan has much experimental support, and is fundamental to many of the anti-
angiogenic therapies currently undergohg clinical trials.
While the Folkman model is useful for understanding the growth of tumours initiating in
avascular tissues, Yancopoulos et al. observe that many tumours form in well-vascularized areas
78. Through studies of rat glioma, human glioblastoma, and mouse lung carcinomas,
Yancopoulos et al. have shown that tumours arising in vascularized tissues c m CO-opt host
37
vessels, resulting in a "cuff' of tumour cells surrounding the host vessel 78.79. In response to
this CO-option ( n o h g that Ymcopoulos et al. do not speculate as to how endathelid ceils detect
CO-option), CO-opted host endothelial cells up-regulate Ang-2, dissociate from their smunding
periendothelial support cells, and apoptose. This vessel regression results in extensive tumour
necrosis, followed by robust angiogenesis at the tumour periphery due to the up-regulation of
angiogenic factors 80.
The observations that h g 2 upregulation can destabilize vessels bas provided an interesting
model for vessel growth. It is known that during embryonic development, Tie-2 is expressed in
endothelial cells from day 8.5, with Ang- 1 expressed stmngly in the myocardium nom day 9- 1 1,
and is later distributed in the mesenchyme surrounding the vessels 6396? In the adult, Tie-2 is
expressed at low levels throughout the vasculature, with Ang-1 detected in most vascularized
tissues 63. Ang-2, in contrast, is expressed in the smooth muscle cells, and possibly some of the
endothelial cells of the dorsal aorta and the hepatic vessels, arnong other sites. In the adult, Ang-
2 is expressed in the tissues that undergo vascular remodeling, namely the ovary, placenta, and
uterus. Studies of Ang-1 and Ang-2 expression in the rat ovary have shown a correlation
between Ang-2 expression and follicular angiogenesis 64978979.
Although questions arise as to the relevance of tumour angiogenesis to the development of the
embryonic vasculature, it is intriguing to think that Ang-1 and Ang-2 rnight act in opposition
during embryonic vascular development, as they seem to in adult angiogenesis. Do the changes
to the vasculature seen in normal and pathologie vessel remodeling recapitulate the process of
vascular patteming in the developing embryo? Does h g - 2 mediated vessel regression occur
during the development of the embryonic vasculature? Given the model that Tie-2/Ang
interactions affect the stability of a vessel through regulating endothelial-mesenchymaVmatrix
interactions, the Tie-2/Ang pathway provides another example of an extrinsic interaction that is
important in the patterning of the mammalian vasculature.
iii. Ephrin expression and vascular patteming
While the VEGF and Angiopoietin pathways undoubteàiy have a role in vascular
development, many other genes and pathways have been shown to be required for the correct
38 formation of the vasculature. Details of the activity of such genes in the endothelium, and their
PA -A --- -- potenti@ - - interactions -- established-pathways rqnah enigmatic. Certainly the discovery that
members of the EpWephrin family are required for correct vascular patteming has provided
interesting new ideas of how a vascular network can fom arteries and veins.
The Eph receptors comprise the largest known family of receptor tyrosine kinases; split into
A and B classes based on homology and binding, both the Eph receptors and the membrane-
bound ephrin ligands become phosphorylated upon ligand stimulated clustering, resulting in
reciprocal signalhg 81,82. In 1998, it was well known that ephrin/Eph interactions were
important in axon guidance, and neural crest ce11 migration. Additionally, some evidence had
shown that ephrins were involved in vascular development 81983. Despite this background, the
publication by Wang et al. demonstrating differential expression of and roles for ephrin B2, and
Eph B4 in vascular patteming came as a surprise to both the vascular and the ephrin communities
81984. Although it was known that the primary capillary plexus was formed, and some
angiogenic remodeling occurred prior to the commencement of circulation, it was commonly
held that the differences between arteries and veins were formed during later stages of
remodeling, due to hemodynamic and physiological constraints on the vasculature. The
observation that ephrin B2 was preferentially expressed in arteries, and Eph B4 was expressed in
veins suggested that differences between arteries and veins were genetically determined, and not
solely a matter of physiology. Furthemore, the study of targeted transgenic mice mutant for
ephrin 8 2 showed that the ephrin was requùed for the remodeling (but not the differentiation) of
the yok sac vasculature and head vessels, in addition to myocardial trabeculation. In discussing
their findings, Wang et al. postulate some mechanisms for the formation of capillaries through
cis or trans ephrin-Eph interactions, and speculate on an interaction between the ephrin and
augiopoietin pathways, but little was hown as to how the ephrins might pattern the vasculature
84.
Several observations published over the next year served to confuse the understanding of
ephrin-Eph interactions in vascular patterning. While Wang et al. were unable to see expression
of any other Eph receptors or ephrin ligands in the vasculature, other groups were able to detect
such expression 83985; differences in findings were attributed to differences in sensitivity
between in situ protocols. Adams et al. reported Ephrin BI, B2, and Eph B3 expression in
39
artenes, with ephrin BI, 83, and Eph 84 were expressed in veins 83. Transgenic rnice lacking
E @ L B ~ ~ d E p h B3 were f d to have variable cudi~vascdar defects (30% penetrance).
McBride et al. extended these fiadings to show that ephrin Al was present in several developing
vessels including the dorsal aorta, allantoic vessels, and veins in the head 85. Interestingly,
studies of the Xenopus vasculature demonstrated that while Eph B4 was expressed in the veins,
and ephrin BI and B2 in the arteries, no other Eph or ephnns could be found. Such a
discrepancy might be attributed to differences in species 86. Questions of Eph redundancy were
alleviated somewhat by the publication of the Eph 84 knockout mouse 87. Like the ephnn 82
knockout, embryos lacking Eph B4 die by day 10.5 with cardiovascular defects. While neither
the Eph B2-1-, or Eph B3 -1- embryos show vascular defects separately 83, Eph B4 -1- embryos
are unable to comectly remodel the vasculahue, resulting in dilated vessels, fused branches, and
incorrect remodeling of the antenor cardinal vein 87. Like the ephrin B2 mutants, Eph B4 have
defects in remodeling both arteries and veins, which were speculated to be a result of the loss of
bidirectional signaling, rather than simply a secondary defect due to abnormal blood flow.
m i l e the results of Adams and others have shown that several ephrins/Eph may be expressed
on, or in the vicinity of the vasculature, the observation of differential ephrin B2EphB4
expression on arteries and veins has been successfÙlly reproduced. Certainly the "symmetrical"
phenotypes of the ephrin B2 knockout, and the recently published Eph B4 knockout continue to
suggest an essential role for ephrin B2 and Eph B4 signaling in the development of the
vasculature. That said, much more work needs to be done to understand 1) how the ephrins are
differentially replated between veins and arteries, 2) what interactions occur in vivo to ensure
that "like" vessels fuse only with "like" when the uasculaîure is remodele4 and 3) how
differences in ephrin expression can result in the characteristic vesse1 wall structure and elasticity
observed for arteries and veins. In this way, the ephrins provide an interesting example of a new
pathway that is required for the patterning of the mammalian vasculature.
4. The hypoxic response in mammalian vascular development
Oxygen is essential for the survival of multicellular organisms; to this end, organisms have
evolved systems to monitor and maintain O2 homeostasis h m the systemic down to the cellular
level. In mammals, detection of hypoxia by O2 senshg centers in the carotid bodies leads to the
40
stimulation of heart and respiratory rate 30, the dilation or constriction of specific subsets of
vessels, ami the stimulation of erythrocyte production. In situations of acute or regional hypoxia, A
oxygen starved tissue stimulates the ingrowth of vessels 50. Hypoxic cells also upregulate a
number of genes to allow ATP generation through anaerobic respiration; hypoxia has also been
found to stimulate apoptosis 88. Given the vast array of responses produced by low oxygea, it is
important to understand what happens in a ce11 to mediate these responses. More critical to this
work, is the question of how hypoxia might be involved in the differentiation or patteming of the
vasculature. 1s there any evidence connecting hypoxia-response and the development of blood
vessels?
The fmt of the Hypoxia Inducible Factors (HIF-I), and hypoxia responsive elements (HREs)
were âiscovered by Gregg Semenui's group, over the course of their studies of erythropoietin
(EPO) regulation in the early 1990s 89. It was known that the levels of EPO mRNA and protein
were increased in many ce11 types under hypoxic conditions; electromobility shift assays
demonstrated the formation of new complexes on EPO DNA when incubated with hypoxic
nuclear extract 89-92. Deletion analysis identified a 256 bp elernent that was sufficient to confer
hypoxia responsiveness to a heterologous transgene 89. Further work narrowed down the
minimal hypoxia responsive element (HRE) to 50, and finally 18 bp 91993-95. Interestingly,
electromobility shift assays (EMSA) performed with Hep3B ce11 extracts demonstrated the
formation of hypoxia-inducible protein complexes on radiolabeled oligonucleotides containing a
wild type, but not a mutant element; scanning mutagenesis demonstrated that an 8 bp site was
required for hypoxia inducible protein binding 91. Later analyses demonstrated that hypoxia
responsive elements containing MF-1 bmding sites were present in the promoter, first intron, or
3' untranslated regions (UTR) of several genes, including PGK, LDHA, and ENO-1 52996.
Currently, more than 28 genes have been s h o w to contain an HRE, or to be down-regulated in
cells lacking HIF-1 huiction 3O. Most relevant to this thesis are the observations that VEGF,
VEGFR-1, Ang-2, and Tie-2 mRNA are upregulated in cells exposed to hypoxic conditions
51954,97-9? Furthemore, VEGFR-2 protein, but not mRNA may be increased in hypoxic cells
543559100. The fïnding that these major vascular genes are upregulated by hypoxia is suggestive
that hypoxia has a role in the formation of tbe vasculahire.
41 Our cumnt understanding of the hypoxia response element holds that the HIF-1 complex
binds to a conserved CGTGC motif, contactingthe four &ne residues 30; this HIF binding
site is necessary, although work described in this thesis shows that it is not always sufficient to
confer hypoxia responsiveness to a promoter. Certainly several groups have demonstrated
hypoxic induction of reporter constructs containing a wild-type, but not a mutant hypoxia
response element 529549101. Other studies suggest diat additional elements, or protein-protein
interactions may be required for some elements 52,102. While many groups have s h o w HRE-
mediated reporter activation by hypoxia, work descnbed in this thesis raises some serious
questions as to the specificity and sufnciency of HRE activity derived from different genes.
The HIF family of transcription factors were first identified by Gregg Semenza's group; HIF-
1 was found to be a heterodimer comprised of an a and a B subunit, both containing a basic
helix-loop-helix domain (bHLH) and a PAS domain (named for per-amt-sim, the first three
proteias to have this sequence motif). lo3. The p-subunit of this complex was found to be
ARNT, the ubiquitously expressed p-subunit to the Aryl Hydrocarbon Receptor (AHR) 104.
HIF-la was found to be a novel gene, containing oxygen sensitive degradation and activation
domains 309 1059 106. Under n o m x i c conditions, the HIF 1 a protein is rapidly ubiquitinated and
targeted for proteosomal degradation, through a von Hippel-Lindau (VHL) dependent pathway
107,108. On detection of hypoxia, HIF-la protein is stabilized, and undergoes an oxygen-
sensitive conformational change in the transactivation domain. Active HIF- la cari then bind
ARNT, and translocate to the nucleus where it binds to the HRE, and upregulates the
transcription of target genes. Some evidence suggests that HIF-1 may upregulate its own
transcription, but it appears that much of its specificity cornes from post-translational
modifications l. It is not known how HIF senses the level of oxygen in cells, althougb
there have been some suggestions that H E - l a might sense oxygen directly, either through
interactions with reactive oxygen species, or through conformation changes induced by low
oxygen 112. Other models propose cytochromes, or even entire mitochondria to be the cellular
oxygen sensors 113. Such models are pure speculation, however, with little, or conflicting
evidence to support them. It is not known how HF- la seases bypoxic conditions 1 12.
42 Since the identification of HIF-1, homology searches and binding studies have aided in the
discovery of other hypoxia-inducible- f ~ t o r s . Where HIF- l a and ARNT are expressed at low -? --
levels throughout embryo and adult, HIF-2a is highly expressed the vasculature, with low levels
of expression in the decidua 1 1491 15. HIF-3a has also been recently identified, and is expressed
in the adult thymus, kidney, h g , brain, and heart; it is not known where HIF-3a is expressed
during embryogenesis 1 16. Recently two additional ARNT homologues have been identified.
ARNT-2 is preferentially expressed in mesectoderm denved tissues, such as the CNS, while
ARNT-1 is seen to be at higher levels in mesendodenn derived tissues such as the gut, lungs, and
heart 1 1 5 9 1 17. Finally, Northem analyses of ARNT-3 show expression in the brain and skeletal
muscle 1 18. in his 1999 review, Gregg Semenza claims that any of the three a subunits could
heterodimerize with any of the three f3-subunits to form a fuactional transcription factor. While
over expression studies have s h o w that ARNT-3 can form a functional complex with HIF-1 a or
HIF-2a in vitro, it is not known if al1 of the possible combinations will fonn fùnctional dimers
1 18. Furthemore, it has yet to be shown if this apparent redundancy is relevant in vivo.
Interestingly, hypoxia-dependent protein binding has recently been shown to be present in
Drosophilu 1 199120. Shi la r (Sima), a bHLH-PAS protein with 63% homology to human HE-1
bas been proposed to mediate this activity 121. Activity studies of hypoxia-inducible simo
fusion proteins support this claim, as fusion proteins made with sima, but not with the related
trucheuless ( t h ) , or single-minded (sim) bHLH-PAS were responsive to hypoxia 121 3 1 22. In
confiict, Bacon et al. noted that antibodies raised against sima were unable to prevent hypoxia-
dependent complex formation 122. Studies of the Trh bHLH-PAS locus have also demonstrated
some interesting results 123,124. Although the Trh protein does not appear to have hypoxia-
inducible activity, it was able to bind to and activate a reporter containing the EPO hypoxia
response element 125. Ectopic expression of Trh or human HIFla was sufficient to induce the
formation of ectopic tracheal pits in flies. Clearly, M e r studies in Drosophilu may be useful
toward understanding the role of bHLH-PAS transcription factors in regulating the hypoxia
response.
Several pieces of evidence suggest a connection between the HIF pathways, as mediators of
hypoxic response, and the development of the vasculature. Targeted mutations in HIF-1 resulted
43 in mid-gestational embryonic lethality (1 0.5) characterized by prominent neural defects,
myocardial - - -a hyperplasia, and defects in both the embryonic and extraernbryonic vasculature
88,126,127, Sections of HIF-1" embryos showed massively enlarged neural vessels, with
dilated and disorganized capillaries. Embryos deficient in ARNT also exhibited lethality
coupled with defects in vascular remodeling 128. Like the HE-la '" embryos, ARNT "- were
able to differentiate endothelial cells, and produce a primary plexus, but are unable to form a
proper branched network 128. hterestingly, the severe defects observed in HIF-la, and ARNT
mice show that the other HF subunits are not able to completely compensate for loss of HIF-1
activity. Whether this is due to the observed differences in expression, or to differences in
function remains to be seen. hterestingly studies of teratocarcinomas formed by HIF- 1 a '", and
ARNT 4- ES cells show that tumours impaired in hypoxia response often have decreased
vascularization. 88, 127.
An intriguing connection between HIF activity and vesse1 development cornes from the study
of HE-2a. Independently discovered by four different groups, HIF2a is specifically expnssed
in the embryonic and adult endothelium 989 1 14, 12% 130. The original knock out analysis,
performed in C57B16/129Sv mice, demonstrated that embryos died up to, or shortly afier birth of
heart failure. Detailed examination of homozygous embryos showed no obvious defects in
vascular architecture; instead, the authors described statistically significant changes in heart rate
and blood flow due to defects in the organ of Zuckerkandl, and a corresponding reduction in
catecholamine synthesis 131. Furthemore, Tian et al. claimed that the addition of a
catecholamine precursor (DOPS) to the water of pregnant females was able to increase the
number of HE-2a -1- cmbryos that surviveà to tem. An independently targeted mutation
generated by G.-H. Fong's group resulted in a very different phenotype: ICW129Sv HIF-2a-/-
mice die by day 13.5 with vascular defects and hemmorhaging 132. Specifically, some areas of
the yok sac had areas in which sheets of endothelial cells failed to f o m tubes. A shidy of 129Sv
HE-2a homozygous embryos (derived fkom tetraploid aggregations of HE-2a -/- ES cells)
showed a more severe phenotype. In this background, mutant embryos died by day 12.5 with a
severely disorganized yok sac vasculature, and abnomal remodeling of the embryonic vessels.
Since both groups demonstrated successful inactivation of the HIF-2a gene, and absence of HIF-
2a protein in homozygous, but not heterozygous, or wild-type cells, Peng et al. speculated that
44 the conflicting results could be the result of strain-specific differences in genetic background.
While the vascular anomalies reported by Peng - a - et - al. seem to correlate with the phenotype of the
HIF-la knockout, the absence of vascular abnormalities reported by Tian et al. are a surprising
finding. Clearly M e r work will have to be done to understand the potential roles of HIF-2a in
the control of heart rate and vascular development.
III. Introduction to the experimental approach
While it has long been known that a fiinctioning cardiovascular system is essential for
survival of embryo and adult alike, several exciting findings have implicated vascular
abnonnalities with disease. It is becoming increasingly evident that changes to the expression or
fûnction of a vascular gene can result in chronic defects, (e.g. venous malformations observed in
patients with a mutation in the Tie-2 receptor) or serious pathologies developing later in life (e.g.
m o u r angiogenesis). Furthemore, it is clear that the correct genetic control of vascular genes
is essential to survival: the loss of a single copy of the VEGF gene is lethal in mice. Thus,
studies to dissect the genetic control of vascular genes may be useful towards understanding, and
ultimately treating the disease state. Given the evidence that several important vascular genes
are transcriptionally upregulated under hypoxic conditions, and the observation that embryos
impaired in hypoxic response have severe vascular defects, it is reasonable to hypothesize that
hypoxia has a role in the normal development, differentiation, or patteming of the embryonic
vasculahue. If this were the case, then one would predict that areas of hypoxia would occur
naturally over the course of embryonic development, and would roughly correlate with those
areas in which VEGF and other hypoxia-responsive genes were expressed. Later experiments
could then explore a functional role for hypoxia through the production of local areas of hypoxia,
or through the examination of vascular development under increased oxygen levels. For any of
these experiments to have relevance, the first step that must be taken is to examine if areas of
hypoxia occur naturally in a developing embryo.
Several experiwnts could be perfomed to study the areas of hypoxia in a developing
embryo. From a technical standpoint, the simplest approach would be to examine the in situ
hybridization patterns of VEGF, PGK, Ang-2, and other hypoxia-regulated genes. Theoretically,
areas of expression common to many such genes, as determined by hybridiziag serial sections,
could be due to hypoxia. There are certain disadvantages to this method; firstly, many genes
45 would have to be cornpared as it is not possible to differentiate areas in which a gene was
activated - - -- -- by hypoxia h m areas in which gene A- expression was regulated by other developmental
or environmental factors. Seconàly, if conditions of hypoxia occur transiently during embryonic
development, it may be difficult to identify consistent areas between embryos. Even if
consensus regions could be identified, such areas would have to be confinned through an
independent measurement of hypoxia.
A second approach that could provide useful information as to the areas of hypoxia in an
embryo is through the use of chemical marken. As discussed in Chapter 3, the nitroimidazole
compounds EF5 and pimonidazole are fiequently used in studies of tumour development, as they
form adducts on macromolecules in hypoxic but not normoxic conditions; immunohistochemical
analysis of adduct formation shows the areas of chemical hypoxia in the tissue 127,133-135.
hterestingly, chemical marken of hypoxia have been used by pathologists to assist in patient
diagnosis; discovery of hypoxic areas in tumours is often associated with a poor prognosis
134,136. Several advantages accompany the use of nitroimidazole compounds to study
embryonic hypoxia: firstly, the formation and detection of adducts is a well-established method
to examine areas of hypoxia in tissue. Secondly, adduct formation occurs without relying on a
particular biological pathway, allowing a truly general marker of hypoxia. Perhaps the strongest
argument for the use of nitroimidazole based compounds has arisen very recently, as Chen and
others have begun to use this technique to mark areas of hypoxia in the developing rat embryo
137. Of the methods which currently c m be used to examine areas of hypoxia in the developing
embryo, the use of chemical markers appears to be one of the most promising; the use of this
method will be discussed M e r in Chapter 3. At the time that this project was undertaken,
nitroimidazole based compounds had not been used in embryos, and the antibody for their
detection was not commercially available.
A third approach that could be taken to study the areas of hypoxia in a developing embryo to
use a hypoxia-sensitive reporter construct to produce transgenic mice. If a transgene could be
constructed that gave strong induction in al1 ceIl types under hypoxia, with littfe expression
under normoxic conditions, then embryos could be dissected and stained for hypoxic areas.
Mice carrying such a marker could be bred to some of the targeted vascular mutants, or available
tumow models to examine differences in vascular growth and remodeling relative to tissue
46 oxygenation. For such an approach to be usefil, it must be possible to find a general element
that can provide a quantifiable response - specificjily and exclusively to hypoxic conditions in al1
ce11 types. Later problems would requin the generation of hypoxia-responsive ES ceIl lines and
ultimately mice that are insensitive to transgene position effects. Embryos expressing a hypoxia-
responsive marker would also have to be compared between different lines, and with chernical
markers to c o d m bypoxia-specific expression.
To identify the areas of low oxygen that occur during embryonic vascular development, a
transgene was designed juxtaposing a hypoxia responsive element, containing an intact HIF-1
binding site, with a basal promoter and reporter. A basic Hsp Lac2 transgene was readily
available, and had been used by members of out lab and others to produce enhancer-ciriven
galactosidase expression 138-140. Other arguments recommending the Hsp Lac2 transgene
included the fact that the modified Hsp68 prornoter was off in most tissues of the embryo but
could be induced to high levels of expression 138. Additionally, studies using Hsp Lac2
transgenes c o d m e d consistent, faithful replication of the endogenous expression pattern 14*.
An Hsp LacZ ûansgene was used instead of a naturally occurring hypoxia responsive promoter
to minimize expression due to the presence and activity of other, non-hypoxia dependent
regulatory elements.
The mouse VEGF HRE was chosen to drive the Lac2 transgene for several reasoas. Firstly,
while much of the early work on HRE activity bad been performed using the EPO HRE, a
minimal VEGF element had recently been shown to be sufficient to confer hypoxic induction
ont0 a transgene, by the same criteria. Since the VEGF gene had been weli snidied in our lab, it
seemed like a reasonable starting point to make a hypoxia-responsive transgene. At that time,
the assumption was made that the EPO and VEGF HRE would be fÙnctionally equivalent; work
described in this thesis demonstrates that this is not the case. Secondly, at the time that this
project was undertaken, experiments performed on the minimal human VEGF HRE
demonstrated it to be sufficient to confer hypoxic induction onto a transgene, by the criteria
established for the EPO HRE 51352. 78% homology was detected between the 47 bp human and
mouse HREs, including 100% homology at the HIF-1 binding site and conserved 3' element
34952. For comparison, the same region of the rat VEGF gene had 82% homology to the human,
and 89% homology to the mouse VEGF HRE 52,141. Furthexmore, both human and rat VEGF
-*
47 HRE had been shown to confer hypoxia responsiveness to a transgene; while the sequence of the
--- 2 - - mouse VEGF promoter was available, no experiments had been performed with the mouse
A - - -
element 349529141. At the time the fust transgene was constmcted, the assumption was made
that the mouse VEGF HRE would be sufficient to impart hypoxia responsiveness to a transgene;
work described in this thesis suggests that this assumption may have been incorrect.
To examine the areas of hypoxia present during embryonic development, a transgene was
constructed, placing an HRE from the mouse VEGF gene in the context of an Hsp Lac2
transgene. After demonstrating that this transgene was not induced in cells exposed to hypoxia,
a cornparison was made between different elements and constructs to ask several questions: 1) 1s
an HRE sufficient to mediate a hypoxic response? 2) Are there differences in the activities
conferred by different hypoxia-response elements? 3) Can a construct be created to show
reproducible, consistent induction of reporter activity in R1 ES cells exposed to hypoxia?
48
IV. References
1; Sabùi, F. K. Shidies on tEie 05iiïio~ooif-vessek andof red blwd-corpuscles as seen in
the living blastoderm of chicks during the second day of incubation. Contr. Embry., Carnegie
Iwt. W d . 9,215-258 (1920).
2. Gonzalez-Crussi, F. Vasculogenesis in the chick embryo. An ultrastructural study. Am J
Anat 130,441460 (1 97 1).
3. Le Douarin, N. A biological ceIl labeling technique and its use in expermental
embryology. Dev Bi01 30,2 17-222 (1973).
4. Pardanaud, L., Yassine, F. & Dieterlen-Lievre, F. Relationship between vasculogenesis,
angiogenesis and haemopoiesis during avian ontogeny. Development 105,473-485 (1989).
5. Hirakow, R. & Hinuna, T. TEM-studies on development and canalization of the dorsal
aorta in the chick embryo. Anat Emb*yol166,307-3 15 (1 983).
6. Patan, S. TIEl and TIE2 receptor tyrosine kinases inversely regulate embryonic
angiogenesis by the mechanism of intussusceptive rnicrovascular growth. Microvasc Res 56, 1-
21 (1998).
7. Metzger, R. J. & Krasnow, M. A. Genetic control of branching morphogenesis. Science
284, 1635-1639 (1999).
8. Krasnow, M. A. Genes that control organ form: lessons from bone and branching
morphogenesis. Cold Spring Harb Symp Quant Bi01 62,235-240 (1997).
9. Pardanaud, L., Altmann, C., Kitos, P., Dieterlen-Lievre, F. & Buck, C. A. Vasculogenesis
in the early quai1 blastodisc as studied with a monuclonal antibody recognizing endothelial cells.
Dewlopment 100,339-349 (1 987).
10. Wagner, R. C. Endothelial cells embryology and growth. Adv. Microcirc. 9, 45-75
(1 980).
1 1. Dupin, E., Ziller, C. & Le Douarin, N. M. The avian embryo as a rnodel in developmental
studies: chimeras and in vitro clona1 analysis. Curr Top Da, Biol36, 1-35 (1 998).
12. Stern, C. D., Fraser, S. E., Keynes, R. J. & Primmett, D. R. A ce11 lineage analysis of
segmentation in the chick embryo. Dewlopment lM, 23 l-24î4 (1988).
13. Foikman, J. Toward an understanding of angiogenesis: search and discovery. Perspect
Biol Med 29, 10-36 (1 985).
14. Pardanaud, L. & Dieterlen-Lievre, F. Emergence of endothelial and hemopoietic cells in
the avian embryo. Anat Embryol (Berl) 187,107-1 14 (1993).
49 15. Pardanaud, L. & Dieterlen-Lievre, F. Does the paraxial mesoderm of the avian embryo
bave hemangioblastic capacity? Ana? Embryol @erI) 192,30 1-308 (1 995).
16. Pardanaud, L. et al. Two distinct endothelial Iineages in ontogeny, one of them related to
hemopoiesis. Development 122, 1363- 137 1 (1 996).
17. Pardanaud, L. & Dieterlen-Lievre, F. Manipulation of the angiopoietic/hemangiopoietic
cornmitment in the avian embryo. Development 126,6 1 7-627 ( 1 999).
18. Risau, W. & Flamme, 1. Vasculogenesis. Annu Rev Ce11 Dev Biol 11, 73-91 (1995).
19. Shilo, B. 2. et al. Branching morphogenesis in the Drosophila tracheal system. Cold
Spring Harb Symp Quant Biol62,241-247 (1997).
20. Affolter, M. & Shilo, B. Genetic control of branching morphogenesis during drosophila
tracheal development. Curr Opin Cell Bi01 l2,73 1-735 (2000).
21. Jarecki, J., Johnson, E. & Krasnow, M. A. Oxygen regulation of airway branching in
Drosophila is mediated by branchless FGF. Cell99,2 1 1-220 (1999).
22. Wappner, P., Gabay, L. & Shilo, B. 2. Interactions between the EGF receptor and DPP
pathways establish distinct ceIl fates in the tracheal placodes. Development 124, 4707-47 16
(1 997).
23. Steneberg, P., Hemphala, J. & Samakovlis, C. Dpp and Notch specify the fusion ce11 fate
in the dorsal branches of the Drosophila trachea. Mech Dev 87, 153- 163 (1 999).
24. Sutherland, D., Samakovlis, C. & Krasnow, M. A. branchless encodes a Drosophila FGF
homolog that controls tracheal ce11 migration and the pattern of branching. Cell87, 109 1- 1 10 1
(1 996).
25. Vincent, S. et al. DPP controls tracheal ce11 migration along the dorsoventral body axis of
the Drosophila embryo. Development 124,2741-2750 (1997).
26. Glazer, L. & Shilo, B. 2. The Drosophila FGF-R homolog is expressed in the embryonic
tracheal system and appears to be required for directed tracheal ce11 extension. Genes Dev 5,
697-705. (1991).
27. Reichman-Fried, M. & Shilo, B. 2. Breathless, a Drosophila FGF receptor homolog, is
required for the onset of tracheal ce11 migration and tracheole formation. Mech Dev 52,265-273
(1 995).
28. Lee, T., Hacohen, N., Krasnow, M. & Montell, D. J. Regulated Breathless receptor
tyrosine kinase activity requued to pattern ce11 migration and branching in the Drosophila
tracheal systern. Genes Dev 10,2912-2921 (1996).
50 29. Wolf, C. & Schuh, R. Single mesodemial cells p ide outgrowth of ectodennal tubular
smctures in Drosophila. Genes Dev 14,2 140-2 145 (2000).
30. Semenza, G. L. Regulation of mammalian 0 2 homeostasis by hypoxia-inducible factor 1.
Annu Rev Cell Dev Biol15,55 1-578 (1999).
31. Petrova, T. V., Makinen, T. & Alitalo, K. Signaling via vascular endothelial growth
factor recepton. Exp Ce11 Res 253, 1 17- 130 (1 999).
32. Neufeld, G., Cohen, T., Gengrinovitch, S. & Poltorak, Z. Vascular endothelial growth
factor (VEGF) and its receptors. Faseb J 13,9-22 (1 999).
33. Meyer, M. et al. A novel vascular endothelial growth factor encoded by Orf virus,
VEGF- E, rnediates angiogenesis via signalling through VEGFR-2 (KDR) but not VEGFR-1
(Flt-1) receptor tyrosine kinases. Embo J 18,363-374 (1999).
34. Shima, D. T. et al. The mouse gene for vascular endothelial growth factor. Genomic
structure, definition of the transcriptional unit, and characterization of transcriptional and post-
transcriptional regulatory sequences. J Biol Chem 271,3877-3883 (1 996).
35. Miquerol, L., Gertsenstein, M., Harpal, K., Rossant, J. ê: Nagy, A. Multiple
developmental roles of VEGF suggested by a LacZ-tagged allele. Dev Biol212,307-322 (1999).
36. Kendall, R. L., Wang, O. & Thomas, K. A. Identification of a nahiral soluble form of the
vascular endothelial growth factor receptor, FLT-1, and its heterodimerization with KDR.
Biochem Biophys Res Commun 226,3249328. (1 996).
37. Leung, D. W., Cachianes, G., Kuang, W. J., Goeddel, D. V. & Ferrara, N. Vascular
endothelial growth factor is a secreted angiogenic mitogen. Science 246, 1306- 1309 ( 1989).
38. Keck, P. J. et al. Vascular permeability factor, an endothelial cell mitogen related to
PDGF. Science 246, 1309- 13 12 (1 989).
39. Carmeliet, P. Mechanisms of angiogencsis and artcriogenesis. Nat Med 6, 389-395
(2000).
40. Carmeliet, P. et al. Abnomal blood vesse1 development and lethality in embryos lacking
a single VEGF allele. Nature 380,435439 (1996).
41. Ferrara, N. et al. Heterozygous embryonic lethality induced by targeted inactivation of
the VEGF gene. Nature 380,439442 (1996).
42. Shalaby, F. et al. Failure of blood-island formation and vasculogenesis in Fk- 1 -deficient
mice. Nature 376,62-66 (1995).
43. Fong, G. H., Rossant, J., Gertsenstein, M. & Breitman, M. L. Role of the Flt-1 receptor
tyrosine kinase in regulating the assembly of vascular endothelium. Naîure 376,66-70 (1 995).
44. Fong, G. H., Zhang, L., Bryce, D. M. & Peng, J. Increased hemangioblast commitment,
not - vascular disorganization, is the primary defect in flt-l knock-out mice. Developnrent 126,
30 15-3025 (1 999).
45. Hiratsuka,S.,Minowa,O.,Kuno,J.,Noda,T.&Shibuya,M.Flt-l lackingthetyrosine
kinase domain is suf'fïcient for normal development and angiogenesis in mice. Proc Natl Acad
Sci U S A 95,9349-9354 (1 998).
46. Fong, O. H., Klingensmith, J., Wood, C. R., Rossant, J. 8t Breimian, M. L. Regulation of
flt-1 expression during mouse embryogenesis suggests a role in the establishment of vascular
endotheliurn. Dev Dyn 207,l- 1 0 ( 1 996).
47. Plate, K. H., Breier, G., Weich, H. A. & Risau, W. Vascular endothelial growth factor is a
potential tumour angiogenesis factor in human gliomas in vivo. Nature 359,845-848 (1992).
48. Tufro, A. VEGF spatially directs angiogenesis during metanephric development in vitro.
Dev Bi01 227,558-566 (2000).
49. Cleaver, O. & Krieg, P. A. VEGF mediates angioblast migration during development of
the dorsal aorta in Xenopus. Developrnent 125,3905-39 14 ( 1998).
50. Shweiki, D., Itin, A., Soffer, D. & Keshet, E. Vascular endothelial growth factor induced
by hypoxia may mediate hypoxia-initiated angiogenesis. Nature 359,843-845 (1 992).
51. Liu, Y., Cox, S. R., Morita, T. & Kourembanas, S. Hypoxia regulates vascular
endothelial growth factor gene expression in endothelial cells. Identification of a 5' enhancer.
Circ Res 77,638643 (1995).
52. Forsythe, J. A. et al. Activation of vascular endothelial growth factor gene transcription
by hypoxia-inducible factor I . Mol Cell Bi01 16,4604-46 1 3 (1 996).
53. Levy, N. S., Chung, S., Fumeaux, H. & Levy, A. P. Hypoxic stabilization of vascular
cadotheliat growth factor d W A by the RNA-binding protein HttR. J Bi01 Chem 273,64 1 ?-6423
(1998).
54. Gerber, H. P., Condorelli, F., Park, J. & Ferrani, N. Differential transcriptional regulation
of the two vascular endothelial growth factor receptor genes. Flt- 1, but not Fk-IIKDR, is up-
regulated by hypoxia. J Biol C h 272,23659-23667 (1997).
55. Waltenberger, Jas Mayr, U., Pentz, S. & Hombach, V. Functional upregulation of the
vascular endothelial growth factor receptor KDR by hypoxia. Circulation 94, 1647-1654 (1996).
56. Dumont, D. J., Yamaguchi, T. P., Conlon, R. A., Rossant, J. & Breitman, M. L. tek, a
novel tyrosine kinase gene located on mouse chmmosome 4, is expressed in endothelial cells and
theu presumptive precursors. Oncogene 7,147 1 - 1480. (1 992).
52 57. Sato, T. Ney Qin, Y., Kozak, C. A. & Audus, K. L. Tie-1 and tie-2 define another class of
putative receptor tymsiqe kinase genes expressed in eqly embryonic vascular system [published - LA- - -- - -
erratum appears in Proc Natl Acad Sci U S A 1993 Dec l5;90(24): 120561. Proc Natl Acad Sci U
S A 90,9355-9358 (1993).
58. Dumont, D. J. et al. Dominant-negative and targeted nul1 mutations in the endothelial
receptor tyrosine kinase, tek, reveal a critical role in vasculogenesis of the embryo. Genes Dev 8,
1 897- 1909 ( 1994).
59. Partanen, J. & Dumont, D. J. Functions of Tiel and Tie2 receptor tyrosine kinases in
vascular development. Curr Top Microbiol Immun01 237, 159-172 (1999).
60. Jones, N. et al. Identification of TeWTie2 binding partners. Binding to a multifunctional
docking site mediates ce11 sumival and migration. JBiol Chem 274,30896-30905 ( 1 999).
61. Papapetropoulos, A. et al. Angiopoietin-1 inhibits endothelial ce11 apoptosis via the
Akt/survivin pathway. J Biol Chem 275,9 102-9 105 (2000).
62. Davis, S. et al. Isolation of angiopoietin-1, a ligand for the l'IE2 receptor, by secretion-
trap expression cloning. Ce11 87, 1 16 1 - 1 169 (1 996).
63. Suri, C. et al. Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during
embryonic angiogenesis. Ce11 87, 1 17 1 - 1 1 80 (1 996).
64. Maisonpierre, P. C. et al. Angiopoietin-2, a natural antagonist for Tie2 that disrupts in
vivo mgiogenesis. Science 277.55-60 (1997).
65. Valeimiela, D. M. et al. Angiopoietins 3 and 4: diverging gene counterparts in mice and
humaas. Proc Natl Acad Sci LI S A 96,1904- 1 909 (1 999).
66. Witzenbichler, B., Maisonpierre, P. C., Jones, P., Yancopoulos, O. D. & Isner, J. M.
Chemotactic properties of angiopoietin- 1 and -2, ligands for the endothelial-specific receptor
tyrosine kinase Tie2. JBfal Chem 273, I 8W- t852 1 (1998).
67. Hayes, A. i. et al. Angiopoietin-1 and its receptor Tie-2 participate in the regulation of
capillary-like tubule formation and survival of endothelial cells. Microvasc Res 58, 224-237
(1999).
68. Procopio, W. N., Pelavin, P. I., Lee, W. M. & Yeilding, N. M. Angiopoietin-1 and -2
coiled coi1 domains mediate distinct homo- oligomerization patterns, but fibrinogen-like domains
mediate ligand activity. J Biol C'hem 274.30 196-3020 1 (1 999).
69. Sato, T. N. et al. Distinct d e s of the receptor tyrosine kinases Tie-1 and Tie-2 in blood
vesse1 formation. Ndwe 376,70074 (1995).
53 70. Folkman, J. & D'Amon, P. A. Blood vessel formation: wbat is its molecular basis? Ce11
87,1153-1 155 u996).
71. Puri, M. C., Rossant, J., Alitalo, K., Bernstein, A. & Partanen, J. The receptor tyrosine
kinase TE is required for integrity and sumival of vascular endothelial cells. Embo J 14, 5884-
589 1 (1 995).
72. Partanen, J. et al. Ce11 autonomous fuactions of the receptor tyrosine kinase T E in a late
phase of angiogenic capillary growth and endothelial ce11 survival during murine development.
Development 122.30 13-302 1 (1 996).
73. Suri, C. et al. Increased vascularization in mice overexpressing angiopoietin-1. Science
282,468-47 1 (1998).
74. Thurston, G. et al. Leakage-resistant blood vessels in mice transgenically overexpressing
angiopoietin-1 . Science 286,251 1-25 14 (1999).
75. Yancopoulos, G. D. et al. Vascular-specific growth factors and blood vessel formation.
Nature 407,242-248 (2000).
76. Folkman, J. Tumor angiogenesis. A h Cancer Res 43, 175-203 (1985).
77. Fukumwa, D. et al. Tumor induction of VEGF promoter activity in stroma1 cells. Cell94,
7 15-725 (1998).
78. Holash, J., Wiegand, S. J. & Yancopoulos, G. D. New mode1 of tumor angiogenesis:
dynamic balance between vessel regression and growth mediated by angiopoietins and VEGF.
ûncogene 18,53564362 (1999).
79. Holash, J. et al. Vesse1 cooption, regression, and growth in tumors mediated by
angiopoietins and VEGF. Science 284,1994- 1998 (1999).
80. Boehm-Viswanathan, T. 1s angiogenesis inhibition the Holy Grail of cancer therapy?
Curr @in Oncol 12,89-94 (2000).
81. Yancopoulos, G. D., Klagsbrua, M. & Folkman, J. Vasculogenesis, angiogenesis, and
growth factors: ephrins enter the fray at the border. Cell93,66 1-664 (1 998).
82. Gale, N. W. & Yancopoulos, G. D. Growth factors acting via endothelial cell-specific
receptor tyrosine kinases: VEGFs, angiopoietins, and ephrins in vascular development. Genes
Dev 13, 1055-1066 (1999).
83. Adams, R H. et al. Roles of ephrlnB ligands and EphB receptors in cardiovascular
development: demarcation of arteriaVvenous domains, vascular morphogenesis, and sprouting
angiogenesis. Genes Dev 13,295-306 (1999).
54 84. Wang, H. U., Chen, 2. F. & Anderson, D. J. Molecular distinction and angiogenic
interaction between embryonic arteries a ~ d veins revealed by ephrin-B2 and its receptor Eph-B4.
Ce11 93,741-753 (1998).
85. McBnde, J. L. & Ruiz, 3. C. Ephrin-Al is expressed at sites of vascular development in
the mouse. Mech Dev 77,20 1-204 (1998).
86. Helbling, P. M., Saulnier, D. M. & Brandli, A. W. The receptor tyrosine kinase EphB4
and ephrin-B ligands restrict angiogenic growth of embryonic veins in Xenopus laevis.
Development 127,2690278 (2000).
87. Gerety, S. S., Wang, H. U., Chen, 2. F. & Anderson, D. J. Symmetrical mutant
phenotypes of the receptor EphB4 and its specific transmembrane ligand ephrin-B2 in
cardiovascular development. Mol Cell4,403-4 14 ( 1 999).
88. Canneliet, P. et al. Role of HE-lalpha in hypoxia-mediated apoptosis, ce11 proliferation
and tumour angiogenesis [published erratum appears in Nature 1998 Oct 1 ;395(67O l):52S].
Nature 394,485-490 (1998).
89. Semenza, G. L., Nejfelt, M. K., Chi, S. M. & Antonarakis, S. E. Hypoxia-inducible
nuclear factors bind to an enhancer element located 3' to the human erythropoietin gene. Proc
Nat1 Acad Sci U S A 88,5680-5684. (1 99 1).
90. Semenza, O. L., Koury, S. T., Nejfelt, M. K., Gearhart, J. D. & Antonarakis, S. E. Cell-
type-specific and hypoxia-inducible expression of the human erythropoietin gene in transgenic
mice. Proc Nat1 Acad Sci US A 88,8725-8729. (199 1).
91. Semeami, G. L. & Wang, G. L. A nuclear factor induced by hypoxia via de novo protein
synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional
activation. Mol Ce11 Bi01 12, 547-5454 (1992).
92. Wang, G. L. & Semenza, G. L. Characterization of hypoxia-inducible factor 1 and
regulation of DNA binding activity by bypoxia. J Biol Chem 268,2 15 13-2 15 18 (1 993).
93. Beck, L, Weinmann, R. & Caro, J. Characterization of hypoxia-responsive enhancer in
the human erythropoietin gene shows presence of hypoxia-inducible 120-Kd nuclear DNA-
binding protein in erythropoietin-produchg and nonproduchg cells. Blood 82,704-7 1 1 (1993).
94. Kvietikova, L, Wenger, R. H., Marti, H. H. & Gassmann, M. The transcription factors
ATF- 1 and CREB- 1 bind constitutively to the hypoxia-inducible factor- 1 (HIF- 1) DNA
recognition site. Nucleic AcidP Res 23,4542450 (1995).
95. Kvietikova, 1.. Wenger, R. H., Marti, H. H. & Gassmann, M. The hypoxia-inducible
factor4 DNA recognition site is CAMP-responsive. Kidney Inf 51,564466 (1997).
96. Semenza, G. L. et al. Hypoxia response elements in the aldolase A, enolase 1, and lactate
dehydrogenase A gene promoters contain essential binding sites for hypoxia-inducible factor 1. J - .=- -
Biol Chem 271,32529932537 (1996).
97. Yuan, H. T., Yang, S. P. & Woolf, A. S. Hypoxia up-regulates angiopoietin-2, a tie-2
ligand, in mouse mesangial cells. Kidney lnt 58, 19 12- 19 19. (2000).
98. Tian, H., McKnight, S. L. & Russell, D. W. Endothelial PAS domain protein 1 (EPASI),
a transcription factor selectively expressed in endothelid cells. Genes Dev 11, 72-82 (1 997).
99. Mandriota, S. J. & Pepper, M. S. Regdation of angiopoietin-2 mRNA levels in bovine
microvascular endothelial cells by cytokines and hypoxia. Circ Res 83,852-859 (1 998).
100. Shen, B. Q. et al. Homologous up-regulation of KDFUFlk-1 receptor expression by
vascular endothelial growth factor in vitro. J Bi01 Chem 273,29979-29985 ( 1 998).
101. Shibata, Tgy Akiyama, Ney Noda, M., Sasai, K. & Hiraoka, M. Enhancement of gene
expression under hypoxic conditions using fkagments of the human vascular endothelial growth
factor and the erythropoietin genes. Int J Radiut Oncol Biol Phys 42,9 13-5 16 (1998).
102. Kimura, H. et al. Identification of Hypoxia-Inducible Factor- 1 (HIF- 1) Ancillary
Sequence and Its Function in Vascular Endothelial Growtb Factor Gene Induction by Hypoxia
and Nitric Oxide. J Bi01 Chem 276,229292298 (2001).
103. Wang, G. L. & Semenza, G. L. Purification and characterization of hypoxia-inducible
factor 1. JBiol Chem 270, 1230-1237. (1995).
104. Wang, G. L., Jiang, B. H., Rue, E. A. & Semenza, O. L. Hypoxia-inducible factor 1 is a
basic-helix-loop-helix-PAS heterodimer regulated by cellular 0 2 tension. Proc Nat1 Acad Sci U
S A 92, 55 10-55 14. (1 995).
105. Jiang, B. H., Rue, E., Wang, O. L., Roe, R. & Semenza, G. L. Dimerization, DNA
biilding, aad tratisectivatioa properties of hypoxia- inducible fector 1. J Biol Chem 271, 1777 1 - 17778. (1996).
106. Salceda, S. & Caro, J. Hypoxia-inducible factor lalpha (HIF-lalpha) protein is rapidly
degraded by the ubiquitin-proteasome system under normoxic conditions. Its stabilization by
hypoxia depends on redox-induced changes. JBiol Chem 272,22642-22647. (1997).
107. Maxwell, P. H. et al. The tumour suppressor protein VHL targets hypoxia-inducible
factors for oxygen-dependent proteolysis. Nature 399,271-275 (1 999).
108. Cocbnan, M. E. et al. Hypoxia inducible factor-alpha binding and ubiquitylation by the
von Hippel-Lindau twnor suppressor protein. J Bi01 Chem 275,25733-2574 1. (2000).
56 109. Wenger, R. H., Kvietikova, I., Rolfs, A., Gassmann, M. & Marti, H. H. Hypoxia-
inducible factor- 1 alpha is regulated at the post-mRNA - - - level. Kidney Int 51,560-563 (1 997).
110. Iyer, N. V., Leung, S. W. & Semenza, G. L. The human hypoxia-inducible factor lalpha
gene: HIF 1 A structure and evolutionary conservation. Genomics 52, 159- 165 (1 998).
11 1. OIRourke, J. F., Tian, Y. M., Ratcliffe, P. J. & Pugh, C. W. Oxygen-regulated and
transactivating domains in endothelial PAS protein 1 : cornparison with hypoxia-inducible factor-
lalpha. J Biol Chem 274,2060-207 1 (1999).
1 12. Wenger, R. H. Mammalian oxygen sensing, signalling and gene regulatiun. J Exp Biol
203 Pt 8,1253- 1263 (2000).
113. Lando, D., Pongratz, I., Poellinger, L. & Whitelaw, M. L. A redox mechanism controls
differential DNA binding activities of hypoxia-inducible factor (HIF) lalpha and the HIF-like
factor. J Bi01 Chem 275,461 8-4627. (2000).
114. Ema, M. et al. A novel bHLH-PAS factor with close sequence similarity to hypoxia-
inducible factor lalpha replates the VEGF expression and is potentially involved in lung and
vascular development. Proc Natl Acad Sci U S A 94,427304278 (1997).
115. Jain, S., Maltepe, E., Lu, M. M., Simon, C. & Bradfield, C. A. Expression of ARNT,
ARNT2, HIFl alpha, HIF2 alpha and Ah receptor mRNAs in the developing mouse. Mech Dev
73, 1 17-123 (1998).
116. Gu, Y. Z., Moran, S. M., Hogenesch, J. B., Wartman, L. & Bradfield, C. A. Molecular
characterization and chromosomal localization of a third alpha-class hypoxia inducible factor
subunit, HIF3alpha. Gene Expr 7,205-213 (1998).
1 17. Hirose, K. et al. cDNA cloning and tissue-specific expression of a novel basic helix-loop-
belix/PAS factor (Amt2) with close sequence similarity to the aryl hydrocarbon receptor nuclear
translocator (Arnt). Mol Cell Bi01 16, t 706- t 7 13 ( 1996).
118. Takahata, S. et al. Transcriptionally active heterodimer formation of an Amt-Iike PAS
protein, Amt3, with HIF-la, HLF, and clock. Biochem Biophys Res Commun 248, 789-794
(1 998).
119. Nagao, M., Ebert, B. L., Ratcliffe, P. J. & Pugh, C. W. Drosophila melanogaster SL2
cells contain a hypoxically inducible DNA binding complex which recognises mammalian HIF-
binding sites. FEBS Lett 387, 16 1 - 166. (1 996).
120. Crews, S. T. Control of ce11 lineage-specific development and transcription by bHLH-
PAS proteins. Genes Dev 12,607-620 (1998).
57 121. Nambu, J. R., Chen, W., Hu, S. & Crews, S. T. The Drosophila melanogaster similar
bE&H-P-AS gene encodes a protejn related to buman hypoxia-inducible factor 1 alpha and - - - - - - - - -
Drosophila single- minded. Gene 172,249-254. (1 996).
122. Bacon, N. C. et al. Regulation of the Drosophila bHLH-PAS protein Sima by hypoxia:
hctional evidence for homology with mammalian HIF-1 alpha. Biochem Biophys Res Commun
249,811-816 (1998).
123. Wilk, R., Weizman, 1. & Shilo, B. 2. trachealess encodes a bHLH-PAS protein that is an
inducer of tracheal ce11 fates in Drosophila. Genes Dev 10,93- 102. (1 996).
124. Isaac, D. D. & Andrew, D. J. Tubulogenesis in Drosophila: a requirement for the
trachealess gene product. Genes Dev 10, 103- 1 17. (1 996).
125. Zelzer, E., Wappner, P. & Shilo, B. Z. The PAS domain confers target gene specificity of
Drosophila bHLH/PAS proteins. Genes Dev 11,2079-2089 (1 997).
126. Iyer, N. V. et al. Cellular and developmental control of 0 2 homeostasis by hypoxia-
inducible factor 1 alpha. Genes Dev 12, 149- 162 (1 998).
127. Ryan, H. E., Lo, J. & Johnson, R. S. HF-1 alpha is required for solid tumor formation
and embryonic vascularization. Embo J 17,3005-3015 (1998).
128. Maltepe, E., Schmidt, J. V., Baunoch, D., Bradfield, C. A. & Simon, M. C. Abnormal
angiogenesis and responses to glucose and oxygen depnvation in mice lacking the protein
ARNT. Nature 386,403407 (1997).
129. Flamme, 1. et al. HRF, a putative basic helix-loop-helix-PAS-domain transcription factor
is closely related to Liypoxia-inducible factor-1 alpha and developmentally expressed in blood
vessels. Mech Dev 63,5160. (1997).
130. Hogenesch, J. B. et al. Characterization of a subset of the basic-helix-loop-helix-PAS
supcrfkmily that interacts with cotqmnfilh of the dioxin signalhg pathway. J Biol Chem 272,
858 1-8593. (1 997).
131. Tian, H., Hammer, R. E., Matsumoto, A. M., Russell, D. W. & McKnight, S. L. The
hypoxia-responsive transcription factor EPAS 1 is essential for catecholamine homeostasis and
protection against heart failure during embryonic development. Genes Dev 12, 3320-3324
(1 998).
132. Peng, S., Zhang, L., Drysdale, L. & Fong, G. H. The transcription factor EPAS-
lhypoxia-inducible factor 2alpha plays an important role in vascular remodeling. Proc Nat1
Acad Sci US A 97,8386-8391. (2000).
58 3 3 Horsman, M. R. Measurement of -or oxygenation. Int J Rudiat Oncol Bi01 Phys 42,
701-704 (1998).
134. Raleigh, J. A., Dewhirst, M. W. & Thrall, D. E. Measuring Turnor Hypoxia. Semin
Radiat Oncol 6,3745 (1 996).
135. Marti, H. J. et al. Hypoxia-induced vascular endothelial growth factor expression
precedes neovascularization after cerebral ischemia. Ain J Pathol156,965-976 (2000).
136. Weidner, N. Angiogenesis as a predictor of clinical outcome in cancer patients. Hum
P ~ t h d 3 1,403-405 (2000).
137. Chen, E. Y., Fujinaga, M. & Giaccia, A. J. Hypoxic microenvironment within an embryo
induces apoptosis and is essential for proper morphological development. Teratology 60,2 15-
225 (1999).
138. Kothary, R., Perry, M. D., Moran, L. A. & Rossant, J. Cell-lineage-specific expression of
the mouse hsp68 gene during embryogenesis. Dev Bi01 121,342-348 (1987).
139. Kothary, R. et (il. Inducible expression of an hsp68-lac2 hybrid gene in transgenic mice.
Development 105,707-7 14 (1989).
140. Rossant, J., Zirngibl, R., Cado, D., Shago, M. & Giguere, V. Expression of a retinoic acid
response element-hsplacZ transgene defines specific domains of transcriptional activity duting
mouse embryogenesis. Genes Dev 5,1333- 1344 ( 199 1).
141. Levy, A. P., Levy, N. S., Wegner, S. & Ooldberg, M. A. Transcriptional regulation of the
rat vascular endothelial growth factor gene by hypoxia. J Bi01 Chem 270, 13333- 13340 (1 995).
142. Bellairs, R., and Osmond, M. The atlas of chick development. San Diego: Academic
Press (1998).
CHAPTER 2
THE CONSTRUCTION AND CHARACTERIZATION OF HYPOXIA RESPONSIVE
REPORTER GENES FOR USE IN TRANSGENIC MICE
1. Results % -
1. The VEGF HRE Hsp Lac2 transgene responds to heat shock but not bypoxia in R1 ES
ceüs
Annealed oligonucleotide concatarners containing three copies of the mouse VEGF hypoxia
responsive eletnent (HM) were cloned before a modified Hsp68 Lac2 tmsgene 192, (Figure 2-
1, Table 1). To detemine if the VEGF HRE Hsp Lac2 transgene could produce oxygen
concentration dependent fbgalactosidase activity, a transient expression assay was perfomed on
RI ES cells using constmcts containing the minimal Hsp Lac2 transgene, or a transgene
containing wild-type or mutated mouse VEGF HRE. Electroporated cells were divided into
three plates and exposed to 20% oxygen (room air), 1% oxygen, or a 42 O C heat shock, as
descnbed in the Materials and Methods. Plates were stained for fbgalactosidase activity, and fl-
galactosidase positive cells were counted. Figure 2-2 shows a summary of four replicate
experiments as a ratio of cells induced by hypoxia or heat shock relative to üninduced cells
cultured at 20% oxygen. In al1 experiments, higher levels of B-galactosidase activity were
detected in heat shocked cells than those kept at 37OC. No differences were observed in the
levels of B-galactosidase activity in cells grown at 20% and 1% oxygen with any HRE construct.
There was no evidence to suggest that the VEGF HRE Hsp LacZ construct could produce
oxygen-concentration dependent &galactosidase activity in Rl ES cells.
Several explmations could be made to account for this finding. As there was no construct
used in this experiment that did show oxygen dependent fbgalactosidase activity, it could be the
case that the low oxygen conditions that the cells were exposed to (1% for 40 hours) were not
sufficient to stimulate a hypoxic response in the R1 ES ce11 line. While there has been no work
published on the behavior of HRE transgenes in R1 ES cells, there is evidence to suggest that R1
ES cells are able to upregulate the transcription of HIF target genes in response to hypoxia; Ryan
et al. show that several genes including VEGF, are upregulated in R1 cells exposed to 1%
oxygen for 4-24 hours 3. Can R1 ES cells upregulate the expression of a transiently transfected
HRE transgene under these oxygen conditions? A second explanation for these hdings is that
the mouse VEGF HRE is not sufficient to confer oxygen-dependent responses to an Hsp Lac2
transgene. To examine these possibilities, and to m e r explore the use of HRE elements in
61 creating a hypoxia-responsive transgene, work was done to establish an in vitro system in which
- --.. - . oxygen-dependent changes in gene expression could be quantified.
Figure 2-1 : The VEGF HRE Hsp Lac2 transgenes
---- .-- - A.
Wild-Type VEGF HRE : agcttacacagtgcatacgtgggtttccacaggtcgtctcactccccgccaa
Mutated VEGF HRE: agcttacacagtgcataaaagggtttccacaggtcgtctcactccccgccaa
---- - - - Fig-2-1: A) Sepuence of the wild-tyge and mutated forms of the mouse VEGF hypoxia responsive element, with HIF- 1 consensus binding site in bold. B) Schematic diagram of
VEGF HRE Hsp Lac2 transgenes. Three copies of wild-type or mutated mouse VEGF
HRE were cloned into the Hind III (H) site 20 bp h m the start of the Hsp Lac2 cassette.
64 Table 1 : Oligonucleotide sequences and PCR pnmers used in the preparation of HRE containing
p & i Ï Ï a d e 1 ol'mber 1 Sequence
mVEGFWTHRE-F elements 1 1 1 ACGTTACACAGTGCATACGTGGGTTTCCACAGGTCGTCTCAC
mVEiGFWTfiRE-R
mVEGFMutHRE-F
mVEGFMutHRE-R
1
hEP0WTHR.E-F
TCCCCGCCAA AGCTITGGCGGGGAGTGAGACGACCTGTGGAAACCCACGTA
1
1
hEPOWTHRE-R
hEPOMutHRE-F
hEPOMutHRE-R
TGC ACTGTGTA ACGTTACACAGTGCATAAAAGGGTITCCACAGGTCGTCTCAC TCCCCGCCAA AGCTlTGGCGGGGAGTGAGACGACCTGTGGAAACCCTTlTA
3
mPGKWTHRE-R
TGCACTGTGTA AGCTTGATCGCCCTACGTGCTGTCTCAGATCGCCCTACGTGC
3
3
3
.. M-EPOPCR-F M-EPOPCR-R M-EPOPCR Kpiil-F M-EPOPCR EcoRV-R RV Primer 3 (pGL3) GL Primer 2 (pGL3)
TGTCTCAGATCGCCCTACGTGCTGTCTCAA AGCTITGAGACAGCACGTAGGGCGATCTGAGACAGCACGTA GGGCGATCTGAGACAGCACGTAGGGCGATCA AGCTTGATCGCCCTAAAAGCTGTCTCAGATCGCCCTAAAAGC TGTCTCAGATCGCCCTAAAAGCTGTCTCAA AGCTTTGAGACAGCTTITAGGGCGATCTGAGACAGCTfTTAG
3 GTCGTGCAGGACGTGACAA AGCTTTGTCACGTCCTGCACGACTGTCACGTCCTGCACGACT
PCR PCR PCR PCR PCR PCR
GTCACGTCCTGCACGACA AAAAAAAAAGCTTGCTAGCCCGGGCTCGA AAAAAAACTGCAGATGCAGATCGCAGATC AAAAAAGGTACCGCTAGCCCGGGCTCGA AGAAAGATATC ATGCAGATCGCAGATC CTAGCAAAATAGGCTGTCCC CTTTATGrr-1-rrGGCGTCl"TCCAT
65 Figure 2-2: The VEGF HRE Hsp Lac2 transgenes respond to heat shock but not hypoxia
-LA* A-& a- -
Relative induction of Hsp LacZ h s g e n e s in R I ES-cells exposed to reduced oxygen or heat shock conditions
Expenment
1 1 % Oxygen Hsp Lac2
2 Heat Shocked Hsp Lac2
4 Heat Shocked mVEGF WT H s p W
lConstruct ITreatment 1 Average IStd. Dev. 1 Hsp Lac2 Hsp LacZ mVEGF WT Hsp
,Lac2 mVEGF WT Hsp
1% Oxygen Heat Shock 1% Oxygen
mVEGF Mut Hsp LacZ
Heat Shock
1.66 15.70 1.52
1% Oxygen
0.62 0.53 1.43
22.72
mVEGF Mut Hsp [ ~ e a t Shock 17.15
6.26
8.27
1.35 0.97
Figure 66
2-2: Rl ES cells were transiently electroporated with Hsp LacZ transgenes containhg
wild-type, mutant, or no VEGF - -- H- trimer. Transfected cells were split between three
plates and incubated under normoxic (20% 0 2 , 5% CO2, 94% Ni, 37OC). hypoxic (1%
02, 5% COz, 94% N2,37OC), or heat shock conditions (20% 9 , 5 % C02,94% N2, 42OC)
as described in the Materials and Methods. Plates were stained for fbgalactosidase
activity, and the number of p-galactosidase positive cells determined for each condition.
Displayed are the average ratios calculated of 1%:20%, and 42OC:37OC for each
construct, fkom up to four replicate expenments. The induction of Hsp Lac2 by heat
shock is significantly different nom that by exposure to conditions of low oxygen (*
indicates ~<0.025. Stuclent's t-test).
67 2. The EPO EIRE can confer hypoxic expression to an SV40 Luciferase transgene in HeLa ceUs
A s w e y of the literature on hypoxia response shows that hypoxia responsive transgene
activity had been demonstrated in several ce11 lines, including HepG2, Hep3B, and HeLa. HeLa
cells were cbosen over R1 ES cells for the functional dissection of the HRE based transgenes for
three reasons. Firstly, transient transfection assays described in the literature showed that
hypoxic HeLa cells were able to mediate consistent, quantifiable induction of a given hypoxia-
responsive construct in transient transfection assays; no reports had been published on similar
assays perfomed in R1 ES 4-7. Secondly, HeLa cells were readily accessible and easy to work
with. Thirdly, a constmct was obtained that had been shown to mediate a hypoxic response in
transiently transfected HeLa cells 8, and could be used as a positive control (EPO n=4 SV40
Luciferase, Materials and Methods).
HeLa cells were transiently transfected with a constitutively expressed pgalactosidase
reporter (pBOS, Materials and Methods), and one of three constructs containiag CMV
Luciferase, SV40 Luciferase, or a constnict containing SV40 Luciferase preceded by four copies
of the EPO HRE (EPO (n=4)SV40 Luciferase, Figure 2-2, Materials and Methods). Transfected
cells were split to two plates and incubated under 20% or 1% oxygen. Cells were harvested, and
extracts assayed for fl-galactosidase and Luciferase activity. No differences in ce11 viability were
noted between samples incubated under 20% and 1% oxygen (data not shown); in this and al1
subsequent HRE-Luciferase experiments, CO-transfection of a constitutive $-galactosidase
expressing plasmid (pBOS) was used to normalize transfection efficiency and cell harvesting.
As shown in Figure 2-3 EPO (n=4)SV40 Luciferase consistently mediated 8-fold induction of
Luciferase activity in cells exposed to 1% oxygen relative to those exposed to 20% oxygen; this
is in agreement with previously reported findings (Figure 2-3) 9. Constnicts with either SV40 or
CMV Luciferase alone did not mediate hypoxic induction of Luciferase activity. These data
demonstrated that it is possible to observe and quantiv hypoxia-induced reporter activity in
transiently transfected HeLa cells; the oxygen conditions were sufficient to induce hypoxia-
responsive transgene ac tivity .
68 Figure 2-3: An EPO HRE SV40 Luciferase transgene can be induced by hypoxia in HeLa cells
. - ----- -- .- -
Induction of Luciferase activity in HeLa cells exposed to 1 % oxygen
1 2 3
Construct
1 SV40 Luciferase
2 EPO n=4 SV40 Luciferase
3 CMV Luciferase
Construct
SV40 Luciferase EPO n=4 SV40 Luciferase CMV Luciferase
Average Fold Induction 1.41 8.47 1 .50
Std. Dev.
0.54 3.98 0.39
n
11 19 6
- Figure - . 2-3: HeLa cells were transfected - with SV40 Luciferase, EPO n=4 SV40 Luciferase, or
CMV Luciferase and the consitutive fbgalactosidase expression vector pBOS.
Transfected cells were split between two plates, incubated under 1% or 20% oxygen,
harvested, and assayed for Luciferase/P-galactosidase activity as described in the
Materials and Methods. Luciferase and fLgalactosidase data fiom each 1%/20% pair was
used to calculate an induction ratio, by dividing the Luciferase activitylp-galactosidase
activity observed in cells grown under 1% by that of cells grown under 20%. Shown are
the average inductions over six to nineteen replicate experiments. EPO n=4 SV40
Luciferase gives significantly increased induction under conditions of reduced oxygen
compared with SV40 Luciferase and CMV Luciferase (***, p<0.0005, Student's t-test).
70 3. The EPO HRE can confer oxygeniensitive expression to an SV40 LacZ, but not an Hsp
LacZ based traasgeae - - - . -
Given the finding that the mouse VEGF HRE Hsp Lac2 tcansgene could not respond to
hypoxia in transiently transfected R1 ES cells, hvo questions were asked. Firstly, as it had been
demonstrated that three copies of the EPO HRE were sufficient to impart hypoxic inducibility to
a traasgene in HeLa cells, could the EPO HRE activate an Hsp Lac2 construct in HeLa cells
exposed to hypoxia? Secondly, could the EPO HRE mediate consistent, and measurable
activation of a LacZ based constmct?
To examine the effect of an HRE on the Hsp Lac2 reporter, a transgene was constmcted
placing four copies of the EPO HRE upstream of the Hsp promoter. (EPO (n=4) Hsp LacZ,
Materials and Methods) EPO HRE Hsp LacZ, or a constitutive &galactosidase were transiently
transfected with pSVLuc+ into HeLa cells, and incubated under 20% or 1% oxygen as described
in the Materials and Methods. As sbown in Figure 2-4, neither the constitutive Lac2 (pBOS),
nor the EPO HRE Hsp Lac2 gave significant increases in fbgalactosidase activity on exposure to
bypoxia. In al1 replicates, cells transfected in parallel with the EPO(n=4) SV40 Luciferase and
pBOS demonstrated significant induction (Figure 2-3).
To test whether lack of induction was due to the HRE or the particular promoter used, a
transgene was consûucted in which four copies of the EPO HRE and the SV40 promoter were
cloned before a Lac2 reporter. In al1 replicate experiments, cells transfected with the EPO HRE
SV40 LacZ, but not the SV40 Lac2 construct measurably induced LacZ activity under hypoxic
conditions (Figure 2-4).
71 Figure 2-4: The EPO HRE can activate the SV40 but not the Hsp promoter in hypoxic HeLa
-- - - cells
Activity of Lac2 transgenes in HeLa cells exposed to 1% or 20% oxygen
hEPO n=4 Hsp LacZ pBOS Construct
O Average 20% Average 1%
Activity of Lac2 transgenes in HeLa cells exposed to 1% or 20% oxygen
Average Average
Construct
Figure 2-4: A) A representative experiment in which EPO HRE Hsp LacZ or pBOS transgenes
were cotransfected with a constitutive Luciferase expression plasmid into HeLa cells.
Transfected cells were exposed to 1% or 20% oxygen, harvested, and assayed for p- galactosidase and Luciferase activity as described in the Materials and Methods. Bars
represent the absorbance for each construct averaged over two replicates after
standardizing for transfection and harvesting efficiency, using the Luciferase data. EPO
Hsp Lac2 activity was assayed in seven separate experiments; no evidence was found for
an oxygen-concentration dependent effect on EPO Hsp LacZ activity. Data shown are
fiom one of six replicate experiments. B) An experiment showing the activity of EPO
HRE SV40 LacZ, and SV40 LacZ transgenes in HeLa cells exposed to 1% or 20%
oxygen. As in A), p-galactosidase readings for 1% and 20% samples were standardized
for transfection and harvesting using the Luciferase data. Bars correspond to the average
absorbance of three replicates for each sample. (** indicates that activity under 1% and
20% oxygen is significantly different by Student's t-test, p<0.005.)
73 4. Minimal HREs from dlfterent KIF-1 target genes have diffennt responses in HeLa ceUs
exposed to low oxygen
Since the discovery of HIF-1, more than twenty-eight genes have been shown to be
upreguleted in hypoxic cells 10. Minimal hypoxia responsive elements have been identified in
some of these genes including the phosphoglycerate kinase (PGK-1) gene, the vascular
endothelial growth factor (VEGF), and the erythrocyte stimulating hormone erythropoietin
(EPO). As shown in Figure 2-5, many groups have demonstrated the sufficiency of these
elements to impart hypoxia inducibility on a transgene, although differences in experimental
conditions, reporter context, and ceIl lines make it impossible to compare them directly. Are
there differences between the activities of minimal HRE elements derived fiom different
sources?
To address this question constructs containing three copies of wild-type (wt) EPO, wt PGK,
wt VEGF, and mutated (mut) EPO HRE were cloned in consistent orientation and distance to an
SV40 Luciferase transgene. One of these constmcts, or a constitutively expressed SV40
Luciferase driven by the SV40 Enhancer @SVLuc+), was transiently transfected into HeLa cells
with a constitutively expressed bgalactosidase @BOS). As shown in Figure 2-6 the consûuct
containing three copies of the wild-type, but not the mutated EPO HRE was capable of mediating
4-fold induction of Luciferase activity. The construct containing three copies of the mouse
VEGF element gave variable activity, ranging fkom no induction in several cases, to 22-fold
induction on one occasion. (The average value is shown in Figure 2-6.) Neither the SV40
Luciferase, nor the CMV Luciferase demonstrated hypoxic induction. The addition of four or
three copies of EPO HRE, three copies of PGK HRE, three copies of VEGF HRE, or the SV40
enhancer produced significantly different inductions compared with that observed with SV40
Luci ferase alone @ varies from <0.0 1 (VEGF HRE), to <0.0005 (PGK HRE). The addition of
three copies of mutated EPO HRE produced no sipificant difference in induction when
compared with the SV40 Luciferase transgene. Sûikingly, the construct containing the wild-type
PGK element gave consistently higher induction than either the EPO H E or VEGF HRE
containing conshucts. (Figure 2-6: 52-fold compared with Cfold, and 9-fo ld) (p<0.0005).
Figure 2-5: An alignment of HRE elements used in the literatwe
GATCGCCCTACGTGCTGTCTCA GCCCTACGTGCTGTCTCA GCCCTACGTGCTGCCTCG
CCACAGTGCATACGTGGGCTCCAACAGGTCCTCTT ACACAGTGCATACGTGGGTTTCCACAGGTCGTCTCACTCCCCGCCAA
GATCCACAGTGCATACGTGGGCTTCCACAGAGCTC GTCGTGCAGGACGTGACA ACGCTGAGTGCGTGCGGGACTCGGAGTACGTGACGGA TCTTGGCAGGACGTGCTATGGGGGGCACACATAGAT
Source 11 Mouse EPO 0
Transgene 4 Copies in SV40
9
~ u c i ferase 3 Copies in SV40
Human IGFBPl
2 Copies in TK GH 1 Copy in TK CGT 3 Copies in Hsp68 Lac2 1 Copy in TK Luci ferase 3 Copies in TK GH 1 Copy in SV40 Luci ferase 1 Copy of 372 bp fragment of IGFBPl intron 1 in Hsp7O Luci ferase
CeU Llne Induction Reference Hep 3B 50 Fold 8
HeLa I 8-9 Fold
R1 ES None This thesis
PC12 1 2.8 Fold 1 13 1 Hep G2 18 Fold 1 1 Hep 3B 34 Fold 14
---- - - - F i p - - 2.5: A survey of the literature showed - @at - - HF& sequences have been identified in many different target genes; nine representative elements are shown with details as to the
transgene and ce11 line in which they were tested. HIF-1 consensus binding sites are
highlighted, aad the EPO, VEGF, and PGK elements that were used in this study are
marked with an asterix.
76 Figure 2-6: HREs from different sources confer different induction on SV40 transgenes in
---,---A - - .. hypoxic HeLa cells
SV40 Luciferase activity of HeLa cells under 1% and 20% oxygen
1 2 3 4 5 6 7 8
Cons truc t
1 ~ ~ 4 0 Luciferase ~EPO n=4 SV40 Luciferase
Ipsv Luc+ ~ ~ E P O n=3 SV40 Luciferase
1 SV40 Luciferase
2 EPO n=4 SV40 Luciferase
3 CMV Luciferase
4 pSVLuc+
5 hEPû n=3 SV40 Luciferase
6 hEPO mut SV40 Luci feme
7 mWGF n=3 SV40 Luci ferase
8 mPGK n=3 SV40 Luciferase
Average Fold Std. Dev. n Induction 1.41 0.54 1 1
77 Figure 2-6: HeLa cells were transfected with the constitutive fhgalactosidase expressing plasmid
pBOS, and an SV40 Luciferase - - - transgene. - -- Transfected cells were incubated under 1% or
20% oxygen, harvested, and assayed for fl-galactosidase activity. The Fold Induction
was calculated by taking the ratio of Luciferase activity to ~galactosidase activity for the
sample grown at 1% oxygen, and dividing it by the same ratio for the sample grown at
20% oxygen. Data are presented as the average fold induction for n replicate samples;
the EPO n=4 SV40 Luciferase, pSVLuc+, EPO (n=3) SV40 Luciferase, VEGF SV40
Luciferase, and PGK SV40 Luciferase constructs give statistically significant differences
in induction when compared with the SV40 Luciferase transgene (*, pq0.025, ** p <0.01;
***, p<0.0005). Data on the SV40 Luciferase, EPO n=4 SV40 Luciferase, and CMV
Luciferase are the same experiments shown in Figure 2-3.
78 5. HREs can confer hypoxic-inducibiiity on TK Lucifense and TK Lac2 transgenes in
HeLa c@s --2 .----
Although it was clear that the EPO and later PGK HRE constmcts could mediate SV40
Luciferase induction in hypoxic HeLa cells, preiimioary evidence suggested that EPO n=4 SV40
Luciferase showed no inducion in hypoxic R1 ES cells (Figure 2-9, and data not shown). This
finding was surprising as it was known that RI ES cells were capable of mediating HIF-1
induction of several target genes (including VEGF and PGK) 3. Data in the literature shows that
the SV40 promoter does not work well to drive transgene expression in embryonic
teratocarcinorna cells, so it was decided to look at HRE activity on a different promoter 16. The
TK promoter was chosen for three reasons: firstly, it had been used as a basis for several
transgenics; secondly, the minimal TK promoter could be activated in ES cells; finally, evidence
in the literature had demonstrated that HREs could activate the TIC promoter in transiently
transfected Hep G2 cells 1 1.
To examine the activity of different HREs on the TK promoter, constmcts containing three or
four copies of wt EPO, or three copies of mutant EPO, wt PGK, or wt VEGF HRE TK
Luciferase were CO-transfected with pBOS into HeLa cells. As shown in Figure 2-7, replicate
experiments normalized for transfection showed that constructs containing three copies of wt
EPO or wt VEGF resulted in 2.5-foid induction of Luciferase activity relative to the normoxic
level. While low, this induction was statistically different than that observed with the TK
Luciferase transgene alone (p~0.01, 0.025 respectively). The construct containing four EPO
elements produced 9-fold induction, while a construct with three PGK elements consistently
produced high levels of Luciferase activity, averaging 40-fold induction in cells exposed to 1%
oxygen relative to those grown under 20% oxygen. The induction observed for EPO (n=4) TK
Luciferase, and PGK TK Luciferase was also significantly higher than that of the minimal TK
Luciferase transgene (p<0.0005 for each). Neither the basic TK Luciferase, nor a TK Luciferase
with a mutated EPO HRE induced under hypoxic conditions (Figure 2-7, ~ ~ 0 . 2 5 ) . A
cornparison of the induction of the TK Luciferase traasgenes to that of the corresponding SV40
Luciferase traosgene shows that there is no difference between the induction of the SV40 or TIC
constnicts containing the PGK HRE, the mutated EPO HRE, four copies of the wild-type EPO
HRE, or no HRE (p ranges from 0.25-0.40). The traiisgenes containing three copies of the
79 VEGF or EPO HREs were statistically different fkom the SV40 Luciferase counterparts,
(p<0.025,0.005 - respective1 y), although the si gni ficance of this finding is unclear.
To confimi and extend these findings, a series of TK LacZ transgenes containing wild-type or
mutated EPO HRE, PGK HRE, or no element were transiently transfected into HeLa cells, and
assayed as descnbed previously. A representative expriment is shown in Figure 2-8. In al1
expenments, neither TK LacZ, nor mutated EPO HRE TK Lac2 showed significant differences
in 0-galactosidase activity in HeLa cells exposed to 1% or 20% oxygen. HeLa cells transfected
with PGK HRE TIC Lac2 showed consistently higher levels of $-galactosidase activity in cells
exposed to 1 % oxygen than the cells exposed to 20% oxygen (n=6,3 are shown in Figure 2-8).
Figure 2-7: HRE TK Luciferase traasgenes cm be induced h hypoxic HeLa cells
Activity of TK Luciferase transgenes in HeLa cells exposed to 1% and 20% oxygen
1 hEPO n=4 SV40 60.00 1 +** 1 Luciferase
3 hEPO n=4 TK Luci ferase
4 hEPO n=3 TK Luci ferase
5 hEPO mut TK Luci ferase
6 mVEGF n=3 TK Luci ferase
7 mPGK n=3 TK
I~onstruct l~verage Fold IStd. Dev. In 1
hEPO n=4 SV40 Luciferase
~IIEPO n=3 TK Luciferase 12.72 10.5 1 16 1
TK Luci ferase hEPO n=4 'MC Luciferase
~ ~ E P O mut TIC Luci ferase 1 1.40 10.38 16 1
Induction 7.07
ImVEGF n=3 TIC Luciferase 12.45 10.50 16 1
1.64 9.15
I ~ P G K n=3 TK Luciferase (42.23 11 3.40 16 1
4.0 1 4 0.52 2.65
4 9
81 Figure 2-7: TK Luciferase tnuisgenes were transfected into HeLa cells with the constitutive p-
galactosidase expressing plamid-pBOS as described in the Matenals and Methods. As in -
previous figures, data is s h o w as an average fold induction of n replicate samples.
ConstNcts containing four or three copies of wild-type EPO HRE, VEGF HRE, PGK
HRE, but not the mutated EPO HRE produced significantly different induction on
exposure to low oxygen conditions than TK Luciferase. (*, p <O.OS; ** p < 0.01; ***, p
<0.0005, Student's t-test.)
82 Figure 2-8: The PGK HRE TK Lac2 transgene can produce quantifiable induction of $9
---, .. =---- - - galactosidase activity in HeLa-celis
Activity of Lac2 transgenes in HeLa cells exposed to 1% or 20%
TK LacZ hEPO WT hEPO Mut mPGK WT TK Lac2 TK Lac2 TK Lac2
O Average 20%
H Average 1%
Construct
Fig-e 2-8: A representative experiment in which TIC Lac2 transgenes were transiently - - - - -
transfected into HeLa cells with a constitutive Luciferase expressing plasmid pSVLuc+.
As in other experiments, transfected cells were split into two plates and incubated under
1% or 20% oxygen, harvested, and assayed for p-galactosidase activity. Data are shown
as a pair of bars corresponding to the absorbance (measure of the p-galactosidase
activity) of the 20% and 1% averaged from three replicate transfections after
standardizbg for transfection and harvesting eficiency. Shown are the data fiom one of
two replicate experiments. (* indicates that the activity of the transgene is significantly
difiemit in cells exposed to 1 % and 20% oxygen, Student's t test, pe0.025)
84 6. BRE 'MC Luciferase and HIRE TK LacZ transgenes have different activities in R1 ES
cells - --- A
The original goal of this work was to examine the areas of hypoxia in the developing embryo
through the production of hypoxia-responsive transgenic mice. For this appmach to be
successful, a constmct must be identified that Oves strong, reproducible induction specifically
upon low oxygen, with little expression under normal oxygen conditions. (Further discussion of
what is "normal" oxygen in vivo occurs later in this chapter.) As one of the commonly used
methods of producing transgenic mice requires the production of stable ES ce11 lines, it was
important to determine if HRE-containing constmcts could mediate induction of Luciferase or
Lac2 activity in R1 ES cells exposed to conditions of low oxygen.
In the first experiment, TIC Luciferase constnicts containing three copies of wt EPO, wt PGK,
wt VEGF, mutated EPO, or no element, were electroporated into Rl ES cells. Electroporated
cells were split into two and exposed to normoxic or hypoxic conditions. As in previous
experiments, cells were harvested, and extracts assayed for Luciferase and fl-galactosidase
activity. As shown in Figure 2-9, PGK, but no other HRE mediated an increase in Luciferase
activity in hypoxic R1 ES cells (p<0.0005). The induction observed with the PGK construct is
sipificantly higher than that of either the TK Luciferase alone, or than that produced by wild-
type EPO, mutated EPO, or VEGF concatamers (p<O.OOS).
To detexmine if an HRE could mediate the hypoxic induction of LacZ activity in RI ES cells,
the transient transfection experirnent was repeated with the TK LacZ based constructs. As
described previously, coastmcts containhg wt PGK, wt EPO, mut EPO, or no elemnit with TK
LacZ were electroporated into R1 ES cells, split, and incubated under 20% and 1% oxygen.
Figure 2-10 shows a representative experiment standardized to the Luciferase activity for
transfection and harvesting efficiency. Although some samples of cells transfected with the PGK
TK Lac2 construct appeared to show differences in activity between the 1% and 20% samples,
~galactosidase activity was low in al1 samples, and no consistent differences were seen with any
of the TK Lac2 constmcts (Figure 2-10, and data not shown).
85 Figure 2-9: PGK but not EPO HRE TIC Luciferase transgenes are induced in hypoxic R1 ES cells
Actnrity ratio of TK Luciferase transgenes in R1 ES cells exposed to 1 % and 20%
1 2 3 4 5 6 7 Construct
1 hEPO n=4 SV40 Luci ferase
2 TK Luciferase
3 hEPO n=4 TK Luciferase
4 hEPO n=3 TK Luciferase
5 hEPO mut TK Luciferase
6 mVEGF n=3 TK Luciferase
7 mPGK n=3 TK Luciferase
Construct , ,hEPO n=4 SV40 Luciferase ,TK Luci ferase $EPû n=4 TK Luciferase *!PO n=3 TIC Luciferase ,!iEPO mut TK Luciferase rnVEGF n=3 TIC Luciferase mPGK n=3 TK Luciferase
Average Fold Induction 0.76 0.87 t0,78 0.85 0.77 0.99 3.24
Std. Dev.
0.18 0.47 .0.12 0.23 0.15 0.3 1 1 .O4
F i g i e 2-9: TK Luciferase transgenes were electroporated into RI ES cells, split into two - -L - 2 - - -
populations and incubated under 1% or 20% oxygen as described in the Materials and
Methods. Induction ratios (Fold Induction) was calculated fkom taking the ratio of the
Luciferase activity/ unit absorbance of cells grown under 1% oxygen to that of the cells
p w n under 20% oxygen. Data are presented as an average of n replicate transfection
experiments. (***, p <0.0005 by Student 's t-test).
87 Figure 2-10: The HRE TK LacZ ûansgenes do not induce fl-galactosidase activity in hypoxic R1
- - . P A L - - ES cells
Activity of TK LacZ transgenes in RI ES cells exposed to 1% or 20% oxygen
D Average 20% Average 1 %
pBOS TK LacZ hEPû WT hEPO Mut mPGK TIC Lac2 TIC Lac2 WT TK
Lac2
88 Figure 2-10: TK Lac2 transgenes were electroporated into RI ES cells with the constitutive
w - Luciferase expression plasmid pSVLuc+. Transfected cells were split into two
populations and incubated under 1% or 20% oxygen as described in the Materials and
Methoûs. Data are presented as a pair of bars corresponding to the average Absorbance
for constmct, after standardizing for transfection and harvesting efficiency. Shown is
representative data fiom one of three replicate experiments. No significant differences in
TIC LacZ activity were seen in cells exposed to 1 % or 20% oxygen.
89 7. The PGK HRE SV40 Luciferase haasgene shows the gnatest change in acthity between
- 10% and 1% oxygen -- -
As discussed previously, the intention behind this work was to identiQ the areas of reduced
oxygen concentration that occur in a developing embryo through the expression of an oxygen
sensitive transgene. In the work to this point, HRE transgene expression has been investigated
by cornparhg transgene expression in cells exposed to 20% oxygen (normal incubator
conditions), to that observed in cells exposed to 1% oxygen (low oxygen conditions). In the
literature these conditions are often referred to as nomoxic and hypoxic respectively, and are the
standard conditions under which much of the work on hypoxia responsive genes has been
performed 1,13,14. Recently, it bas been hypothesized that the definition of 20% oxygen as
"normoxic" is misleading, and that the average tissue oxygen concentration is around 6%. This
estimate seems to be supported by the historical findings of clioicians 17. Given this
information, and the requirement that the transgene have low basal levels of activity under
nonnal conditions of oxygen, how suitable is an HRE-based transgene for the examination of
tissue oxygenation?
As shown in Figure 2-6, of the HRE SV40 Luciferase constnicts tested, the PGK HRE SV40
Luciferase transgene consistently gave the bighest increase in Luciferase activity in hypoxic
cells, averaging 52 f 16 fold induction (n=8). To examine the effect of oxygen concentration on
transgene activity HeLa cells were traasfected witb the PGK SV40 Luciferase, the EPO (n=3)
SV40 Luciferase, or the basic SV40 Luciferase transgene; transfected cells were split into two
plates and incubated at 20% oxygen, or under reduced levels of oxygen (l5%, IO%, 5%, or 1%)
for 40 hours. After incubation cells were harvested and assayed for Luciferase or p- galactosidase activity as described previously. Standardized induction ratios were calculated for
each sample set (see Matenals and Methods for calculations); Figure 2-1 1 shows the average
induction as a fiuiction of oxygen concentration. Neither the EPO nor the PGK transgene
showed a significant increase in activity between 20% and 10% oxygen (p < 0.10). Beween
10% and 5%, cells transfected with PGK HRE SV40 Luciferase showed a signifiant increase in
Luciferase activity ftom 2.6 to 11 times the level at 20% (p < 0.005). The EPO(n=3) SV40
Luciferase shows little change in activity between 10% and 5%. Between 5% and 1%, the PGK
SV40 Luciferase transgene shows a M e r increase in activity, fiom 1 1 fold increase at 5% to 24
-- - 90 fold increase at 1%. (Both compared with the level of Luciferase at 20%, p < 0.005.) At 1%
---A - - - - oxygen concentration the EPO construct showed - a modest increase to 6 times the Luciferase
activity at 20%, but there were not suficient data to conclude that the observed increase was
statistically signi ficant (p < 0.25).
91 Figure 2- 1 1 : The HRE SV40 Luciferase ûansgenes show dose dependent responses to changes
- ------ in oxygen levels.
Induction of SV40 Luciferase transgenes under increasing oxygen concentration
Oxygen concentration
-t- SV40 Luciferase
4 E P O (n=3) SV40 Luci ferase PGK (n=3) SV40 Luci ferase
concentration L
SV40 Luci ferase SV40 Luciferase SV40 Luci ferase SV40 Luci ferase
PGK (n=3) SV40 Luciferase 0.15 -1.86 0.59 PGK (n=3) SV40 Luciferase 0.1 2.59 1 .O7
Average Fold Induction
EPO (n=3) SV40 Luciferase EPO (n=3) SV40 Luciferase EPO (n=3) SV40 Luciferase EPO (n=3) SV40 Luciferase
PGK (n=3) SV40 Luciferase 0.01 24.22 7.4 1
Std. Dev.
0.15 O. 1 0.05 0.01 0.15 0.1 0.05 0.0 1
1.18 0.53 0.77 0.85
0.29 0.20 I
0.22 0.24
1.23 0.57 0.97 -6.35
0.042 O-O
0.488 4.98
Figure 2-1 1: For each oxygen concentration Ci%, 5%: IO%, or 15%), three replicates of SV40 -
Luciferase, two replicates of EPO n=4 SV40 Luciferase, and six replicates of PGK (n=3)
SV40 Luciferase were CO-transfected with the constitutive fbgalactosidase expressing
plasmid pBOS into HeLa cells. Transfected cells were split into two populations, and
incubated under 20% oxygen, or a reduced oxygen concentration. As in previous
experiments, cells were harvested, and assayed for Luci ferase and fbgalac tos idase
activity. lnduction ratios were calculated and averaged between the replicate
measurements of a constmct for a given oxygen concentration, to produce an estimate of
the activity of the construct at a given oxygen concentration, relative to the activity of the
same construct at 20% oxygen. The data are presented as a graph of the average
induction ratios. The induction of PGK HRE SV40 Luciferase was significantly different
nom that of SV40 Luciferase at al1 oxygen concentrations tested.
93
II. Discussion -- 4.--Acoeaeesw BEF-1 binding site kaet aIw.yc suniCient tQ confer oxygem reopo~siveness
to a transgene
Several interesthg observations have been made through these experirnents. The fmt of
these is the surpriskg finding that a response element containing a consensus HIF-1 binding site
is not suficient to confer oxygen sensitive expression to an Hsp LacZ transgene in HeLa cells.
As show in Figure 2 3 , four copies of the minimal EPO HRE were sufficient to confer hypoxia
responsiveness to an SV40 Luciferase, and an SV40 LacZ transgene, but not to an Hsp Lac2
transgene in HeLa cells. Several possible explanations could account for these tindings. Of
these, two, the potential effects of chromatin structure, and the hypothesized role of secondary
structure on HRE activity, will be discussed in m e r detail.
One possible explanation for the observed difference in function may be attributed to the
chromatin structure of the heat shock loci. As described in a review by Wallrath et al., work
done on the Drosophika Hsp70 locus bas demonstrated that the binding of proteins to the GAGA
boxes prevents the formation of nucleosomes over the Hsp70 regulatory regions. This binding
allows the formation of transcription initiation complexes, but is not sufficient to stimulate the
subsequent movement of the polymerase for transcript elongation. 18. When cells are heat
shocked, Heat Shock Factors (HSFs) bind to heat shock response elements (HSEs) upstream of
the site of transcription initiation, interacting with the stalled polymerase complexes to permit
transcription. Alterations made to the chromatin structure prevent the formation of these
"preset" complexes, and reduce or eliminate heat shock induction 18-20, It is possible that HIF
binding to the EPO HRE is not sufficient to activate transcription at the stalled Hsp locus, or
even that local alterations in the chromatin structure prevent HIF-1 binding to the HRE. While
there is no reasoa to suspect that HE is less capable of activating stalled complexes at the Hsp
promoter than other transcription factors, it has not been determined if HIF can bind to the
stalled transcription complexes, or if that binding was sufficient for transcriptional activation. A
preliminary experirnent, such as an SI nuclease protection assay, might be useful to determine
the areas of protection and hypersensitivity on the EPO Hsp LacZ and Hsp Lac2 transgenes. 1s
the HRE accessible to proteh? Once the areas of protein binding were identified, it would be
interesthg to perform an in vitro binding assay, to M e r examine the interactions in EPO HRE
Hsp Lac2 transgenes. If the EPO Hsp Lac2 transgene is incubated with nuclear extract fkom
94 cells grown under 1% or 20% oxygen, are there differe-nces in the complexes formed? Can HIF-
1 bind to @ EPO HRE Hsp Lac2 transgene? -- - - -- - --
Interestingly, a recent paper by Tazuke et al demonstrated that two copies of a 372 bp
sequence containing the IGFBP-1 HRE could confer 30-fold induction ont0 an Hsp Luciferase
transgene in HepG2 cellsl5. M i l e the IGFBP-1 HRE used undoubtedly contains other
regulatory elements that could assist with transcription at the Hsp locus, the length of the element
results in a greater distance between the element and the Hsp promoter. Given the finding that
chromatin structure is an important mechanism of Hsp7O regulation, it is reasonable to propose
that altering the distance between a regulatory element and the "preset" chromatin domain might
affect element function. Given that the nucleosome is thought to contain 146 bp of DNA, the
addition of approximately 300 bp between the HRE and Hsp could be enough to shift the
element out of the nucleosome, and render it accessible to HIF. Along these lines, experiments
could be performed to examine the behavior of the minimal IGFBP-1 HRE in the Hsp Luciferase
transgene, or look at the behavior of the EPO or PGK elements at different positions with respect
to the Hsp Lac2 tmnsgene.
The idea that chromatin might be involved in the regulation of the Hsp promoter, and Hsp
based transgenes is not without precedent in the literature. The homeobox (Hox) genes are a
group of transcription factors that are essential for pattern formation in the developing
27,2 8 embryo. Unusually, these genes are clustered, and are expressed in a linear manner
proceeding fiom 3' to 5' over the spatial and temporal course of development. M i l e the
establishment of Hox expression is not well understood, it is thought that a cis acting repressor
element, located upstream of the complex prevents the promoters fiom premature activation.
Enhancer elements provide an additional level of control, by stimulating the expression of non-
repressed genes. Most imporîantly to this work is the hypothesis, described in a recent review by
Deschamps et al., that chromatia is important for the maintenance of Hox expression States. In
this model, the transition of expression fiom 3' to 5' Hox genes would occur in conjunction with,
or as a result of, the directional opening of the chromatin. As development progresses, the
chromatin would relax, resulting in the increasing availability of 5' genes for transcription. After
a time the chromatin was thought to "fieeze" the transcription state of the Hox cluster,
"propagating the memory" of the expression levels to fûture generations of cells. While much
95 mon work needs to be done to understand the role of chromatin in transcription regulation, the
A second explanation accounting for the insufficiency of an HRE to activate the Hsp
promoter lies within the concept of the "minimal" hypoxia response element. In the literature,
the term minimal is used to describe the smallest sequence identified by deletion or mutation,
that can confer an efiect ont0 an exogenous promoter. Of the elements used in this study, the
human EPO, and mouse PGK elements had been tested and met this cnteria. The mouse VEGF
element was not tested, but shared 83% homology with the minimal human VEGF HRE,
including 100% homology over the HIF-1 binding site and mrrounding sequence (Figure 2-5).
Despite these criteria, there are noticeable differences in the length and sequence composition of
the minimal elements (Figure 2-5). Given the finding that the EPO HRE can act on the SV40 but
not the Hsp promoter, it is possible that there are additional sequençe elements, or protein-
protein interactions in addition to the binding of HIF-1 which are required for the activity of the
element. Stated plainly, it is possible that the EPO HRE is not suffieient for transgene activity,
but has worked with a few transgenes because of the presence of other useful binding sites or
proteins that are in the vicinity of the promoter. The Hsp promoter, acting through a different set
of mechanisms does not have these interactions, and the HRE was not able to fimction. If this
idea were to be tested, a starting point would be to examine the areas in which proteins bind to
the Hsp promoter in vitro. A footprint analysis of protein binding to Hsp LacZ, EPO Hsp LacZ,
and EPO SV40 Lac2 using extracts prepared nom HeLa cells grown at 1% or 20% oxygen,
could be a useful fmt step in seeing what binding sites are occupied. It would be especially
interesthg to compare protein binding using extracts fiom cells incubated at 1% and 20%. Does
HIF bind to the EPO HRE Hsp Lac2 transgenes? What other promoters does this element work
with, (or not work with), and are there any similarities in promoter architecture or sequence?
While these experiments could provide interesting and usefbl data, it is important to note that
they use naked DNA, and would not be representative of nucleosome associated DNA in the
chromatin.
2, Hmoxia response elemem fro-rn dwerent sources have dinerent activities
A second interesting finding of this work is the observation that minimal HREs fbtn different
sources confer significantly different inductions to SV40 or TK based transgenes. Most
outstanding in these experiments is the activity of the PGK HRE. As shown in Figures 2-6 and
2-7, constructs containing the PGK HRE have significantly higher levels of induction than either
the base transgene or a transgene containing wild-type EPO or VEGF HRE elements. This
finding has no precedent in the literature; several groups have isolated minimal HREs from target
genes and shown that they can confer oxygen responsiveness to a transgene, but up to this point
no work has been done to compare HRE activity directly.
One possible explanation of these findings again returns to the definition of the "minimal"
hypoxia responsive element. As discussed above, it is certainly conceivable that hypoxia
responsive activity requires sequences outside the HRE. Given the differences in length and
sequence of the elements tested, it is also possible that the differences in HRE behavior stem
fiom the presence (or absence) of other regdatory regions within what has been defied as the
minimal element; such differences could alter the affmity of HIF-1 for the different HFtE
sequences. It is not clear at this time what would be the best experiment to test this idea.
Certainly, protein binding techniques such as footprinting analyses, or a crosslinking expenment
might give an idea of interacting proteins in extracts fiom cells grown under 20% and 1%
conditions. A comparison between matched constructs containing wild-type and mutated HRE
elements might give some interesting findings as to the protein activity on the element. This
said, it may be dificult to see differences due to the presence of "nonspecific" protein binding.
A better experiment might be to examine different elements in a functional assay, such as the
Luciferase assays descnbed here. Cornparisons between the activity of constnicts with wild-
type, mutated, or no HRE might reveal if there were an alteration in the level of transgene
activity in the absence of oxygen stimulation. A variation of this assay would be to keep an HRE
core sequence constant, and alter the 5' and 3' flanking elements. What sequences are
responsible for coderring the response differences?
A second possible explanation for the differences in HRE activity stems from the recent
suggestion that the formation of DNA secondary structures could be important to HRE function.
97 The formation of secondary structures was most recently proposed by Kimura et al. who
observed @at several hypoxia responsive elements have an auxiliary sequence 3' to the HIF - - - . --- - -
binding site 21. This sequence, a CAGGT motif had been reported previously by Semenza in
characterizhg the EPO element, and by Forsythe et al. in their work with the VEGF element
1,2122. In theu 2001 paper, Kirnuni et al. hypothesize that the (G/T) ACGTG sequence of the
HIF-1 binding site could form a hairpin secondary structure with the imperfect inverted repeat
CAGGT, provided by the hypoxia ancillary sequence (HAS). Mutation analysis of the VEGF
elements demonstrate that the alteration of either element, or the orientation/spacing of the
elements relative to one another significantly reduces the function of the entire HRE.
Furthermore, the sequence alignment reported by Kimura et al. shows that several previously
identified hypoxia responsive elements have similar auxillary sequences and spacing. As s h o w
in Figure 2-5, of the elements used here, only the VEGF element contains the auxiliary element
(CACAGGT). As in the paper by Kimura et al., this element forms a imperfect inverted repeat
with the HRE, and could conceivably assist in HRE activity. The EPO element used in these
concatamers lacked the awillary element; an examination of the EPO concatamer shows no
obvious candidates for secondary structure formation. Interestingly, while the PGK gene does
not have a consensus HAS, there are several small regions within the element that look as if they
could form secondary structures with the HIF-I binding site. Furthermore, an oligonucleotide
sequence compnsed of the PGK element, but not the EPO or VEGF elements appears to form a
stable secondas, structure when run on a denaturing polyacrylamide gel (data not shown). The
question of HRE activity will be discussed furiher in Chepter 3.
3. HRE transgene actMty is affected by the celiular context
One of the most striking findings of these experiments is the effect of the cellular
environment on the activity of an HRE based transgene. in the literatwe, the large number of
genes that have hypoxia response elements, coupled with the wide-ranging genetic and
physiologie reactions which occur when an organism is challenged with conditions of low
oxygen, suggested that hypoxia response was an organism-wide pathway that al1 cells could
undergo if necessary. While there is evidence to show that both the HeLa and the RI ES ce11
lines used in these experiments c m undergo a hypoxia response, the extent of induction of these
cells are very different. ûne example of the difference between the response of HeLa and RI ES
cells is shown with the PGK TK Luciferase transgene. While the PGK element mediated 40 fold
98 induction in HeLa cells, it only produced a 3 fold incnasc in activity in R i ES cells. This
difference canmt be accounted for solely on the basis of transfection efficiency, as both samples = - - d -
were standardized for ce11 number. Furthemore there is no evidence to suggest that background
levels of Luciferase activity are higher in either ceIl line (data not shown). The differences in
activity described in this paper could conceivably be attributed to species differences between
human (HeLa) and mouse (R1 ES) lines, but certainly the data in the literature shows that large
differences can occur even between a pair of human ce11 lines (e.g. Hep 3B and HeLa.) 9.
Why are there differences in HRE transgene activity between ce11 lines? One explanation for
this finding is based on the basal level of promoter activity within the different ceIl lines. Since
the efficiency of transfection is different between the two ce11 lines, it is possible that many
fewer cells are acquiring the HRE transgene, but those that have it are expressing it at a much
higher basal level. If the base level of traasgene expression were high, then one might expect to
see a reduced extent of hypoxic induction in cells, when compared to a population with the same
amount of hypoxic HIF activity, and a lower base level of expression. A second possible
explanation is that accessory transcription factors assist in activating hypoxia-dependent
transgene activity. If such an accessory factor were absent in hypoxic R1 ES cells, then one
might expect some level of transcriptional activation, since HIF-1 would be present in the cells,
but the level of activity would be lower than if HIF bound to the HRE in the presence of such a
factor. The converse could also have occuned: if a repressor were expressed in R1 ES but not in
HeLa cells, one might expect less induction to be seen in hypoxic ES cells than in their HeLa
counterparts. To examine these possibilities in M e r detail, it would be useful to test the
activity of the HRE constructs in other ce11 lines, especially those fkom mice, to see if there are
any other variations in expression. 1s the PGK HRE always active in producing a quantifiabte
hypoxia response? While it is impossible to test HRE transgene expression in every ce11 type, a
survey of transgene response in many different ceil types could give an estimate of the variation
that one might encounter over the different ce11 types of the embryo. An analysis of transgene
expression in stable lines of undifferentiated, and differentiated ES cells might also be usefùl to
assess the extent and consistency of HRE transgene behavior.
4. s- HRE - - transgene activity as a funcdon ofosygen - concentration
A fuial interesting result that was identified through this thesis work was the examination of
HRE transgene expression under a range of oxygen concentrations. In the literature, much of the
information on the minimal HRE sequences was obtained through pairwise cornparisons of
transgene behavior under conditions of "normoxia", defined as 20% oxygen (room air), and 1%
oxygen, or "hypoxia". While mmy of the ce11 lines used in such experiments are normally
cultured under 20% oxygen, such terms are misleading when considering the behaviour of the
hansgenes in vivo. Measurements in anesthetized mammals bave found that the average p02 in
the alveoli is 104 mmHg (1 3.6%), with an average of 95 mmHg (1 2.4%) in arterial blood, and 40
mmHg (5.2%) in venous blood. It has been reported that the normal intracellular p02 ranges
fkom 5 mmHg (0.65%) to 40 mmHg (5.2%), with a minimum of 1-3 mmHg (0.13% to 0.39%)
required for metabolism 23. Other groups report concentrations of 30-35 mmHg (4.5%) in the
hepatic veins, 20-30 mmHg (3.4%) in the renal cortex, and 18 mmHg (2.5%) in the cerebral
cortex z4. A consensus of 6% oxygen has been proposed as a reasonable working estimate of
tissue oxygenation in a healthy mamrnal 17.
Given this information, it was important to examine the behavior of the HRE based
transgenes over a range of oxygen concentrations relevant to physiologic oxygenation. To this
end it was decided to look at increments of 5% oxygen concentration to obtain an estimate of
transgene behavior between 20% and 1%. As shown in Figure 2-1 1, very little change in
Luciferase expression is observed between 20% and 10% in either the EPO or PGK based
transgenes. The majority of the change in PGK expression occurs at oxygen concentrations
between 10% and 1%, with a potentially greater increase between 5% and 1%; the change
detected in the EPO transgene occurred between 5% and 1%. Little change is observed with
either transgene between 20% and 10% oxygen. While M e r oxygen points would need to be
tested to better elucidate the HRE expression curve in HeLa, it is clear that the increase in
Luciferase activity occurs over a range that is physiologicaily relevant.
A survey of the work performed on HLF-1 expression and DNA binding activity appear to be
in at least partial agreement with the findings of this work. As reported in Jiang et al., HIF-1 is
expressed at low levels over much of the range fiom 20% to 6% oxygen, increasing
100
exponentially over the lower ranges, to a maximum at 0.5% oxygen 24. Given the limits of
oxygen concentration tesîed in-tbis-expriment,- it- is not possible b state that they correlaîe
exactly with the fmdings of Semenza's group (the increase in activity between 10% and 5% are a
point of contention), but it is not surprising that the expression of an HRE containing transgene
resembles the expression and activity of the HIF-1 transcription factor. To be able to clariQ this
point, M e r experiments would have to be performed to examine HRE activity under a finer
range of oxygen concentrations.
5. The use of HRE containing transgenes to detect amas of hypoxia response in vivo
While the original goal of this project was to identify the amas of low oxygen in a developing
embryo through the activity of a hypoxia responsive transgene, the unexpected finding that an
HRE coupled to Hsp LacZ was not sufficient to produce oxygen dependent Lac2 activity in RI
ES cells prompted the detailed examination of HRE activity in vitro. As described above,
several findings have been made that raise interesting questions as to the activity of an HRE in
hypoxic cells. First, the activity of an H M is dependent on its context, unlike the general
response element hiated at in the literature. Secondly, the minimal elements themselves have
some differences, the causes of which are as yet unknown, that result in differences in the extent
of hypoxic induction, under controlled conditions of ce11 type, culture, and hypoxic stress.
Thirdly, differences exist behkreen ce11 lines such that an element functional in one line may give
no detectable induction in another. Finally, the range of activity between HRE based transgenes
shows differences between elements, but generally occurs between 5% and 1%, a range in
agreement with the current data on tissue oxygenation and the HIF-1 activity curve.
From these data, it canwt be said that the development of hypoxia responsive transgenic mice
is impossible. Certainly, the consistently strong induction observed for the PGK TK Luciferase,
and PGK TIC Lac2 in HeLa cells shows that it is possible to obtain hypoxia driven reporter
activity in vitro using an HRE transgene. The induction curve produced for the HRE Luciferase
transgenes shows that the maximum induction of the transgene does occur over the
physiologically relevant region, suggesting that the transgene could produce the desired activity
under conditions of low oxygen, with low activity under nomoxia. These data show a
statistically significant, quantifiable difference in activity in cells exposed to 5% and 1% oxygen.
It is not known if such a difference wili be as noticeable in the qualitative anaiysis of expression
101 patterns for which the transgene was intended. Further refmement of the oxygen concentration
- c g including additional points between 10% and 1% might be useful to understanding the
activity of the transgene. Given the variation observed in vitro both within a ce11 line, and
between cell lines, it is impossible to predict how the transgene will behave in vivo until it is put
into the mouse and the expression pattern exarnined. The continued use of HRE based
transgenes in the development of oxygen responsive transgenic mice will be discussed in
Chapter 3.
m. Coaclusions
In an attempt to identiw the areas of low oxygen in a developing embryo, a transgene was
constructed that juxtaposed an HRE ont0 a basic Hsp LacZ gene. The surpishg behavior of the
VEGF Hsp LacZ constmct prompted a series of expenments to compare the behavior of HREs
from different sources on different transgenes. Although performed to examine, and identiQ a
transgene usefil for embryological studies, the work described here has provided new
observations on element-promoter interactions, useful to anyone interested in transgene design.
Equally important are the cornparisons of HRE behavior described here, which provide a new
avenue on which to study the mechanisms of hypoxia response.
103 IV. Materials and Methods
-
Construction of HRE transgenes
HRE concatamerization: 10pg each of an oligonucleotide pair (Table 1) was annealed in 0.5 M
Tris (pH 7.9, and 100 m M MgC12, by placing the reaction tube in boiling water and allowing it
to cool to room temperature. Annealed oligonucleotides were phosphorylated with T4
polynucleotide kinase as per the manufacturer's instructions (NEB). HREs were ligated into
pBluescnpt (Stratagene), and sequenced to determine orientation and direction. Al1 subsequent
constructs were sequenced to c o d m HRE-promoter correctness.
Wild-tye and mutant VEGF HRE Hsp LacZ: XhoI-PstI fragments containing a trimer of wild
type or mutated mouse VEGF HRE were ligated into the XhoI-Pst1 sites of Hsp LacZ 2.
Sequencing showed that HREs were in the reverse orientation relative to the Hsp promoter.
SV40 Luciferase: The SV40 Luciferase transgene (pGL3-promoter, Promega), CMV-Luciferase,
and the EPO n=4 SV40 Luciferase construct were the kind gifts of M.Ema 8 9 . EPO n=4 SV40
Luciferase contains four copies of the EPO minimum HRE 8. HRE sequence is shown in Table
1. The pSVLuc+ containing Luciferase under the control of the SV40 promoter and enhancer
(pGL3-Control, Promega) was a gifi of Jemifer Mitchell.
HRE SV40 Luciferase constructs: EPO (n=3) wt, EPO mut, and PGK wt SV40 Luciferase were
constmcted by ligating the KpnVEco RV hgment of HRE-pBluescript into Kpd-SmaI digested
SV40 Luciferase. VEGF HRE SV40 Luciferase was prepared by ligating the Xhol-Eco RV
hgment into SmaI-XhoI digested SV40 Luciferase, resulting in a construct with three copies of
the wild type mouse VEGF HRE in the forward orientation relative to the SV40 promoter.
EPO HRE HSD Lad: Tbe concatamer of fout human EPO elements was PCR amplified fiom
EPO n=4 SV40 Luciferase using the primers pl M-EPOPCR-F and p2 M-EPOPCR-R. 20 ng of
template was amplified in 1.5 m M MgCD, 10 rnM Tris, 50 mM KCl, 0.001% gelatin, 10 ng/pL
each primer, and 0.2 mM dNTPs. Template was denatured at 94°C for 5 minutes, followed by
30 seconds annealhg at 58OC, and 1 minute extension at 72OC. 24 cycles followed consisting of
30 seconds at 91°C, 30 seconds at 58T, and 1 minute at 72°C.
SV40 Lac2 and EPO HRE SV40 LacZ: The - - - >3 kb band nom NcoI-XbaI digested EPO HRE
(II=~) SV40 Luciferase or NcoI-XbaI digested SV40 Luciferase, was ligated to the 3 kb NcoI-
XbaI hgment fiom Hsp Lac2 to produce EPO HRE SV40 LacZ, and SV40 LacZ.
TK Luciferase: The completed TK Luciferase constnict was a gift of M.Ema. Briefly, the TK
Luciferase transgene contains a 213 bp TK p m o t e r inserted into the XhoI fragment of the
pGL3 vector backbone.
EPO W. EPO mut. and PGK wt HRE TIC Luciferase: KpnI-EcoRV fragments of the HRE
in pBluescript were ligated into KpnI-Smal of TK Luciferase.
EPO (n=4 wt. VEGF HRE TK Luciferase: For these constnicts the HRE containing region of
VEGF SV40 Luciferase, or EPO SV40 Luciferase was amplified using the Rvprimer 3, and M-
EPOPCR EcoRV-R primen. PCR conditions were as described above. PCR products were
digested with KpnI-EcoRV, purified through conventional gel extraction (Qiagen), and ligated
into KpnI-EcoRV digested TK Luciferase.
TK Lac2 and HRE TK Lac2 constructs: The 3 kb NcoI-XbaI band of Hsp LacZ was gel pwified
and ligated to the 2 3 kb band of TK Luciferase, and the EPO (n=3) wt HRE, EPO mut HRE,
PGK wt HRE containing constructs to produce HRE TK LacZ.
Control constmcts: A constmct expressing Lac2 under the pENL promoter @BOS) was the kind
gifl of M.Ema 899. A second constmct, containing GFP under expression of pCAGG promoter
has been described elsewhere*?
Ceii Unes, transfection methods and incubation conditions
HeLa cells were cultured on plastic in DMEM supplemented with 10% FCS (Causera),
passaging every two days as recommended by ATCC. R1 ES cells were grown on plates pre-
treated with 0.1% gelatin, in DMEM supplemented with 15% FCS (HyClone), 2mM L-
glutamine, 100 pM B-mercaptoethanol, 1 m M sodium pyruvate, 0.1 mM non-essential amino
105 acids, 50 p g / d penicillin/sûeptomycin, and 1000 U/mL LE. R1 ES cells were passaged every
HeLa cells were transfected with 10 pg of test construct and 10 pg of a constitutively
expressed control plasmid (e.g. pBOS, pSVLuc+, or GFP, as specified in the text) for each well
of a six well plate. Transfection was by the Calcium Phosphate method: 88 pL of DNA diluted
in 1110 TE was added LOOpL of 2 x HBS (5.95 g HEPES, 8.17g NaCl, 0.37g Na2HP0.4 in 500
mL W20. pH 7.05) 12 PL of ice-cold 2M CaC12 was added over a period of 30 seconds with
agitation. Transfection mix was added to fresbly changed media on 80% confluent HeLa cells,
and plates were incubated for 4 h o u at 37OC. Afier the incubation, cells were split between two
plates and incubated at 20% Oz, 5% C02, (nomxic) or 1% 0 2 , 5% CO*, 94% Nt (hypoxic) for
40 hours.
Rl ES cells were electroporated with 20 pg each of test DNA, and a constitutiveiy expressed
control26. After a 30 minute incubation on ice, cells were split into two plates and incubated for
40 hours under nomoxic (20% 02, 5% CO2) or hypoxic (1% 0 2 , 5% CO2, 94% N2) conditions.
The transient transfection experiments to test the VEGF HRE Hsp LacZ transgene were
performed prior to the construction or acquisition of the Luciferase constnicts. In this
experiment, cells were electroporated with 40 pg of Hsp LacZ, VEGF wt Hsp LacZ, or VEGF
mut Hsp LacZ. After 30 minutes on ice, cells were split to three plates. Afier one day of
incubation under nomoxic conditions, and the addition of fiesh media, cells were incubated for
2.5 hours in either nomoxic (20% 02, 5% COZ, 37OC), hypoxic (1% 02, 5% COZ, 94% N2,
37OC), or heat shock (20% 02, 5% CO2, 42OC) conditions. M e r the specified incubation period,
cells were fixed, stained for fbgalactosidase activity, and the p-galactosidase expressing cells
counted.
Luciferase and @-galactosidase assays - - - - -
Cells were hawested in 400 pL (6 well plate), or 900 pL (100mm plate) of Reporter Lysis
Buffet, and subjected to a single freeze-thaw cycle as recommended by the
mamûachuer(Promega). 1OpL of HeLa extract, or 5OpL of RI ES extract was assayed with 50
pL Luciferase Assay Reagent (Promega) for 10 seconds in a Lumat LB 9507 luminometer
(EG&G Berthold).
For the assay of p-galactosidase activity, 50pL HeLa, or 250pL of RI ce11 extract was added
to 200pL ONPG (4 pg/mL), and 950 pL X-Buffer (16.1 g NazHP04-7H20,5.5g NaH2P04-H20,
0.75g KCI, 0.25g MgS04-7H20, 2.7 mL p-Mercaptoethanol, to IL, pH 7.0). Reaction
mixes were incubated for 4 hours (HeLa), or 12 hours (R1 ES) at 37OC; samples were read on a
Beckman DU 530 spectrophotometer (Beckman Coulter), using assayed extract fiom GFP
transfected control cells as a blank,
HRE Luciferase data is presented as the induction of Luciferase activity observed in hypoxic
extract relative to that observed in an equivalent sample of cells exposed to nonnoxia.
Fold induction = (1 % Luciferasell % LacZ) / (20% Luciferasel 20% LacZ)
Statistical analyses were perfonned using Student's t test, with reference to the table of t values
located at http:l/www.statsofi.com/textbook/sttable.h~l.
HRE &galactosidase results are presented as graphs of representative experiments showing
the $-ptactosidase activity meamcl m 20% and 1% ceti extracts, standdzed far the cumber
of cells. Unlike the constitutively expressed B-galactosidase used with the HRE Luciferase
experiments, p-galactosidase activity produced by the HRE-Lac2 constructs is almost
undetectable in most 20% extracts. Conversely, some samples, such as the HeLa cells
transfected with PGK HRE Lac2 produce nearly undetectable levels of pgalactosidase activity
under 20% oxygen, and measurable activity from cells exposed to 1% oxygen. Because of the
low level of activity observed under 20%, the calculation of a ratio between 1% and 20% & galactosidase activity is meaningless, mathematically equating to -/O. It is not known if the low
level of B-galactosidase activity detected in 20% samples represents "no expression" of the
107 transgene under 20% oxygen, or if the spectrophotometric assay is simply not sufficiently
-A--- - - sensitive to detect a response.
in the experiment to look at the effect of oxygen concentration on transgene activity (Figure
2-1 l), HeLa cells were tramfected as described above with EPO (n=3) SV40 Luciferase, PGK
Luciferase, or SV40 Luciferase, and pBOS. Transfected cells were split equally to two plates,
and incubated under 20% and a reduced level of oxygen (15% Oz, 5% CO2, 80% N2), (10% 0 2 ,
5% CO2, 85% N2), (5% 02, 5% CO2, 90% N2), (1% 0 2 , 5% C02, 94% N2). Cells were
harvested, and extracts assayed for Luciferase and fbgalactosidase activity. Spectrophotometer
and Luminometer were blanked using matched samples prepared with GFP ûansfected cells. A11
samples in this experiment were assayed at the sarne time, using the same batch of Luciferase
Assay Reagent, ONFG, and p-galactosidase assay buffer. Measurements were standardized for
ceIl number, and average induction ratios calculated for each construct within an oxygen cohort.
Figure 2-1 1 shows a plot of the average induction ratio for each construct at each oxygen
concentration.
10s V. References - =
1. Forsythe, J. A. et al. Activation of vascular endothelial growth factor gene transcription
by hypoxia-inducible factor 1. Mol Ce11 Bi01 16,4604-46 13 ( 1996).
2. Kothary, R. et al. Inducible expression of an hsp68-lacZ hybrid gene in transgenic mice.
Developrnent 105,707-7 14 (1989).
3. Ryan, H. E., Lo, J. & Johnson, R. S. HIF-1 alpha is requiml for solid tumor formation
and embryonic vascularization. Embo J 17,3005-30 15 (1998).
4. Wenger, R. H., Kvietikova, L, Rolfs, A., Camenisch, G. & Gassmann, M. Oxygen-
regulated erythropoietin gene expression is dependent on a CpG methylation-fiee hypoxia-
inducible factor- 1 DNA-binding site. Eur J Biochem 253,77 1 -777 (1 998).
5. Kvietikova, I., Wenger, R. H., Marti, H. H. & Gassmann, M. The transcription factors
ATF- 1 and CREB- 1 bind constitutively to the hypoxia-inducible factor- 1 (HIF- 1) DNA
recognition site. Nucleic AcidF Res 23,4542450 (1995).
6. Kvietikova, L, Wenger, R. H., Marti, H. H. & Gassmann, M. The hypoxia-inducible
factor4 DNA recognition site is CAMP-responsive. Kidney Int 51,564466 (1997).
7. Gerber, H. P., Condorelli, F., Park, S. & Ferma, N. Differential transcriptional regulation
of the two vascular endothelial growth factor receptor genes. Flt-1, but not Flk-l/KDR, is up-
regulated by hypoxia. J Biol Chem 272,23659-23667 (1997).
8. Ema, M. et al. A novel bHLH-PAS factor with close sequence similarity to hypoxia-
inducible factor lalpha regulates the VEGF expression and is potentially involved in lung and
vascular development. P m Natl Acud Sci U S A 94,427304278 (1 997).
9. Ema, M. et al. Molecular mechanisms of transcription activation by HLF and HIFlalpha
in response tv hypoxia: their stabilizetion and redox signabindueed interaction with CBP/p300.
Embo J 18, 1905-1914. (1999).
10. Semenza, G. L. Regulation of mammalian 0 2 homeostasis by hypoxia-inducible factor 1.
Annu R a , Ce11 Dev Biol15,551-578 (1999).
11. Firth, J. D., Ebert, B. L., Pugh, C. W. & Ratcliffe, P. J. Oxygen-regulated control
elements in the phosphoglycerate kinase 1 and lactate dehydrogenase A genes: similarities with
the erythropoietin 3' enhancer. Froc Natl Acud Sci US A 91,6496-6500 (1994).
12. Liu, Y., Cox, S. Rey Monta, T. & Kourembanas, S. Hypoxia regulates vascular
endothelial growth factor gene expression in endothelial cells. Identification of a 5' enhancer.
Circ Res 77,638-643 (1 995).
109 13. Levy, A. P., Levy, N. S., Wegner, S. & Goldberg, M. A. Transcriptional regulation of the
rat vascular endothelial growth factor gene by hypoxia. JBiol Chem 270, 13333-13340 (1995). - - - -
14. Semenza, G. L. et al. Hypoxia response elements in the aldolase A, enolase 1, and lactate
dehydrogenase A gene promoters contain essential binding sites for hypoxia-inducible factor 1. J
Bi01 Chem 271,32529-32537 (1996).
15. Tanike, S. 1. et al. Hypoxia stimulates insulin-like growth factor binding protein 1
(IGFBP- i) gene expression in HepG2 cells: a possible mode1 for IGFBP-1 expression in fetai
hypoxia. Proc Nutl Acad Sci U S A 95, 10 1 88- 1 0 1 93. (1 998).
16. Nicolas, J. F. & Berg, P. in Teratocarcinornu Stem Ceils (eds. Silver, L. M., Martin, G. R.
& Stnck ld , S.) 467-497 (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1983).
17. Csete, M. in Great Lakes Mummalian Deveiopment Meeting (Toronto, 2001).
18. Wallrath, L. L., Lu, Q., Granok, H. & Elgin, S. C. Architectural variations of inducible
eukaryotic promoters: preset and remodeling chromatin structures. Bioessays 16, 1 65- 1 70.
(1 994).
19. Bevilacqua, A. & Mangia, F. Activity of a microinjected inducible murine hsp68 gene
promoter depends on plasmid configuration and the presence of heat shock elements in mouse
dictyate oocytes but not in hvo-ce11 embryos. Dev Genet 14,92402 (1993).
20. Peny, M. D., Aujame, L., Shtang, S. & Moran, L. A. Structure and expression of an
inducible HSP70sncoding gene f?om Mus musculus. Gene 146,273-278. (1994).
21. Kimura, H. et al. Identification of Hypoxia-Inducible Factor-1 (HIF-1) Ancillary
Sequence and Its Function in Vascular Endothelial Growth Factor Gene induction by Hypoxia
and Nitric Oxide. 3 Bi01 Chem 276,2292-2298 (2001).
22. Semenza, G. L. & Wang, G. L. A nuclear factor induced by hypoxia via de novo protein
syntiKsis binds to the buman erythropoietia geae enbancet at a site required fot traascriptiond
activation. Mol Cell Bi01 12,5447-5454 ( 1 992).
23. Guyton, A. C. Texbook of medical physiology (WB Saunders, Philadelphia, 1 99 1).
24. Jiang, B. Hay Semenza, G. L., Bauer, C. & Md, H. H. Hypoxia-inducible factor 1 levels
Vary exponentially over a physiologically relevant range of 0 2 tension. Am J Physiol 271,
C 1 172- 1 180. (1 996).
25. Hadjantonakis, A. K., Gertsenstein, M., Ikawa, M., Okabe, M. & Nagy, A. Generating
green fluorescent mice by gennline transmission of green fluorescent ES cells. Mech Dev 76,799
90. (1998).
110 26. Matise, M. P., Auerbach, W., and Joyner, A.L. in Gene targeting: a pructical approach
(ed. Joyner, A. L.) 10 1 - 132 (Oxford University Press, Oxford, 2000). --" - .+A-. - & -.. -
27. Deschamps, J., Van Den M e r , Esy Forlani, S., De Graaff, W., Oosterveen, T., Roelen,
B., and Roelfsema, S. Initiation, establishment, and maintenance of Hox gene expression paiterns
in the mouse. Int. J. Dm. Biol. 43,635-650. (1999).
28. Castelli-Gair, J. Implications of the spatial and temporal regulation of Hox genes on
development and evolution. h t . J. Dev. Biol. 42,43744. ( 1 998).
C W T E R 3
FUTURE DIRECTIONS
112
1. Summary -
ASpart oftoe work to Senti@ aieas ofredücedoxygen in a developing embryo, a transgene
was constnicted juxtaposing a hypoxia responsive element upstream of a minimal Hsp LacZ
transgene. Transient transfection assays of this constnict in RI ES cells showed no evidence of
&galactosidase induction, prompting a detailed examination of HRE behavior in viîro, as part of
the effort to develop a HRE based transgene suitable for the production of transgenic mice. A
survey of the literatrw showed that several minimal HRE sequences had been characterized, but
variations in transgene context and the choice of ce11 line prevented direct comparisons. To
better examine the question of HRE activity a series of matched transgenes were constnicted and
tested, allowing the examination of element behavior in a constant context. interestingly, it was
found tbat minimal elements have significantly different activities under constant conditions of
transgene context, ce11 type, and incubation conditions. Furthermore, the minimal HRE is not
always sufficient to drive promoter activity, even in cells that are capable of using the HRE in a
different transgenic context. Work presented here also shows that the choice of cell line also
affects the activity of an HRE based transgene. Finally, preliminary evidence suggests that at
least two of the HRE transgenes described here are active under the physiologically relevant
m g e of oxygen concentrations (1-10%) detennined for several tissues in vivo.
II. Future Directions
., - The work described here opens up several possible avenues of experimentation, of which
three will be discussed bere. Of these areas, two: the production of oxygen responsive transgenic
mice tbrough the optimizatioa of an HRE transgene, and the identification of areas of low
oxygen in a developing embryo, are as interesting and relevant as they were at the begiming of
this work. The third ana, the analysis of HRE structure and function, diverges fkom the rationale
underlying this investigation, but is no less relevant as an area of study arising fiom this work.
The funw directions discussed here are presented as the questions that could be addressed given
the work described in this thesis. This section is not intended to descnbe a contiguous group of
experiments that could lead to fùrther publications.
1. An examination of HRE structure and b c t i o n
While the major focus of this project has been to identim areas of low oxygen in a developing
embryo relative to the areas of vascular development and VEGF expression, the work described
here centers around the approach chosen: the development of a hypoxia responsive transgene to
be used in making transgenic mice. Several fhdings, especially the observation that HRE
elements confer different activities in a cornmon background of ce11 line and transgene context,
have raised new questions on HRE structure and function. in the literature, a minimal HRE has
typically been defined as the smallest sequence required to confer oxygen responsiveness to an
exogenous transgene; in practice the HRE is typically cornprised of a HIF- 1 consensus binding
site, and a small amount of flanking sequence 1-3. Recent papers have described the existence of
an additional element, and hypothesized that the formation of an HRE seconday stnicture might
be necessary for oxygen dependent binding activity 3 y 4 . It is clear that there is much more work
that needs to be done to dissect the function of the HRE, and the role that it plays in the hypoxic
activation of gene expression. Such work is relevant to both the tumour pathologist, and the
developmental biologist, as a mounting body of literature demonstrates the importance of
hypoxia-stimulated gene expression in physiologie and pathologic growth 5-8.
ûne of the most interesting hdings of this work has been the observation that elements from
different transgenes $ive different activities under conditions of low oxygen. Given the different
minimal elements that have been identifie4 it could k interesting to expand the study to hclude
114 additional elements, simply by constructing new HRE SV40 or TK based transgenes. How
consistent are the differences between the elements? Are there any conelations that cm be made - - - -
between element sequence/stnicture and activity? The hypothesis made by Kimura et al., that
secondary structures fonned at the HRE are important for the mediation of hypoxic response, is a
reasonable starting point to m e r examine the function of these elements 4. Does the strength
of an element correlate with its predicted ability to fom a secondary structure? If changes are
made to an element that are predicted to enhance or interfere with the putative secondary
structure, does one observe corresponding changes in the strengtb of the element? To begin
testing this idea, a non-denaturing gel could be used to test the propensity of an element to fonn
a secondary structure in vitro. Were this hypothesis correct, one might expect to see a stronger
element, like that of the mouse PGK gene migrate abnomally compared to scrambled sequences,
a mutated element, or a weaker element of the same length. Along similar lines, one could
produce mutated HREs predicted to enhance the putative secondary structure in a weak element,
or hinder the secondary structure in a strong HRE. These elements could then be placed in the
context of an exogenous transgene to look for differences in hypoxia-responsive activity, in
assays similar to those perfonned here. While these types of experiments look at the elements
outside of their natural context, they would be useful to dissect the sources of element
differences, and may even be useful to define an "optimal" HIE.
2. The optimization and implementation of an HRE based transgene
As discussed previously, a mouse expressing a hypoxia-responsive marker could be a
valuable tool for identifjmg areas of reduced oxygen concentration during both embryonic and
pathologie devetopment. Certahly the data obtained over the course of this work have shown
that it is possible to produce a transgene that produces alterations in activity when cells are
exposed to reduced levels of oxygen. Furthemore, preliminary data on the effect of oxygen
concentration on transgene activity suggest that an HRE based transgene has activity at oxygen
concentrations that are encountered in vivo. Finally, it has been shown that it is possible to
observe oxygen-concentration dependent reporter expression in R1 ES cells. Taken together,
these &ta suggest that an HRE based construct could be used to obtain stable lines of RI ES
cells carrying an HRE-based hypoxia nsponsive transgene.
115 Of the transgenes described here, the PGK TK Luciferase would appear to be the best
candidate -- to produce stable ES ce11 h e s , as it reproducibly gives quantifiable induction under
low oxygen conditions. While the Luciferase reporter gene is not frequently used in the
production of transgenic rnice, detection systems have recently been developed to allow the
imaging of living mice, while the detection of the Luciferase mRNA or protein could
theoretically be perfomed using immunohistochemistry or in situ hybridization 9 . It is not
known how the sensitivity of the Luciferase reporter compares with that of the more commonly
used fbgalactosidase or GFP transgenes in vivo; the availability of sensitive chernical assay that
can be used in screening ce11 Iines, coupled with the fact that the transgene is already consûucted
suggest that it is worth trying. Prior to the preparation of stable PGK TK Luciferase ce11 lines, it
would be important to prepare and test a matched construct containing a fom of the PGIC HRE
mutated in the HIF-1 binding site. One would expect that constructs containing a mutated
element would not have an increase in activity in cells exposed to reduced oxygen concentration,
since the HIF-1 transcription factor should not be able to bind to the HRE. Quantifiable
induction of the mutant PGK Luciferase would require m e r study of PGK HRE transgene
activation; if the mutant PGK element gave no induction under hypoxia, stable lines of ES cells
could be created using the wild-type and mutant TK Luciferase constructs.
One concem when generating stable lines of transgenic Rl ES cells is the possibility of
transgene integration into, or near the regdatory elements of an unrelated gene. Were such lines
to be used to produce transgenic mice, one would expect ectopic expression due to the site of
integration, in addition to, or even in lieu of the hypoxia-responsive expression conferred by the
transgene. Such an occurrence is fiindamental to gene trapping, but represents a complication in
observing hypoxia-specific transgene expression. in these cases, aithough Luciferase expression
would occur in hypoxic tissues, there would be no way of differentiating areas of low oxygen
fiom normoxic tissue that had Luciferase activity due to other transcriptional regulation. To
adâress this problem, two approaches could be taken. Firstly, the HRE-Luciferase constmct
could be flanked by insulating sequemes, such as that of the chick p-globin, or mammalian Alu
sequences 10911. Such a constmct has the advantage that it could be randomly integrated into
ES cells, or injected into blastocysts, allowing expression to be analyzed without creating
targeting vectors, and targeted cell-lines. However, such a method would allow no control of
copy number, nor of mutations generated by random iiitegration of the transgene. A second
116 approach, the targeted integration of the HRE Luciferase transgene into the HPRT locus would
allow -- better control over copy number A A and integration - site, and permit comparisons between
wild-type and mutant HRE mediated expression, while controllhg position efiects.
In either case, several expenments could be performed with lines of stable HRE TIC
Luciferase expressing cells. Although the transient expression assays have demonstrated PGK
TIC Luciferase hypoxic induction in undifferentiated ES cells, they tell nothing of the induction
in differentiated tissue. To address this question, stable lines of RI ES cells containing wild-type
or mutant HRE TK Luciferase, TK Luciferase, or no traasgene could allowed to differentiate
under different oxygen conditions. These embryoid bodies could then be assayed or hybridized
for Luciferase activity, allowing the examination of HRE TK Luciferase activity in many
different ce11 types exposed to nomoxic and hypoxic conditions.
If stable lines of HRE TIC Luciferase ES cells were made, and it was possible to obtain
gemline-expressing chimeras, it would be valuable to test the response of the transgene to
difierent oxygen concentrations. Transgenic embryos could be cultured under 1 %-6%, 10% or
20% oxygen and assayed, or hybridized for Luciferase expression. If the HRE could act on TK
Luciferase in al1 tissues, one would expect a generalized increase in Luciferase expression in
explants grown under artificially controlled hypoxic conditions. Furthemore, observations made
in explants grown under intermediate levels of hypoxia could provide some useful information as
to the sensitivity of the HRE TK Luciferase transgene.
The final, and perhaps most critical experiment tbat would have to be performed with HRE
TK Luciferase mice is (i detailed examination of the Luciferase expression pattern. Here, stage-
matched embryos from multiple lines would have to be compared to determine if a general
consensus pattern could be obtained. If multiple HRE TK Luciferase transgenes containing
different eiements were available, they would also have to be compared in tbis way; certainly
lines containing wild-type and mutant PGK TK Luciferase would have to be compared to
detemine regions of PGK-specific background expression. Most importantly, if a set of mice
were obtained with a consensus expression pattern produced between different lines, this
expression pattern would have to be compared with that produced by chernical markers of
hypoxia. Only then could HRE Luciferase transgenic mice be considered to be a usefûl marker
for hypoxia.
3. Identification - - of areas of hypoxia during normal embryonic development
While the development of a hypoxia-responsive transgenic mouse was an attractive approach
to examine areas of hypoxia in the developing embryo, work described in this thesis has s h o w
that it is a challenging rnethod, which will require m e r work to detexmine its feasibility. Over
the past decade tumour biologists have developed new approaches to assess the oxygen
concentration in tumour tissue. Among the most promising of these are the chemical markers
EF5 and pimonidazole 12. Like many of the nitroirnidazole based compounds, pimonidazole cm
be injected into a host and form adducts on macromolecules in cells exposed to conditions of low
oxygen. Comparisons of pimonidazole binding to other methods of oxygen concentration
determination show that very little pimonidazole binding cm be observed from 30 mmHg (3.9%)
to 10 mmHg (1.3%), but adduct formation increases exponentially when the oxygen
concentration is lower than 10 mmHg (1.3%) 1 3 ~ 1 ~ . Recently, two groups have published data
in which nitroimidazole-based compounds have been used to detect embryonic hypoxia in
developing rat and mouse embryos 15.16. Preliminary results show that hypoxic areas exist in
the neural tube, and neuronal mesenchyme, yolk sac, allantois, EPC, and extraembryonic
endodem of day 8.5-9.0 embryos. Examination of later staged embryos (9.5- 12.5) showed that
the neural tube, and head mesenchyme continued to have areas of hypoxia, in addition to the
intersomitic mesenchyme. By late stages of vascular development, many organs showed
hypoxic immunoreactivity, including the heart, liver, kidney, and gastrointestinal tract. 16. As
might be expected, HIFla and VEGF expression CO-localized with areas of hypoxia.
Further studies of embryonic hypoxia could prove to be most interesting, particularly an
extension of the study to include earlier stages. At what time is hypoxia first seen in the
embryo? Several possible experiments could be performed using the chemical marken of
hypoxia to obtain a better understanding of the areas of low oxygen in a developing embryo, as
well as to test if there is an effect of oxygen concentration on embryonic development. It would
be interesting to repeat the experiments of Lee et al. focussing on earlier stages in embryonic
development. Lee et al. remark that the yok sac appears to be hypoxic through much of its life
16. Are hypoxic areas present at the time of blood island formation? In earlier stages of
embryonic development, especiaily those pre-implantation, the embryo is thought to obtain much
118 of its oxygen nom diffusion. Are the embryos chemically hypoxic? These questions are
-especially relevant in the light of cent -work @at suggests that stem ce11 renewal is favored in
cells grown under reduced oxygea concentration, witb a bias toward differentiation pathways in
cells grown under increased, or "standard" (20%) oxygen concentrations 17.
A second set of experiments that could be performed in parallel would be to detennine if
there is a correlation between the concentration of oxygen in a developing embryo and the
number and extent of blood vessels that are formed. At this time there is a large (and growing)
set of data to suggest that oxygen concentration could be a regulator of vascular development. A
s w e y of the literature shows that oxygen concentration affects the expression of VEGF in a
large number of different ce11 lines. Additionally, there are papers that describe vascular
anomalies in embryos camed by mothers exposed to low oxygen, and two studies in which
pieces of embryonic heart and kidney were cultured under conditions of low oxygen 18-23. To
determine if there is an effect of oxygen on vascular development it would be useful to dissect
and culture matched pairs of embryos under different oxygen cwditions, and examine the
number and extent of vessels formed. Are there any significant differences in the vasculature in
explants grown at 1%, 6%, or 20% oxygen? It might also be interesting to examine the
production of blood islands in embryo culture. 1s there an effect of oxygen concentration on the
formation of blood islands in cultured embryos? Given that evidence exists that there are areas
of reduced oxygen concentration in an embryo, and that there are a number of pieces of data to
suggest that oxygen concentration has an effect on vascular development, these experiments
would be a step towards determining if oxygen c m have a d e in vascular developrnent. Should
there be a significant effect observed, fûrther work could be performed to dissect the source of
the effect.
Instead of assessing the areas of, and postulated effects of oxygen in embryonic development,
a third experirnent that could be perfonned is to use the pimonidazole reagent to dissect some of
the phenotypes observed in embryos mutated in genes important in vascular development. In the
papers characterizhg the knockout phenotype of several genes, the authors descnbe an intact,
and "normal" primary plexus, followed by '%ascular remodeling defects", and often embryonic
lethality 24,25. While many angiogenic mutants appear to have a normal primary capillary
plexi, it is not known if the vasculature hctions nonnally. The use of pimonidazole could be
119 one method of observing if there are defects in the function of the vasculature prior to the
--A - observed defects L - in vascular architecture; - % if such defects existed, one might expect an increase in
the level of pimonidazole activity relative to that of a stage matched, wild-type embryo due to
abnormal circulation and oxygen delivery. This would be a risky course of research, as it is
entirely possible that no sucb functional abnormalities exist, or even that variations between
pimonidazole binding in different individuals would make it impossible to Say with certainty if
there were a difference, but it is one idea that could be attempted using available technology to
dissect the formation of the vasculature during development.
III. Final Comments
--, ---a---- -- A -- - -
Over the course of this work, several interesting findkgs have raised questions on the
mechanisms of hypoxic regulation. In this thesis is presented the fmt data showing tbat minimal
hypoxia response elements coder significantly different inductions under standard conditions of
transgene context, incubation time/oxygen concentration, and ce11 line. Furthemore, work
presented in this thesis have demonsûated differences in HRE activity on the SV40, TK, and
Hsp68 promoters; these data show that a minimal element, containing a HIF-1 binding site, is not
always sufficient to confer hypoxia responsiveness on an exogenous promoter. Furthemore,
significant differences were found in both the pmsence and the extent of hypoxic induction
conferred by a transgene in HeLa, and R1 ES ce11 lines. Finally, preliminary data has been
assembled to demonstrate that two HRE Luciferase transgenes have activity under
physiologically relevant oxygen concentrations. Data presented in this thesis has provided new
and interesting information on the hypoxic response, which can only help in the mderstanding of
the genetic control of vascular development and differentiation.
121 IV. References
1. Semenza, G. L. Regulation of mammalian 0 2 homeostasis by hypoxia-inducible factor 1.
Annu Rev Cell Dev Bi01 15,55 1-578 (1 999).
2. Liu, Y., Cox, S. Rey Morita, T. & Kourembanas, S. Hypoxia regulates vascular
endothelial growth factor gene expression in endothelial cells. Identification of a 5' enhancer.
Circ Res 77,638-643 (1995).
3. Forsythe, J'. A. et al. Activation of vascular endothelial growth factor gene transcription
by hypoxia-inducible factor 1. Mol Cell Biol16,4604-46 1 3 ( 1 996).
4. Kimura, H. et al. Identification of Hypoxia-Inducible Factor4 (HIF-1) Ancillary
Sequence and Its Function in Vascular Endothelial Growth Factor Gene Induction by Hypoxia
and Nitric Oxide. J Biol Chent 276,2292-2298 (200 1 ) .
5. Carmeliet, P. et al. Role of HIF-lalpha in hypoxia-mediated apoptosis, ce11 proliferation
and tumour angiogenesis [published erratum appears in Nature 1998 Oct 1;395(6701):525].
Nature 394,485490 (1998).
6. Blancher, C. & Harris, A. L. The molecular basis of the hypoxia response pathway:
tumour hypoxia as a therapy target. Cancer Metastusis R a t 17, 1 87- 194 (1 998).
7. Maxwell, P. H. et al. The tumour suppressor protein MIL targets hypoxia-inducible
factors for oxygen-dependent proteolysis. Nature 399,27 1-275 (1999).
8. Holash, J., Wiegand, S. J. & Yancopoulos, G. D. New mode1 of tumor angiogenesis:
dynamic balance between vesse1 regression and growth mediated by angiopoietins and VEGF.
Oncogene 18,5356-5362 (1999).
9. Hasan, M. T., Schonig, K., Berger, S., Graewe, W. & Bujard, H. Long-terni, noninvasive
imaging of ngulated gene expression in living mice. Genesis W. 1 16- 122. (200 1).
10. Chung, J. H a y Bell, A. C. & Felsenfeld, G. Characterization of the chicken beta-globin
insulator. Proc Nat1 Acad Sci U S A 94,5750580 (1997).
1 1. Willoughby, D. A., Vilalta, A. & Oshima, R. G. An Alu element from the KI 8 gene
confers position-independent expression in transgenic mice. J Bi01 Chem 275,759-768 (2000).
12. Raleigh, J. A., Dewhirst, M. W. & Thrall, D. E. Measuring Tumor Hypoxia. Semin
Radiai Oncol 6,374 (1 996).
13. Raleigh, J. A., Chou, S. C., Arteel, G. E. & Horsman, M. R. Comparisons among
pimonidazole binding, oxygen electrode measurements, and radiation response in C3H mouse
tumors. Radiat Res 151,580-589. (1999).
122 14. Gross, M. W., Karbach, W., Groebe, K., Franko, A. J. & Mueller-Klieser, W. Calibration
of -m~so-@&tole label& by s@-@taymus mequement of oxygea tension and labeling density in
multicelluiar spheroids. Int J Cancer 61,567-573. (1995).
1 5 Chen, E. Y., Fujinaga, M. & Giaccia, A. J. Hypoxic microenvironment within an embryo
induces apoptosis and is essential for proper morpbological development. Teratology 60, 2 15-
225 (1999).
16. Lee, Y. M. et al. Determination of hypoxic region by hypoxia marker in developing
mouse embryos in vivo: A possible signal for vesse1 development. Dev Dyn 220, 175-186.
(2001).
1 7. Csete, M. in Great Lakes M m a l i a n Development Meeting (Toronto, 200 1).
18. Tufio, A. VEGF spatially directs angiogenesis during metanephnc development in vitro.
Dev Bi01 227,5580566 (2000).
19. Grabowski, C. T. & Paar, J. A. The tenitogenic effects of graded doses of hypoxia on the
chick embryo. Arnerican Journal o/Anatomy 103,3 13-347 (1958).
20. Ingalls, T. H., Curley, F. J. & Prindle, R. A. Anoxia as a cause of fetal death and
congenital defect in the mouse. Am. J. Dis. C M 80.34-45 (1950).
21. Ingalls, T. H., Tedeschi, C. G. & Helpem, M. M. Congenital malformations of the eye
induced in mice by materna1 anoxia. Am. J. Ophth. 35, 3 1 1-329 (1952).
22. Tedeschi, C. D., Ingalls, T.H. Vascular anomalies of mouse fetuses exposed to anoxia
during pregnancy. Am. J. Obstet. Gynecof. 71,1628 (1 956).
23. Stone, J. et al. Development of retinal vasculature is mediated by hypoxia-induced
vascular endothelial growth factor (VEGF) expression by neuroglia. J Neurosci 15,4738-4747.
(1995).
24. Xue, Y. et al. Embryonic laliality and va~cular defects in mice lacking the Notch ligand
Jaggedl. Hum Mol Genet 8,723-730 (1999).
25. Adams, R. H. et al. Roles of ephrinB ligands and EphB receptors in cardiovascular
development: demarcation of arteriavvenous domains, vascular morphogenesis, and sprouting
angiogenesis. Genes Dev 13,295-306 (1 999).