Conservation Of The Sos Salt Tolerance Pathway In Rice

Martínez-Atienza et al. Rice SOS1

- 1 -

RUNNING HEAD:

The rice SOS pathway for salt tolerance.

CORRESPONDING AUTHOR:

José M. Pardo

Instituto de Recursos Naturales y Agrobiología.

Consejo Superior de Investigaciones Científicas.

Reina Mercedes, 10. Sevilla-41012. Spain.

Phone: (34) 954 62 47 11

FAX: (34) 954 62 40 02

e-mail: [email protected]

JOURNAL RESEARCH AREA: Environmental Stress and Adaptation

Plant Physiology Preview. Published on December 8, 2006, as DOI:10.1104/pp.106.092635

Copyright 2006 by the American Society of Plant Biologists

www.plantphysiol.orgon February 10, 2018 - Published by Downloaded from Copyright © 2006 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org


- 2 -

CONSERVATION OF THE SOS SALT TOLERANCE PATHWAY IN RICE

Juliana Martínez-Atienza 1, Xingyu Jiang 1, Blanca Garciadeblas 2, Imelda Mendoza 1,

Jian-Kang Zhu 3, José M. Pardo 1*, and Francisco J. Quintero 1

(1) Instituto de Recursos Naturales y Agrobiología. Consejo Superior de Investigaciones

Científicas. Reina Mercedes, 10. Sevilla-41012. Spain.

(2) Departamento de Biotecnología, Escuela Técnica Superior de Ingenieros Agrónomos.

Universidad Politécnica de Madrid. Madrid-28040. Spain.

(3) Department of Botany and Plant Sciences. Institute of Integrative Genome Biology. 2150

Batchelor Hall. University of California. Riverside, CA 92521.




- 3 -

FOOTNOTES

This work was supported by grants BIO2003-08501-CO2-01 from ‘Ministerio de Educación y

Ciencia’, CPE03-006-C6-3 from INIA, and CVI-148 from ‘Junta de Andalucía’ to F.J. Quintero

and J.M. Pardo, and by NIH grant R01GM59138 to J.K. Zhu. J. M.-A. was supported by a FPU

fellowship from the ‘Ministerio de Educación y Ciencia’.

* Corresponding author; e-mail [email protected]; fax (34) 954624002




- 4 -

ABSTRACT

The salt tolerance of rice (Oryza sativa) correlates with the ability to exclude Na+ from the shoot

and to maintain a low cellular Na+/K+ ratio. We have identified a rice plasma membrane Na+/H+

exchanger that, on the basis of genetic and biochemical criteria, is the functional homologue of

the Arabidopsis thaliana SOS1 protein. The rice transporter, denoted by OsSOS1,

demonstrated a capacity for Na+/H+ exchange in plasma membrane vesicles of yeast cells and

reduced their net cellular Na+ content. The Arabidopsis protein kinase complex SOS2/SOS3,

which positively controls the activity of AtSOS1, phosphorylated OsSOS1 and stimulated its

activity in vivo and in vitro. Moreover, OsSOS1 suppressed the salt sensitivity of a sos1-1

mutant of Arabidopsis. These results represent the first molecular and biochemical

characterization of a Na+ efflux protein from monocots. Putative rice homologues of the

Arabidopsis protein kinase SOS2 and its Ca2+-dependent activator SOS3 were identified also.

OsCIPK24 and OsCBL4 acted coordinately to activate OsSOS1 in yeast cells, and they could

be exchanged with their Arabidopsis counterpart to form heterologous protein kinase modules

that activated both OsSOS1 and AtSOS1 and that suppressed the salt sensitivity of sos2 and

sos3 mutants of Arabidopsis. These results demonstrate that the SOS salt tolerance pathway

operates in cereals and evidence a high degree of structural conservation among the SOS

proteins from dicots and monocots.




- 5 -

INTRODUCTION

Rice is one of the most important cereal crops in tropical and temperate regions of the world.

Among all common environmental stresses, salinity is a major factor decreasing the yield in rice

cultivation in coastal areas and in irrigated farmlands. Problems associated with salinity are

water deficit imposed by the greater osmolarity of the soil solution and the cellular damage

inflicted by excessive ion accumulation in plant tissues. Comparison of rice subspecies and

varieties differing in tolerance to salinity has shown that greater tolerance correlates with the

ability to exclude Na+ from the shoot and maintain a low Na+/K+ ratio (Golldack et al., 2003; Lee

et al., 2003; Ren et al., 2005). For instance, the salt-sensitive variety IR29 accumulated Na+ in

leaves at 5- to 10-fold greater concentrations than the salt-tolerant lines BK or Pokkali (Golldack

et al., 2003). In contrast, shoot K+ concentration per se showed no relation to salinity tolerance

in japonica spp and only weak correlation in indica spp varieties (Lee et al., 2003; Golldack et

al., 2003). Since steady accumulation of Na+ is what injures the cells of leaves at moderate

salinity levels (Flowers et al., 1991; Munns, 1993), restricting the translocation of Na+ is a

mechanism for salt tolerance that plays a major role in rice (Lee et al, 2003; Ren et al., 2005).

The gene SCK1/HKT8, responsible for a major quantitative trait locus (QTL) imparting a high

K+/Na+ balance in shoots and salt tolerance, encodes an Na+-selective transporter of the HKT

family that regulates long distance transport of Na+ (Ren et al., 2005). SCK1/HKT8 participate in

re-absorption of Na+ at the xylem parenchyma, thereby restricting the build up of toxic

concentrations of Na+ in the photosynthetic tissues (Ren et al., 2005). The related rice gene

HKT1 is preferentially expressed in root xylem parenchyma and in cells adjacent to phloem

vessels in leaves, suggesting that it could also be involved in the regulation of long-distance

transport of Na+ (Golldack et al., 2002). The mechanism by which rice roots take up Na+ is

uncertain. Anatomical discontinuities in the root endodermis may lead to uncontrolled apoplastic

bypass-flow of ions and their subsequent discharge into the vascular bundle (Yeo et al., 1987;

Yadav et al., 1996). In this process, ion transporters would play a minor role or none at all, and

the natural variability of salt tolerance among cultivars would be determined by genes

controlling developmental traits (Koyama et al., 2001). However, the kinetics of Na+ uptake by

rice roots is consistent with enzymatic processes driven by ion transporters (Garciadeblas et al.,

2003). Although the molecular identities of these transporters remain to be established, the

kinetic properties of OsHKT1 in heterologous systems recapitulate those of whole roots

(Garciadeblas et al., 2003). In wheat, TaHKT1 is primarily expressed in the root cortex and

down-regulation of TaHKT1 by RNAi reduced Na+ uptake and enhanced salt tolerance,

indicating that TaHKT1 mediated Na+ uptake (Laurie et al., 2002).

Sodium extrusion at the root/soil interface, as well as some level of Na+ efflux in every other cell

type to achieve ion homeostasis, is presumed to be of critical importance for the salt tolerance

of glycophytes (Tester and Davenport, 2003). Indeed, efficient efflux of Na+ to the soil solution

must function in the roots of several species to minimize net uptake since unidirectional influx of




- 6 -

Na+ is rapid and greatly exceeds the rate of accumulation (Tester and Davenport, 2003). In

wheat roots, high rates of Na+ efflux were inferred because net uptake was very low relative to

unidirectional influx (Davenport et al., 2005). The Na+/H+ antiporter SOS1 is the only Na+ efflux

protein at the plasma membrane of plants characterized so far. Mutants of Arabidopsis thaliana

lacking SOS1 are extremely salt sensitive and have combined defects in Na+ extrusion and in

the long-distance transport of this ion from root to shoot (Qiu et al., 2002; Shi et al., 2002).

SOS1 is primarily expressed at the root tip epidermis and in xylem parenchyma at the

xylem/symplast boundary throughout the plant (Shi et al., 2002). At the root/soil interface, SOS1

would act extruding the excess of Na+ ions from root epidermal cells. In addition, the analysis of

the Na+ root/shoot partition in the sos1 mutant under different saline regimes indicated that

SOS1 also participated in the redistribution of Na+ between roots and shoot in a complex

manner (Shi et al. 2002). Under moderate saline stress (25 mM NaCl) sos1 mutant plants

accumulated less Na+ in their aerial parts than the wild-type, indicating that SOS1 functions in

loading Na+ into the xylem for controlled delivery to the shoot. By contrast, at high salinity (100

mM NaCl), the roots and aerial parts of sos1 mutant plants accumulated more Na+ than wild-

type plants, which could be caused by the breakdown of Na+ exclusion at the root epidermis and

to the large electrochemical gradient of Na+ across the xylem/symplast boundary (Pardo et al.,

2006; Shi et al. 2002). In addition, it has been suggested that under severe salinity stress the

difference of Na+ concentration between the xylem sap and xylem parenchyma cells could be of

greater magnitude than the corresponding pH gradient, which would result in reversal of SOS1

activity (assuming an electroneutral exchange) and retrieval of Na+ from the xylem (Shi et al.,

2002; Tester and Davenport 2003). The activity of the SOS1 exchanger is regulated through

protein phosphorylation by the SOS2/SOS3 kinase complex (Quintero et al. 2002; Qiu et al.,

2002). SOS2 is a serine/threonine protein kinase belonging to the SnRK3 family (Gong et al.

2004; Kolukisaoglu et al. 2004). SOS3 is a myristoylated Ca2+ sensor belonging to the

recoverin-like family of SCaBPs/CBLs (Gong et al. 2004; Kolukisaoglu et al. 2004). Upon Ca2+

binding, SOS3 undergoes dimerization and enhances the protein kinase activity of SOS2 (Guo

et al. 2001; Sánchez-Barrena et al. 2005). Besides activating SOS2, SOS3 was also shown to

recruit SOS2 to the plasma membrane to achieve efficient interaction with SOS1 (Quintero et al.

2002). Mutant plants deficient in either SOS2 or SOS3 share the salt-sensitive phenotype of

sos1 plants (Zhu, 2000).

We have begun to characterize Na+ efflux proteins of rice by isolating a SOS1 homologue,

which is encoded by a single copy gene. We show that OsSOS1 functions as a plasma

membrane Na+/H+ antiporter in yeast cells and that, like its Arabidopsis counterpart, it is

phosphorylated and activated by the SOS2/SOS3 protein kinase complex. Ectopic expression

of OsSOS1 suppressed the growth defects of an Arabidopsis sos1 mutant line. We have also

identified the homologues of AtSOS2 and AtSOS3 (OsCIPK24 and OsCBL4, respectively)

which coordinately regulate the activity of OsSOS1. These results show that the SOS pathway

for salt tolerance operates in cereals.




- 7 -

RESULTS

Cloning of OsSOS1 and sequence analyses.

A homology-based computer search identified a rice 290-bp EST clone (Oryza sativa subsp.

japonica cv Nipponbare; Accession C71771) encoding a putative homologue of the Arabidopsis

thaliana Na+/H+ antiporter SOS1. The EST clone was obtained from the MAFF DNA Bank

(Japan) and the entire cDNA insert was sequenced. Sequence comparison with the Arabidopsis

SOS1 protein indicated that the rice EST clone encoded a full-length SOS1 homologue,

although the ORF was presumably interrupted by 2 unspliced introns. These conclusions were

supported by sequence comparisons that were extended to include additional SOS1

homologues from other plant species. Sequences of SOS1 homologues from the moss

Physcomitrella patens and the seagrass Cymodocea nodosa are available from public

databases (Accessions CAD91921 and CAD20320, respectively). Sequences from the

Arabidopsis relative Thellungiella halophila and from the facultative halophyte

Mesembryanthemum crystallinum were kindly provided by Valery Poroyko and Hans Bohnert

(University of Illinois). Multiple sequence alignments of these polypeptides (data not shown)

indicated a high degree of amino acid sequence co-linearity among SOS1 homologues and

evidenced the presence of 2 intervening nucleotide sequences of 805 and 160 bp in the rice

EST clone at positions +750 and +970, respectively (numbering relative to the ATG codon in the

spliced rice cDNA). That these intervening sequences were in fact unprocessed introns was

confirmed by the analysis of the rice genome sequence at the corresponding locus. To obtain a

fully spliced cDNA that could be used for functional studies, RT-PCR amplification was

performed with rice RNA as template and oligonucleotides that primed the amplification of a

fragment spanning the region that contained the 2 unprocessed introns in the EST clone. The

amplified fragment was sequenced to confirm the removal of all introns and the fidelity of the

polymerase and was subsequently subcloned into the EST clone replacing the unspliced portion

of the cDNA. In this way, a full-length cDNA was created that encoded a 1148 amino acid

protein with 57.5% similarity to the Arabidopsis SOS1 transporter (Supplemental Figure 1). A

search of the available rice genomic sequences (ssp. indica and japonica) indicated that the

isolated OsSOS1 cDNA corresponded to locus Os12g44360 on chromosome XII (25285 -

35082 bp), with no additional sequences of significant similarity. Therefore, SOS1 is a single

copy gene in rice.

The sodium transport activity of OsSOS1 is stimulated by the Arabidopsis SOS2/SOS3

kinase complex

Cells of the Saccharomyces cerevisiae strain AXT3K (∆ena1-4 ∆nha1 ∆nhx1) lack all major

sodium transporters essential for the sodium tolerance of yeast and thus are incapable of




- 8 -

growing in AP medium with Na+ concentrations higher than 70 mM (in 1 mM K+) (Quintero et al.,

2002). The P-type pumps ENA1-ENA4 and the (Na+,K+)/H+ antiporter NHA1 localize to the

plasma membrane and both mediate Na+ efflux (Wieland et al., 1995; Bañuelos et al., 1998),

whereas the Na+/H+ antiporter NHX1 drives Na+ sequestration into endosomal compartments

(Darley et al., 2000; Quintero et al., 2000). When OsSOS1 was expressed in AXT3K cells from

a multicopy vector (pDR195), halotolerance was partially recovered and cells could grow in AP

medium containing up to 100 mM sodium (1 mM K+) (Figure 1A).

The Arabidopsis AtSOS1 transporter has been shown to be phosphorylated and activated by

the SOS2/SOS3 protein kinase complex (Qiu et al., 2002; Quintero et al., 2002). SOS2 is a

Ser/Thr protein kinase whose activity and subcellular localization are dependent on the

interaction with the calcium sensor protein SOS3 (Halfter et al., 2000; Quintero et al., 2002). To

test whether the rice homologue OsSOS1 could also be activated by the Arabidopsis

SOS2/SOS3 kinase complex, A. thaliana SOS2 and SOS3 proteins were co-expressed in

AXT3K yeast along with OsSOS1, and the effect of these combinations on the halotolerance of

transformants was determined. As shown in Figure 1A, the concurrent expression of the three

SOS proteins greatly increased the salt tolerance of the transformed cells and afforded growth

in media with up to 400 mM sodium, which is near the maximal salt concentration tolerated by

wild-type yeast cells in AP medium (data not shown). This enhanced tolerance was observed

only when OsSOS1 was present, negating that SOS2 and SOS3 were unmasking an

endogenous yeast activity. AtSOS2 alone in the presence of OsSOS1 was capable of

enhancing the salt tolerance of yeast to an intermediate level lower than that under co-

expression of the three SOS proteins but still considerably higher than that with OsSOS1 alone.

Presumably, this enhanced salt tolerance resulted from the basal activity of SOS2 in the

absence of SOS3.

To determine how OsSOS1 conferred greater Na+ tolerance to yeast, we measured the Na+

content of cells expressing various combinations of SOS proteins. Cells expressing OsSOS1

alone and growing in AP with 30 mM NaCl (1 mM KCl) maintained their intracellular sodium

levels considerately lower than did control cells transformed with an empty vector (Figure 1B).

The intracellular Na+ content was minimal when the three SOS proteins were co-expressed, well

below that of cells expressing OsSOS1 alone or together with SOS2. Thus, the association

between the halotolerance and cytoplasmic sodium levels suggests that OsSOS1 functions as a

sodium efflux transporter in yeast and that its activity is greatly enhanced by the SOS2/SOS3

kinase complex. To directly demonstrate Na+/H+ antiporter activity of OsSOS1, plasma

membrane vesicles were purified by use of aqueous two-phase partitioning from yeast

expressing OsSOS1 with and without co-expression of the SOS2/SOS3 kinase complex. Cells

were grown on selective AP medium containing 1 mM KCl and transferred to the same medium

supplemented with 100 mM NaCl for 1 hour to ensure activation of the SOS2/SOS3 kinase

complex when present. The purity of vesicle preparations was tested by measuring ATP




- 9 -

hydrolysis in the presence of inhibitors of mitochondrial (azide), vacuolar (nitrate) and

plasmalemma (vanadate) ATPases. The relative sensitivity of total ATPase activity to these

inhibitors demonstrated that vesicle preparations were enriched in plasma membrane (data not

shown). Na+/H+ exchange was monitored by the quinacrine fluorescence quenching method. An

inside-acid proton gradient (∆pH) across vesicle membranes was established after the addition

of ATP (Figure 2A). Once ∆pH reached a steady state, the addition of sodium salts led to

fluorescence recovery (i.e. dissipation of the ∆pH, Figure 2A). Vesicles isolated from yeast cells

expressing OsSOS1 displayed Na+/H+ exchange activity that was greater than background

exchange in AXT3K recipient cells over 25-200 mM Na2SO4 (Figure 2B). Maximal Na+/H+

exchange activity, which was detectable at lower Na+ concentrations, was observed in cells co-

expressing OsSOS1 and the Arabidopsis SOS2/SOS3 kinase complex, as was expected from

activation of the rice Na+ transporter by the SOS2/SOS3 kinase. These differences in Na+/H+

exchange activity are in agreement with the relative tolerance to NaCl and intracellular Na+

content of these transformants (see Figure 2). To further ensure that ∆pH dissipation was due to

Na+/H+ exchange, transport assays were performed with sodium gluconate as a substrate.

Relative Na+/H+ exchange rates among vesicle preparations were commensurate at identical

Na+ concentrations independently of the salt used (Figure 2C). Since gluconate is an

impermeant anion, unlike sulfate, ∆pH dissipation was concluded to be specific for Na+.

Transport assays in the presence of K+ and valinomycin, to dissipate the electrical membrane

potential, produced similar results (data not shown), further indicating that Na+ did not move

electrophoretically and that the Na+/H+ exchange mediated by SOS1 was electroneutral. An

approximate Km of 29 mM for Na+ was estimated for activated OsSOS1 in the range of 6.5 –

100 mM Na+ after subtracting background transport in control vesicles from the AXT3K strain.

We have previously shown that the Arabidopsis SOS1 protein is a substrate for the

SOS2/SOS3 kinase complex (Quintero et al., 2002). Results depicted in Figures 1 and 2

indicate that the activity of the rice SOS1 transporter is also enhanced by the co-expression of

the Arabidopsis protein kinase. To confirm that OsSOS1 was phosphorylated by AtSOS2, C-

terminal histidine-tagged OsSOS1 and AtSOS2 were purified from yeast membranes by Ni2+-

binding chromatography (Figure 3A). Also a mutant form of SOS2 (SOS2T/D∆308) that is

hyperactive and independent of SOS3 in vitro (Guo et al., 2001) was purified as a translational

GST fusion (Figure 3A). As shown in Figure 3B, OsSOS1 was weakly phosphorylated by the

wild-type SOS2 (in the absence of SOS3) compared to the strong phosphorylation catalyzed by

the recombinant SOS2T/D∆308 kinase, thus demonstrating that the rice protein is recognized

as a legitimate substrate by the Arabidopsis protein kinase.

Complementation of Arabidopsis sos1 mutant

In Arabidopsis, AtSOS1 has been shown to fulfill two important roles pertaining to sodium

tolerance, namely the restriction of net Na+ uptake by roots and the control of xylem loading for




- 10 -

long-distance transport (Shi et al., 2002). To extend the functional comparisons between

OsSOS1 and AtSOS1 to whole plants, a full-length cDNA encoding the rice transporter was

transformed into the Arabidopsis mutant sos1-1, which bears a 14-bp gene deletion that

completely abrogates AtSOS1 activity (Shi et al., 2000; Qiu et al., 2002). Transgenic seedlings

(T1 generation) were selected on MS medium with kanamycin and then transferred to MS

supplemented with 50 mM NaCl to test genetic complementation (Figure 4). Ten out of 16

transgenic T1 seedlings tested continued growing in the presence of salt (Figure 4A) and were

successfully transferred to soil for further analyses. In all these 10 complemented lines,

expression of the OsSOS1 transgene was confirmed by RT-PCR with the use of rice-specific

primers, and the sos1-1 genetic background was verified by diagnostic PCR of the 14-bp

deletion that defines this mutant allele (data not shown) (Shi et al., 2000). Mutant sos1-1 plants

showed a moderate growth defect in MS plates, which was further exacerbated by the

imposition of moderate salinity stress (Figure 4B). Phenotypic suppression of the Arabidopsis

sos1-1 mutant by the rice SOS1 cDNA was partial because of the greater growth of congenic

lines transformed with the Arabidopsis SOS1 cDNA as compared with transgenic lines

expressing the rice protein, both in the absence and presence of NaCl (Figure 4B). These

results indicate that the rice SOS1 protein can substitute for the endogenous transporter of

Arabidopsis, albeit not completely.

OsSOS1 transcript levels in response to salt stress.

To learn whether the expression of OsSOS1 is modified under salt stress, a northern blot

membrane was prepared with total RNA purified from root and shoot of rice plants subjected to

100 mM NaCl salinity stress for 3, 15 and 48 h. Hybridization was performed with a probe

corresponding to the C-terminal part of OsSOS1, and radiometric signals were quantified by

densitometric scanning of autoradiograms. The relative signal intensities were normalized by re-

probing the blots with an 18S rRNA gene probe. Basal OsSOS1 expression levels were

detected in root and shoot of control, non-treated plants (Figure 5). After 3-h salt treatment,

roots showed a slow and transient increase in the level of OsSOS1 transcripts, which reached a

maximal 6-fold induction 15 h after the onset of salt stress (Figure 5). By contrast, the effect of

salt stress in shoots was the opposite. After 3-h salt treatment, the level of OsSOS1 transcripts

decreased, reaching a 5-fold reduction in mRNA abundance relative to basal levels in control

plants (Figure 5). This decrease was transient and the mRNA abundance slowly recovered, re-

establishing near-basal levels after 48 h of salt treatment. These results further suggest a

functional role of OsSOS1 in the response of rice plants to salt stress. The changes in mRNA

abundance in roots over the first day after transfer to salt were likely related to the osmotic

shock rather than to ionic stress, whereas the up-regulation in roots and leaves at later times

after turgor recovery (48 h) was the likely result of sodic stress.




- 11 -

Identification of a rice kinase complex that activates OsSOS1

Analysis of the rice genome allowed for the identification of up to 30 CIPK/PKS kinases

of the SnRK3 family and 10 CBL/SCaBP interacting calcium sensors (Kolukisaoglu et al., 2004).

On the basis of amino acid sequence comparisons, the rice proteins most similar to the

Arabidopsis SOS3 protein are OsCBL4 (Os05g45810), OsCBL7 (Os02g18880) and OsCBL8

(Os02g18930), with 66.2%, 67.1% and 66.7% identity to AtSOS3, respectively (Supplemental

Figure 2). Like AtSOS3, all three rice homologues are predicted to be N-myristoylated proteins,

a post-translational modification that is essential for SOS3 functionality (Ishitani et al., 2000).

The remaining OsCBL proteins show significantly low similarity scores (Hwang et al., 2005). All

CBL proteins contain 4 conserved EF-hand motifs for Ca2+ binding, separated by intervening

sequences of fixed length. Size and sequence variations among CBL proteins are therefore

restricted largely to N- and C-terminal extension from the conserved core (Kolukisaoglu et al.,

2004). Because the N-terminal part of AtSOS3 is more similar to that of OsCBL4 than OsCBL7

and OsCBL8 (Supplemental Figure 2) and OsCBL4 localizes to the plasma membrane as does

SOS3 (Hwang et al., 2005), a full-length cDNA of OsCBL4 was amplified by RT-PCR with total

mRNA isolated from O. sativa cv Nipponbare used as a template as described in Methods. To

test its putative functional identity with AtSOS3, OsCBL4 was cloned in plasmid pDR195 to

express the rice protein from the PMA1 gene promoter. The resulting plasmid, pDROsCBL4,

was transformed in the yeast strain YP890, expressing AtSOS1 from a chromosomal

integration, with or without AtSOS2 as the interacting protein kinase. As shown in Figure 6A,

OsCBL4 was competent for interaction with AtSOS2 and activation of AtSOS1, as expected if

OsCBL4 were a functional homologue of AtSOS3. Moreover, expression of OsCBL4

suppressed completely the salt sensitivity of the Arabidopsis mutant sos3-1 (Figure 7A, C). The

sos3-1 mutant bears a 9 bp deletion starting at position 759 from the translation start codon (Liu

and Zhu, 1998). Five sos3-1 lines (T2 plants) showing genetic complementation were further

analyzed, and all tested positive for expression of OsCBL4 on RT-PCR. They also tested

positive for the sos3-1 genetic background on diagnostic PCR for the signature 9-bp deletion

(results not shown). Together, these data indicate that OsCBL4 can functionally substitute for

AtSOS3.

The Arabidopsis protein kinase SOS2/CIPK24 is most similar to the uncharacterized rice

proteins OsCIPK24 (Os06g40370; 68.2% identity) and OsCIPK8 (protein accession BAD87720;

62% identity). Because OsCIPK8 is also more similar to Arabidopsis AtCIPK8 than to AtSOS2

(Kolukisaoglu et al., 2004), we focused our initial analysis on OsCIPK24. A full-length cDNA

was amplified by RT-PCR with total mRNA isolated from O. sativa cv Nipponbare used as a

template as described in Methods. Oligonucleotides for amplification were designed according

to the available sequence of a potential full-length cDNA sequence of OsCIPK24 (database

entry AK102270) coding for a putative 454-amino acid polypeptide. The cDNA was cloned in the

yeast vector p414GPD and transformed in the yeast strain YP890 (PGK1:AtSOS1:CYC1), with




- 12 -

and without the potentially interacting protein OsCBL4. Unexpectedly, OsCIPK24 failed to

activate AtSOS1 in the yeast system (results not shown). To test whether this failure was due to

the inability of OsCIPK24 to interact with OsCBL4 or to recognize AtSOS1 as a substrate, a

constitutive CBL-independent form of OsCIPK24 was produced by deletion of the conserved C-

terminal autoinhibitory domain present in SnRK3 kinases (Albrecht et al., 2001; Guo et al.,

2001). On the basis of the known localization of the autoinhibitory domain of AtSOS2 (Guo et

al., 2001), a C-terminal truncation of OsCIPK24 was produced by introducing a stop codon at

the leucine residue at position 315 (Supplemental Figure 3). The truncated protein was tested

for its ability to activate AtSOS1 or the rice protein OsSOS1, with negative results in both cases

(data not shown), which suggests that the OsCIPK24 was not a functional homologue of

AtSOS2 or that the protein being produced in yeast was not biologically active. Close inspection

of the predicted open reading frame of the cDNA amplified based on the EST database entry

AK102270 revealed that a conceptual translation starting at the downstream ATG codon

corresponding to methionine in position +7 predicted a shorter protein with greater similarity to

the amino terminal part of AtSOS2 than the one produced by the larger ORF present in the

OsCIPK24 cDNA amplified initially (Supplemental Figure 3). Hence, 7-amino acid shorter

versions of OsCIPK24, with or without the C-terminal deletion at the leucine residue at position

309 (numbering relative to the new start codon; denoted OsCIPK24∆309), were cloned in

plasmid p414GPD and tested in yeast cells. As depicted in Figure 6B, the constitutive protein

kinase OsCIPK24∆309 was able to activate AtSOS1 in the absence of OsCBL4, which

demonstrates that the polypeptide with the shortened N-terminal was biologically active.

Moreover, co-expression of the complete OsCIPK24 (i.e., starting at the second methionine but

with the intact C-terminal inhibitory domain) interacted productively with OsCBL4 to activate the

SOS1 exchangers from both Arabidopsis (AtSOS1) and rice (OsSOS1) but failed to fully

activate these exchangers in the absence of OsCBL4 (Figure 6C, D). Finally, the OsCIPK24

kinase (short N-terminal) was also able to suppress the salt sensitivity of an Arabidopsis sos2-2

mutant completely (Figure 7B, D). The sos2-2 allele contains a 2-bp deletion corresponding to

nucleotides 1521 and 1522 relative to the translational start codon of SOS2 (Liu et al. 2000). Six

transgenic lines (T2 plants) showing genetic complementation for salt tolerance tested positive

for expression of the OsCIPK24 transgene on RT-PCR and for the signature deletion of the

sos2-2 mutant allele on diagnostic PCR (results not shown). Together, these results strongly

suggest that OsCIPK24 is the functional rice homologue of the Arabidopsis SOS2. They also

show that the OsCIPK24/OsCBL4 complex form a functional module with OsSOS1 to achieve

sodium tolerance.

DISCUSSION

Our genetic and biochemical analyses show that a rice protein, OsSOS1, with significant

sequence similarity to the SOS1 sodium exchanger from A. thaliana, is also its functional

homologue. First, OsSOS1 suppressed the Na+ sensitivity of a yeast mutant lacking the major




- 13 -

Na+ efflux systems at the plasma membrane (the array of ENA1-ENA4 Na+ pumps and the

(Na+,K+)/H+ exchanger NHA1) by a mechanism that reduced the net cellular Na+ content (Figure

1). Furthermore, plasma membrane preparations from yeast transformants expressing OsSOS1

demonstrated greater capacity for Na+/H+ exchange (Figure 2). Second, the Arabidopsis protein

kinase complex SOS2/SOS3, which positively controls the activity of AtSOS1 (Qiu et al., 2002;

Quintero et al., 2002), also stimulated the activity of OsSOS1, both in vivo (Figure 1) and in

plasma membrane vesicles (Figure 2B and C), and OsSOS1 was recognized as a genuine

phosphorylation substrate by AtSOS2 (Figure 3B). Third, OsSOS1 suppressed the growth

defect, both in the absence and presence of salt, of a sos1-1 mutant of A. thaliana (Figure 4).

Taken together, these results demonstrate that OsSOS1 is a functional homologue of AtSOS1,

and they represent the first molecular and biochemical characterization of a Na+ efflux protein

from monocots. Rice OsSOS1 catalyzed Na+/H+ exchange in plasma membrane vesicles

derived from the yeast strain AXT3K in which genes encoding the Na+ efflux proteins ENA1-

ENA4 and NHA1 had been deleted. Although these proteins account for most of the Na+ efflux

in yeast plasma membranes and the cellular tolerance to Na+ (Bañuelos et al., 1998), some

capacity for Na+/H+ exchange still remained in plasma membrane vesicles of the strain AXT3K

at Na+ concentrations greater than 50 mM (Figure 2B). Expression of OsSOS1 alone imparted a

moderate enhancement of Na+/H+ exchange above that background activity. In contrast, co-

expression of the rice SOS1 with the activating SOS2/SOS3 complex from Arabidopsis

significantly increased the Na+/H+ exchange in vesicles. An approximate Km of 29 mM for Na+

was estimated for activated OsSOS1, which is similar to the Km of 23 mM Na+ that has been

estimated for AtSOS1 in plasma membrane vesicles of Arabidopsis plants subjected to salt

exposure to induce the activity of AtSOS1 (Qiu et al., 2003). Accordingly, the salt tolerances

imparted to yeast cells by OsSOS1 and AtSOS1 were comparable (Figure 6A and D).

The rice OsSOS1 protein was phosphorylated and activated by the Arabidopsis SOS2/SOS3

proteins (Figures 2 and 3), which strongly suggests that the mechanistic details of the

biochemical regulation of SOS1 proteins are conserved among these species and that, as a

consequence, functional homologues of the SOS2 and SOS3 proteins should exist in rice. On

the basis of protein sequence similarity, functional tests in yeast, and genetic complementation

of Arabidopsis mutants, we have isolated likely candidates as the functional rice homologues of

the SOS2/SOS3 kinase complex. The rice proteins OsCIPK24 and OsCBL4 were able to

activate the rice transporter OsSOS1 and they could also be exchanged with their Arabidopsis

counterparts to form heterologous protein kinase modules that were fully competent to activate

the SOS1 Na+/H+ antiporters from both Arabidopsis and rice in yeast cells (Figures 1 and 6).

Their ability to complement the sos2 and sos3 mutations of Arabidopsis imply that they are able

to form heterologous protein kinase complexes in planta also (Figure 7). We have previously

shown that over-expression of SOS2 or SOS3 failed to increase the salt tolerance of

complemented mutant lines above wild-type levels (Guo et al., 2004), which is consistent with

the data presented in Figure 7 showing that the over-expression of the rice proteins brought the




- 14 -

salt tolerance of the Arabidopsis mutants close but not beyond that of wild-type plants. These

results show a high degree of structural conservation among the SOS proteins from dicots and

monocots. Contrary to OsSOS1, which is a single-copy gene in rice, OsCIPK24 and OsCLB4

belong to a gene family. Although the complete genomes of the subspecies japonica and indica

are assembled only in part, in both cases the same set of 10 CBLs and 30 CIPKs have been

identified in silico (Kolukisaoglu et al., 2004). Hence, it remains a possibility that other rice CIPK

and CBL isoforms could also have tested positive in our functional analyses, especially for

OsCBL4, for which there were at least 2 other candidates, OsCBL7 and OsCBL8, with high

sequence similarity and predicted N-terminal myristoylation (Kolukisaoglu et al., 2004; Hwang et

al., 2005). In rice, the predicted polypeptides of OsCBL1, 4, 5, 7 and 8 are potential substrates

for N-myristoylation, a lipid modification that promotes protein-protein or protein-membrane

interactions in eukaryotic cells (Kolukisaoglu et al., 2004). However, only OsCBL4 has been

localized to the plasma membrane (Hwang et al., 2005), which is consistent with a role in SOS1

activation (Quintero et al., 2002). Nonetheless, since CIPK/PKS protein kinases can interact

with more than one CBL/SCaBP protein (Guo et al., 2001; Kolukisaoglu et al., 2004), whether

OsCBL4, OsCBL7 and/or OsCBL8 are functionally redundant needs to be investigated. The

phenotypic analysis of the growing number of annotated insertional mutants in rice should

enable the unequivocal identification, by genetic criteria, of the isoforms of CBLs and CIPKs that

are relevant for salt tolerance.

Root hairs and epidermal cells are primary sites for controlled uptake of inorganic ions that

enter the symplastic pathway. In addition, ions move apoplastically across the cortex with the

bulk flow of water and solutes until they reach the endodermis barrier that prevents further

diffusion into the vasculature and entails the selective uptake of ions into the symplast. In a

saline environment, the cell-to-cell pathway imparts greater selectivity and reduced ion uptake

than the bulk flow of water and solutes along the root apoplastic pathway. The relative

contribution of each pathway to net flow of water and solutes is affected by environmental

factors, including salinity (Steudle and Peterson, 1998; De Boer and Volkov, 2003). Typically,

under stress conditions, the apoplastic pathway is reduced by a process that involves the

lignosuberization of root tissues (Azaizeh and Steudle, 1991; Cruz et al, 1992; Sanchez-Aguayo

et al., 2004). Notwithstanding this general model, sodium uptake has been suggested to occur

in rice roots primarily via apoplastic bypass-flow and leakage into the xylem (Yeo et al., 1987).

This apoplastic pathway is presumed to involve discontinuities along the rhizodermal and

endodermal barriers (Yeo et al., 1987; Yadav et al., 1996). Consequently, the uptake of sodium

in rice in saline conditions was proposed to be controlled by genes affecting root anatomy rather

than membrane transport processes (Koyama et al., 2001). However, even if uncontrolled

apoplastic flow were the predominant pathway for Na+ entry the root vascular cylinder, an

enzymatic Na+ efflux mechanism would still be of critical importance to minimize cellular Na+

accumulation in tissues along the plant axis. The plasma membrane Na+/H+ antiporter SOS1

could likely fulfill this role and prevent cellular injury, thus contributing to whole plant salt




- 15 -

tolerance, particularly at moderate salinity levels that do not cause catastrophic physiological

failure. Low salt concentration may not, in itself, be damaging to rice (Yeo et al., 1991); it is the

progressive increase in internal concentration that leads to cellular damage and growth

impairment (Munns, 1993). As long as growth is sustained to keep the concentration of salt in

leaf tissues low by dilution, significant damage could be averted, since the long-term build-up of

salt in leaves is what ultimately leads to injury (Flowers et al., 1991). Although enhanced ion

compartmentation in vacuoles may increase the salt tolerance of rice (Ohta et al., 2002; Fukuda

et al., 2004), this species is a typical glycophyte that relies primarily on Na+ exclusion for growth

in saline environments (Golldack et al., 2003; Lee et al., 2003).

In support of the critical involvement of ion transport processes in the Na+ accumulation by rice

roots, the ability of salt-tolerant lines to exclude Na+ depends on the K+ concentration in the

growth medium. At high-µM to low-mM K+ concentrations, the salt-tolerant lines Pokkali and BK

selectively excluded Na+ while keeping the internal K+ concentration fairly constant. In contrast,

at low-µM K+, these lines accumulated Na+ similar to the salt-sensitive line IR29 (Golldack et al.

2002; Golldack et al. 2003). Physiological measurements of ion uptake by rice roots indicate the

existence of separate high-affinity uptake pathways for K+ and Na+, which have been suggested

to be mediated by HAK/KUP transporters and HKT transporters, respectively (Garciadeblas et

al., 2003). The rice isoform OsHKT1 is expressed in root epidermal and cortical cells (Golldack

et al., 2002), and its kinetic parameters are similar to those displayed by whole roots (high-

affinity Na+ influx that is blocked by K+), whereas the isoform OsHKT4 is expressed in shoots

and mediates fast Na+ influx with low affinity (Garciadeblas et al., 2003). Recently, a major QTL

for shoot K+ content and salt tolerance in rice identified the gene SKC1 encoding an HKT-type

protein corresponding to OsHKT8 (Garciadeblas et al., 2003; Ren et al., 2005). SKC1/HKT8

was preferentially expressed in the parenchymal cells surrounding xylem vessels and up-

regulated by salt stress (Ren et al., 2005). The SCK1/HKT8 isoform from the relatively salt-

tolerant variety Nona Bokra was more active in the facilitation of Na+ transport across the

plasma membrane than its counterpart from the salt-sensitive Koshihiraki variety, which

suggests that a greater capacity for Na+ retrieval from the xylem by SCK1/HKT8 in Nona Bokra

plants was the basis for their salt-tolerance. Together, these results are consistent with

facilitated Na+ transport in saline conditions, particularly at low K+, and support the concept that

ion transport systems and their capacity for Na+:K+ selectivity are of physiological relevance for

the salt tolerance of rice. By extension they also imply that mechanisms restricting net Na+

content, including active efflux at the plasma membrane to counteract ion loading, would be

determinants for salt tolerance. A precise assessment of the relative importance of SOS1 in the

salt tolerance of rice awaits the availability of knock-out mutants or RNA-interference lines.

MATERIALS AND METHODS

Isolation of rice cDNAs




- 16 -

An EST clone (Accession C71771) encoding a putative SOS1 homologue in O. sativa cv

Nipponbare was obtained from the MAFF DNA Bank (Japan). The deduced open reading frame

(ORF) was apparently interrupted by two unprocessed introns of 805 and 160 bp at nucleotide

positions +750 and +970, respectively (numbering relative to the ATG codon in the spliced

cDNA). To obtain a fully spliced cDNA, an RT-PCR was performed with rice RNA as template

and the primers: RSOS1A: 5’- GCGTCGACAATCCATGGACAATCCCGAGGCGG, and

RSOS1B: 5’- TGTGATAAAATTGGATCCAATGAATGCC, which annealed at the putative

initiation codon (underlined) and next to an internal BamHI site, respectively. The RT-PCR

reaction yielded a fragment containing a fragment of the ORF, from nucleotides +1 to +2432,

that was subcloned in the vector pCR-BluntII-TOPO (Invitrogen Inc.), and fully sequenced to

confirm the continuity of the ORF and the fidelity of the amplification. Finally, the amplified

fragment was re-introduced in the original EST clone as a SalI-BamHI fragment, replacing the

equivalent portion in the original cDNA clone with unprocessed introns. The sequence of the

corrected cDNA has been deposited in the GeneBank with Accession AY785147.

A putative full-length cDNA clone (AK101368) corresponding to OsCBL4 (according to the

nomenclature of Kolukisaoglu et al., 2004) guided the design of oligonucleotides OsCBL4F: 5’-

TCGCCATGGGATGCGCGTCGT-3’ and OsCBL4R: 5’- TATTTTCAGTCATGGGCTTCT-3’ used

for the amplification of the open reading frame of OsCBL4 by RT-PCR with total mRNA from O.

sativa cv Nipponbare as template. The amplified cDNA was fully sequenced to assess the

absence of errors. Likewise, the full-length cDNA clone AK102270 encoding OsCIPK24 was

used to design the oligonucleotides OsK24F: 5’-GGCGGATGGGAGGGGAGGAGG-3’ and

OsK24R: 5’-CCAGGCTAGCATGTGGCTGTC-3’ for the amplification of the OsCIPK24 by RT-

PCR. Amplification from the second methionine at position +7 was done with primer

OsK24M2F: 5’-CGCGGATCCGCGGATGGCGGCGGGGAGGA-3’. Truncation of the C-terminal

part of OsCIPK24 at the leucine residue at position 315/309 was achieved by PCR with an

oligonucleotide of sequence 5’-CACCTAAAGAGGGCCACCATC-3’, which introduced a stop

codon, and primers OsK24F and OsK24M2F, respectively.

Plasmid constructs

Plasmid pDROsSOS1 for expression of OsSOS1 in yeast cells under the control of the PMA1

gene promoter was constructed by subcloning the OsSOS1 cDNA as a 3.7 Kb SalI-NotI

fragment in XhoI-NotI restriction sites of multicopy vector pDR195 (Rentsch et al., 1996). A C-

terminal histidine-tagged version of OsSOS1 for protein purification was created by PCR using

the high-fidelity Pfu polymerase (Promega) and the primers 5’-

AAATGGCAACACATGAGCTCAGGG-3’ and 5’-

TGAGCGGCCGCTCAGTGATGGTGATGGTGATGTCGATCAGCAGCGCT-3’. The

OsSOS1:His6X cDNA was subcloned as a BglII-NotI fragment into pDROsSOS1 to produce




- 17 -

plasmid pDROsSOS1H. A histidine-tagged version of wild-type AtSOS2 was produced by PCR

using the primers: 5'-AGAAGCTTATGACAAAGAAAA-3' and 5'-

GAGCGGCCGCAAACGTGATTG-3'. The PCR product was digested with HindIII and NotI and

subcloned in the yeast expression vector pYESHis, a derivative of pYES2 (Invitrogen Inc.)

modified to contain the epitope RGSH6x (Venema et al, 2002). The OsCBL4 cDNA was cloned

in pDR195 as a XhoI-BamHI fragment, to create plasmid pDROsCBL4. All versions of the

OsCIPK24 cDNA (full-length or bearing N- and C-terminal truncations) were cloned as EcoRI-

EcoRI fragments in the yeast expression vector p414GPD (Mumberg et al., 1995). Plasmids

pFL2T, pFL3T and pFL32T used for the expression in yeast of Arabidopsis SOS2, SOS3 and

SOS2/SOS3 proteins, respectively, and plasmid pSOS1-1 for the expression of AtSOS1, have

been described elsewhere (Quintero et al., 2002). The plant expression vector pBIOsSOS1 was

obtained by two-step cloning of OsSOS1 fragments. First a 2,3Kb SalI-BamHI fragment was

inserted into the XhoI and BamHI sites of pBI321. Next, a 1,3Kb BamHI-BamHI was inserted in

the right orientation to reconstitute a full-length OsSOS1 cDNA. Plasmid pBI321 is a derivative

of pBI121 in which the XbaI through SacI cloning sites of plasmid pCR2.1 (Invitrogene) were

inserted between XbaI and SacI sites of pBI121 (Clontech), thus excising the GUS coding

region of pBI121 and creating additional enzyme restriction sites for cloning. Plasmids

pBIOsCIPK24 and pBIOsCBL4 were constructed on the pBI321 backbone for the expression of

OsCIPK4 and OsCBL4 in Arabidopsis.

Arabidopsis transformation and complementation test

The constructs pBIAtSOS1 (Shi et al., 2000), pBIOsSOS1, pBIOsCIPK24, pBIOsCBL4, and

empty vector pBI321 were introduced into the Agrobacterium GV3101 strain, and the resulting

bacterial clones were used to transform sos1-1, sos2-2 and sos3-1 Arabidopsis mutants by

vacuum infiltration (Bechtold et al., 1993). The viral 35S gene promoter is leaky in

Agrobacterium and the residual expression of SOS1 is deleterious to Agrobacterium in the

presence of sodium (Martínez-Atienza, unpublished observations). To minimize the selection of

re-organized constructs, Agrobacterium were grown in LB medium in which 1% KCl substituted

for NaCl. Kanamycin-resistant T2 transgenic plants were selected and subjected to

complementation tests on Murashige and Skoog (MS) agar medium supplemented with NaCl as

indicated for each case. Culture was in an environmentally controlled chamber at 22ºC and 16/8

h daily light/dark cycle with PAR of 30 µmol/m2 per second.

Rice plants growth conditions

O. sativa cv Nipponbare seeds were germinated in sterile conditions, at 28ºC temperature,

100% relative humidity and kept in darkness for five days. Seedlings were then transferred to a

hydroponic culture system consisting of boxes containing 8 liters of aerated nutrient solution

and holding up to 20 plants each. Nutrient medium consisted of 0.09 mM (NH4)2SO4, 0.05 mM




- 18 -

KH2PO4, 0.05 mM KNO3, 0.03 mM K2SO4, 0.06 mM Ca(NO3)2, 0.07 mM MgSO4, 0.11 mM Fe-

EDTA, 4.6 µM H3BO3, 1.8 µM MnSO4, 0.3 µM ZnSO4, 0.3 µM CuSO4, pH 5-5.6 (Miyamoto et al.,

2001). The hydroponic containers were placed in a growth chamber set to a light/dark cycle of

16/8 h daily (PAR 300 µmol/m2 per second), 25-20ºC day/night temperature, and 60-40%

relative humidity. Nutrient solution was changed every seven days. After three weeks of growth

in hydroponic medium, rice plants were subject to salt stress by adding NaCl to 100 mM final

concentration. Samples of roots and shoots were collected at 0, 3, 15, and 48 h after treatment

onset and then frozen in liquid nitrogen.

Ribonucleic acid isolation and northern blot

Total RNA was isolated from roots and shoots of salt-treated rice plants and 40 µg from each

sample was resolved on 1.25% (w/v) agarose-formaldehyde gel, and transferred to Hybond-N

nylon membranes (Amersham) according to standard methods (Sambrook et al., 1989).

Radioactive (32P) probe was prepared from a 1.7 Kb HindIII fragment of OsSOS1 C-terminal by

use of a random priming kit (Amersham). Probe hybridization was performed overnight at 65ºC

in a buffer containing 7% (w/v) SDS, 0.5 M Na2HPO4, 1% (w/v) BSA, 1 mM EDTA, pH 7.2. The

final wash of filters was at 65ºC in 0.1X SSC with 0.1% (w/v) SDS. To estimate the relative

abundance of OsSOS1 mRNA in various samples, the RNA loading was normalized through

hybridization with the EcoRI fragment G of radish ribosomal 18S RNA gene (Delcasso-

Tremousaygue et al., 1988).

Yeast strains and media

Saccharomyces cerevisiae AXT3K strain (∆ena1::HIS3::ena4, ∆nha1::LEU2, ∆nhx1::KanMX4)

(Quintero et al., 2002) is a derivative of W303-1B (MAT� ura3-1 leu2-3,112 his3-11,15 trp1-1

ade2-1 can1-100). Strain YP890 was derived from AXT3K by chromosomal integration of a

PGK1:SOS1:CYC1 expression cassette into the 3´-end of the CYC1 gene (Guo et al., 2004).

Strain YP1021, carrying a chromosomal integration of a rice OsSOS1 expression cassette

(PMA1:OsSOS1:ADH1) was constructed by removing a 1,3 kb ApaI-SnaBI fragment spanning

the URA3 marker and the 2µ DNA replicon from plasmid pDROsSOS1. The resulting plasmid

was linealized at the PMA1 promoter with KpnI and transformed into strain AXT3K carrying

plasmid pFL32T. Plasmid pFL32T expresses the SOS2/SOS3 kinase complex and integrative

transformants were selected on AP medium supplemented with 200 mM NaCl based on the

gain-of-function of SOS1 activity from the PMA1:OsSOS1:ADH1 cassette thought its activation

by SOS2/SOS3. Subsequently, plasmid pFL32T was segregated out in rich, non-selective

medium. Yeast transformation was done by the polyethyleneglycol-lithium acetate method

(Elble, 1992) and transformants were selected on solid SD drop-out media, except when

indicated otherwise. Na+ tolerance tests were performed in the alkali cation-free medium AP

(Rodríguez-Navarro and Ramos, 1984) supplemented with 1 mM KCl and with NaCl as




- 19 -

indicated for each experiment. For ion content measurements, yeast cells were collected during

exponential growth (OD550= 0.2) in liquid AP medium, and their Na+ content was determined by

atomic emission spectrometry after acidic extraction (Rodríguez-Navarro and Ramos, 1984).

OsSOS1:His6X purification and phosphorylation assays

Yeast extracts of cells expressing His-tagged OsSOS1 and AtSOS2 proteins were obtained as

described (Serrano, 1988). AtSOS2:His6x was purified from the soluble fraction by

chromatography on 1 ml column with Ni2+-NTA resin (Qiagen) without further processing. To

purify OsSOS1:His6x, membrane proteins were purified, solubilized and chromatographed on

the Ni2+-NTA resin as described elsewhere (Quintero et al., 2002). Construction and purification

of a glutathione-S-transferase (GST):SOS2T/D∆308 translational fusion has been described

also (Guo et al., 2001). Purified OsSOS1:His6x (100 ng) was used as substrate for

phosphorylation by the Arabidopsis SOS2 and SOS2T/D∆308 protein kinases (100 ng) in 50 µl

of kinase buffer (20 mM Tris⋅HCl, pH 8.0, 5 mM MgCl2, 1 mM CaCl2, 1 mM DTT). Reactions

were started by adding ATP (0.2 mM with 1 µCi of [γ-32P] ATP), incubated at 30ºC for 30 min,

and stopped with 15 µl of 4x SDS/PAGE sample buffer. Aliquots were then resolved by

SDS/PAGE and the gel exposed to X-ray films.

Purification of plasma membrane vesicles

Plasma membrane was isolated from yeast cells by the aqueous two-phase system (Menendez

et al. 1995). Yeast cells were first cultivated in 200 ml AP (1K) medium containing selection

amino acids at 30 ºC one day with shaking (200 rpm), and then transferred into 1000 ml fresh

medium and cultured at 30 ºC with shaking (200 rpm) until the culture reached an OD600 of 3-4.

To ensure activation of the SOS2/SOS3 kinase complex, NaCl was then added to final

concentration of 100 mM and incubation continued for 1 h before harvesting. Cells were

resuspended in 5 mM Tris-HCl, pH 7.5, 700 mM sorbitol to an absorbance of 6 at 800 nm. The

volume of the suspension was then measured and mixed with 1/4 of the volume with lyticase

(Sigma-Aldrich) dissolved in the above medium at 300 units/ml. DTT was then added in to 6.5

mM final concentration, and the mixture incubated at 30 ºC for 1 h with gentle shaking (100

rpm). After lyticase treatment, the resulting protoplasts were recovered by centrifugation at 3000

g for 5 min, washed with the above medium containing 1 mM DTT, and centrifuged again. The

pellet was resuspended in 15 ml ATPase-inducing medium containing 15 mM MES-Tris, pH 6.5,

500 mM sorbitol, 100 mM glucose, and incubated at 30 ºC for 10 min with gentle shaking (100

rpm). Osmotic lysis was thereafter induced with 30 ml osmotic lysis medium containing 25 mM

MES-Tris pH6.5, 5 mM EDTA, 1 mM DTT, 0.2% casein hydrolysate, 0.2% BSA and 1mM

PMSF, on ice for 5 min, assisted by a glass homogenizer, and then centrifuged to remove cell

wall fragments at 300 g and 4 ºC for 3 min. The supernatant was collected and centrifuged at

35000 g and 4 ºC for 15 min. The pellet was resuspended in 9 g membrane suspension medium




- 20 -

containing 5 mM potassium phosphate pH 7.8, 330 mM sucrose and 1 mM DTT, and mixed

quickly with 27 g of two-phase solution with the final composition of 5.7% dextran T-500 (w/w),

5.7% PEG 3350 (w/w), 5 mM potassium phosphate pH 7.8, 330 mM sucrose, 1mM EDTA and 1

mM DTT. The two-phase system was settled on ice for 30 min until phases separated. The

upper and lower phases were collected separately, diluted with 10-fold the fraction volume of 15

mM MES-Tris pH 6.5, 330 mM sucrose, 1 mM DTT, and centrifuged at 65000 g and 4 ºC for 50

min. The membranes were resuspended in the same medium and frozen in liquid nitrogen and

stored at -70 ºC until use.

Na+/H+ exchange assays

The formation of ∆pH was established by the activity of the plasma membrane H+-ATPase and

Na+/H+ exchange activity was measured as a Na+-induced dissipation of ∆pH with the pH value

sensitive fluorescent probe quinacrine in the following reaction mixture (1 ml): 5 µM quinacrine,

50 mM BTP-HCl pH 7.5, 25 mM BTP-Hepes pH 7.5, 250 mM mannitol, 4 mM MgSO4 and 50 µg

plasma membrane protein. The reaction mixture was placed in a fluorescence

spectrophotometer (Hitachi F-2500) and equilibrated in the dark with stirring for 5 min before

fluorescence measurement. The assay was initiated with the addition of 3 mM ATP. When ∆pH

reached steady state, equal amounts of various concentrations of Na2SO4 or sodium gluconate

stock solutions were added to the reaction mixture. To determine initial rates of Na+/H+

exchange, the change of relative fluorescence was measured during the first 30 seconds after

the addition of sodium salts. Specific activity was calculated by dividing the initial rate of

fluorescence recovery, expressed as a ratio of the preformed pH gradient, by the mass of

plasma membrane protein in the reaction and time (∆F mg-1 min-1, where ∆F= F30-F0 / Fmax-Fmin).

The change of pH value was measured at excitation and emission wavelengths of 430 and 500

nm respectively.

Distribution of materials

Upon request, all novel materials described in this publication will be made available in a timely

manner for non-commercial research purposes, subject to the requisite permission from any

third-party owners of all or parts of the material. Obtaining any permissions will be the

responsibility of the requestor.

Sequence data from this article can be found in the GenBank/EMBL data libraries under

accession number AY785147.

ACKNOWLEDGEMENTS

We are grateful to the MAFF DNA Bank (Japan) for biological materials. We thank Alonso

Rodríguez-Navarro for his helpful advice.




- 21 -

LITERATURE CITED

Azaizeh H, Steudle E (1991) Effects of salinity on water transport of excised maize (Zea mays

L.) roots. Plant Physiol 97: 1136-1145

Albrecht V, Ritz O, Linder S, Harter K, Kudla J (2001) The NAF domain defines a novel protein-

protein interaction module conserved in Ca2+-regulated kinases. EMBO J. 20: 1051-1063.

Bañuelos MA, Sychrová H, Bleykasten-Grosshans C, Souciet JL, Potier S (1998) The Nha1

antiporter of Saccharomyces cerevisiae mediates sodium and potassium efflux. Microbiology

144: 2749-2758.

Bechtold N, Ellis J, Pelletier G (1993) In planta Agrobacterium mediated gene transfer by

infiltration of adult Arabidopsis thaliana plants. C. R. Acad. Sci. (Paris) 316: 1194–1199.

Cruz RT, Jordan WR, Drew MC (1992) Structural changes and associated reduction of

hydraulic conductance in roots of Sorghum bicolor L. following exposure to water deficit.

Plant Physiol 99: 203-212

Darley CP, Wuytswinkel OCM, Woude K, Mager WH, De Boer AH (2000) Arabidopsis thaliana

and Saccharomyces cerevisiae NHX1 genes encode amiloride sensitive electroneutral

Na+/H+ exchangers. Biochem. J. 351: 241-249.

Davenport R, James RA, Zakrisson-Plogander A, Tester M, Munns R (2005) Control of sodium

transport in Durum wheat. Plant Physiol. 137: 807-818.

De Boer AH, Volkov V (2003) Logistics of water and salt transport through the plant: structure

and functioning of the xylem. Plant Cell Environ 26: 87-101

Delcasso-Tremousaygue D, Grellet F, Panabieres F, Ananiev ED, Delseny M (1988) Structural

and transcriptional characterization of the external spacer of a ribosomal RNA nuclear gene

from a higher plant. Eur. J. Biochem. 172: 767-776.

Elble R (1992) A simple and efficient procedure for transformation of yeast. BioTechniques 13:

18-20.

Flowers TJ, Hajibagher MA, Yeo AR (1991) Ion accumulation in the cell walls of rice plants

growing under saline conditions: evidence for the Oertli hypothesis. Plant Cell Environ 14:

319-325.

Fukuda A, Nakamura A, Tagiri A, Tanaka H, Miyao A, Hirochika H, Tanaka Y. (2004) Function,

intracellular localization and the importance in salt tolerance of a vacuolar Na+/H+ antiporter

from rice. Plant Cell Physiol 45: 146-159.

Garciadeblas B, Senn ME, Banuelos MA, Rodriguez-Navarro A (2003) Sodium transport and

HKT transporters: the rice model. Plant J. 34: 788-801.

Golldack D, Su H, Quigley F, Kamasani UR, Munoz-Garay C, Balderas E, Popova OV, Bennett

J, Bohnert HJ, Pantoja O (2002) Characterization of a HKT-type transporter in rice as a

general alkali cation transporter. Plant J. 31: 529-542.




- 22 -

Golldack D, Quigley F, Michalowski CB, Kamasani UR, Bohnert HJ. (2003) Salinity stress-

tolerant and -sensitive rice (Oryza sativa L.) regulate AKT1-type potassium channel

transcripts differently. Plant Mol Biol 51: 71-81.

Gong D, Guo Y, Schumaker KS, Zhu JK (2004) The SOS3 family of calcium sensors and SOS2

family of protein kinases in Arabidopsis. Plant Physiol 134: 919-926.

Guo Y, Halfter U, Ishitani M, Zhu JK (2001) Molecular characterization of functional domains in

the protein kinase SOS2 that is required for plant salt tolerance. Plant Cell 13: 1383-1400.

Guo Y, Qiu QS, Quintero FJ, Pardo JM, Ohta M, Zhang C, Schumaker KS, Zhu JK (2004)

Transgenic evaluation of activated mutant alleles of SOS2 reveals a critical requirement of

its kinase activity and C-terminal regulatory domain for salt tolerance in Arabidopsis. Plant

Cell 16: 435-449.

Halfter U, Ishitani M, Zhu JK (2000) The Arabidopsis SOS2 protein kinase physically interacts

with and is activated by the calcium-binding protein SOS3. Proc Natl Acad Sci USA 97:

3735-3740.

Hwang YS, Bethke PC, Cheong YH, Chang HS, Zhu T, Jones RL (2005) A Gibberellin-

Regulated Calcineurin B in Rice Localizes to the Tonoplast and Is Implicated in Vacuole

Function. Plant Physiol 138: 1347-135.

Ishitani M, Liu J, Halfter U, Kim CS, Shi W, Zhu JK (2000) SOS3 Function in Plant Salt

Tolerance Requires N-Myristoylation and Calcium Binding. Plant Cell 12: 1667-1678.

Kolukisaoglu U, Weinl S, Blazevic D, Batistic O, Kudla J. (2004) Calcium Sensors and Their

Interacting Protein Kinases: Genomics of the Arabidopsis and Rice CBL-CIPK Signaling

Networks. Plant Physiol 134: 43-58.

Koyama ML, Levesley A, Koebner RMD, Flowers TJ, Yeo AR (2001) Quantitative Trait Loci for

component physiological traits determining salt tolerance in rice. Plant Physiol 125: 406-422.

Laurie S, Feeney KA, Maathuis FJ, Heard PJ, Brown SJ, Leigh RA. (2002) A role for HKT1 in

sodium uptake by wheat roots. Plant J 32: 139-149.

Lee KS, Choi WY, Ko JC, Kim TS, Gregorio GB (2003) Salinity tolerance of japonica and indica

rice (Oryza sativa L.) at the seedling stage. Planta 216: 1043-1046.

Liu J, Zhu JK (1998) A calcium sensor homolog required for plant salt tolerance. Science 280:

1943-1945.

Liu J, Ishitani M, Halfter U, Kim CS, Zhu JK (2000) The Arabidopsis thaliana SOS2 gene

encodes a protein kinase that is required for salt tolerance. Proc Natl Acad Sci USA 97:

3703-3734.

Menendez A, Larsson C, Ugalde U (1995) Purification of functionally sealed cytoplasmic side-

out plasma membrane vesicles from Saccharomyces cerevisiae. Anal Biochem 230: 308-

314.

Miyamoto N, Steudle E, Hirasawa T, Lafitte R (2001) Hydraulic conductivity of rice roots. J Exp

Bot 362: 1835-1846.

Mumberg D, Muller R, Funk M. (1995). Yeast vectors for the controlled expression of

heterologous proteins in different genetic backgrounds. Gene 156: 119-122.




- 23 -

Munns R (1993) Physiological processes limiting plant growth in saline soils: some dogmas and

hypotheses. Plant Cell Environ 16: 15–24

Ohta M, Hayashi Y, Nakashima A, Hamada A, Tanaka A, Nakamura T, Hayakawa T. (2002)

Introduction of a Na+/H+ antiporter gene from Atriplex gmelini confers salt tolerance to rice.

FEBS Lett 532: 279-282.

Pardo JM, Cubero B, Leidi EO, Quintero FJ (2006) Alkali cation exchangers: roles on cellular

homeostasis and stress tolerance. J Exp Bot 57: 1181-1199.

Qiu QS, Guo Y, Dietrich MA, Schumaker KS, Zhu JK ( 2002) Regulation of SOS1, a plasma

membrane Na+/H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3. Proc Natl Acad

Sci USA 99: 8436-8441.

Qiu QS, Barkla BJ, Vera-Estrella R, Zhu JK, Schumaker KS (2003) Na+/H+ exchange activity in

the plasma membrane of Arabidopsis. Plant Physiol 132: 1041-1052.

Quintero FJ, Blatt MR, Pardo JM (2000) Functional conservation between yeast and plant

endosomal Na+/H+ antiporters. FEBS Lett 471: 224-228.

Quintero FJ, Ohta M, Shi H, Zhu JK, Pardo JM (2002) Reconstitution in yeast of the Arabidopsis

SOS signaling pathway for Na+ homeostasis. Proc Natl Acad Sci USA 99: 9061-9066.

Ren ZH, Gao JP, Li LG, Cai XL, Huang W, Chao DY, Zhu MZ, Wang ZY, Luan S, Lin HX.

(2005) A rice quantitative trait locus for salt tolerance encodes a sodium transporter. Nat

Genet 37: 1141-1146.

Rentsch D, Laloi M, Rouhara I, Schmelzer E, Delrot S, Frommer WBV (1995) NTR1 encodes a

high affinity oligopeptide transporter in Arabidopsis. FEBS Lett 370: 264-268.

Rodriguez-Navarro A, Ramos J (1984) Dual System for potassium transport in Saccharomyces

cerevisiae. J Bacteriol 159: 940-945.

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, 2nd edn.,

Cold Spring Harbor Laboratory Press, (Cold Spring Harbor, NY).

Sanchez-Aguayo I, Rodriguez-Galan JM, García R, Torreblanca J, Pardo JM (2004) Salt stress

enhances xylem development and expression of S-adenosyl-methionine synthase in lignifying

tissues of tomato plants. Planta 220: 278-285.

Sanchez-Barrena MJ, Martinez-Ripoll M, Zhu JK, Albert A. (2005) The structure of the Arabidopsis

thaliana SOS3: molecular mechanism of sensing calcium for salt stress response. J Mol Biol

345: 1253-1264

Serrano R (1988) H+-ATPase from plasma membranes of Saccharomyces cerevisiae and

Avena sativa roots: purification and reconstitution. Methods Enzymol 157: 533–544.

Shi H, Ishitani M, Kim C, Zhu JK (2000) The Arabidopsis thaliana salt tolerance gene SOS1

encodes a putative Na+/H+ antiporter. Proc Natl Acad Sci USA 97: 6896-6901.

Shi H, Quintero FJ, Pardo JM, Zhu JK (2002) The Putative Plasma Membrane Na+/H+

Antiporter SOS1 Controls Long-Distance Na+ Transport in Plants. Plant Cell 14: 465-477.

Steudle E, Peterson CA (1998) How does water get through roots?. J Exp Bot 49: 775-788

Tester M, Davenport R (2003) Na+ tolerance and Na+ transport in higher plants. Annals of

Botany 91: 503-527.




- 24 -

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The ClustalX

Windows interface: flexible strategies for multiple sequence alignment aided by quality

analysis tools. Nucl Acids Res 24: 4876-4882.

Venema K, Quintero FJ, Pardo JM, Donaire JP (2002) The Arabidopsis Na+/H+ exchanger

AtNHX1 catalyzes low affinity Na+ and K+ transport in reconstituted liposomes. J Biol Chem

277: 2413-2418.

Wieland J, Nitsche AM, Strayle J, Steiner H, Rudolph HK (1995). The PMR2 gene cluster

encodes functionally distinct isoforms of a putative Na+ pump in the yeast plasma

membrane. EMBO J 14: 3870-3882.

Yadav R, Flowers TJ, Yeo AR (1996) The involvement of the transpirational flow in sodium

uptake by high- and low-sodium transporting lines of rice developed through intravarietal

selection. Plant Cell Environ 19: 329–336.

Yeo AR, Yeo ME, Flowers TJ (1987) The contribution of an apoplastic pathway to sodium

uptake by rice roots in saline conditions. J Exp Bot 38: 1141–1153.

Yeo AR, Lee KS, Izard P, Boursier PJ, Flowers TJ (1991) Short and long term effects of salinity

on leaf growth in rice (Oryza sativa). J Exp Bot 42: 881–889.

Zhu JK (2000) Genetic analysis of plant salt tolerance using Arabidopsis. Plant Physiol 124:

941-948.




- 25 -

FIGURE LEGENDS.

Figure 1. Activation of rice SOS1 by the Arabidopsis SOS2/SOS3 kinase complex. (A)

AXT3K cells transformed with an empty vector (0) or with the indicated combination of SOS

genes (1, OsSOS1; 2, AtSOS2; 3, AtSOS3) were grown overnight in selective SD medium. Five

microliters of serial decimal dilutions were spotted onto plates of AP medium with 1 mM KCl and

supplemented with 0 (not shown), 100 or 200 mM NaCl. Plates were incubated at 28ºC for 3

days. Plasmids used for expression of the SOS proteins were pDR195 for OsSOS1, pFL2T for

AtSOS2, pFL3T for AtSOS3, and pFL32T for co-expression of AtSOS2 and AtSOS3. (B)

Intracellular Na+ content as determined by atomic emission spectrometry. Cells were grown in

AP medium with 1 mM KCl and 30 mM NaCl, and collected at OD550=0,2-0,3. Values are the

mean and SE of 3 independent cultures of each combination of SOS genes. Units are nanomols

of ion per milligram dry weight of cell samples.

Figure 2. Na+/H+ antiporter activity of rice SOS1. (A) ATP-dependent pH gradient formation

in membrane vesicles isolated from yeast cells expressing rice SOS1. An inside-acid ∆pH was

formed after the addition of ATP to vesicles (arrow 1). Once fluorescence was stabilized,

sodium salts were added to the cuvette (arrow 2), and fluorescence recovery, indicating proton

exchange, was monitored for 2 minutes, after which ∆pH was disrupted by the addition of 25

mM (NH4)2SO4 (arrow 3). Fluorescence is expressed as arbitrary units. (B) Na+/H+ exchange as

a function of Na2SO4 concentration and the presence of rice OsSOS1, with and without co-

expression of the Arabidopsis SOS2/SOS3 kinase complex. Circles, AXT3K cells transformed

with empty vector pDR195; squares, AXT3K cells expressing rice OsSOS1 alone; diamonds,

AXT3K cells transformed to produce proteins OsSOS1, AtSOS2 and AtSOS3. Na+/H+ exchange

activity is given as the proportion of dissipation of the preformed pH gradient per minute and

milligram of membrane protein. (C) Specificity of sodium-induced proton exchange. Sodium was

added to a final concentration of 75 mM as sulfate (grey bars) or gluconate (black bars) salt.

Values are the mean and SE of percent fluorescence dissipation of triplicate samples.

Figure 3. Phosphorylation of rice SOS1 by the Arabidopsis kinase SOS2. (A) Recombinant

His-tagged OsSOS1, AtSOS2 and GST-fused AtSOS2T/D∆308 were purified by affinity-

chromatography. Aliquots (1 to 4) of the first elution volumes were analyzed for protein purity by

SDS-PAGE. Bands corresponding to OsSOS1:His6x (128 kDa), AtSOS2:H6x (52 kDa) and

GST:AtSOS2T/D∆308 (60 kDa) are indicated. Standard molecular weights are shown on the

left. (B) Purified proteins were combined as indicated in protein kinase reaction assays. Aliquots

of phosphorylation reactions were resolved by SDS-PAGE and exposed to X-ray films. Arrow

indicates the 128 kDa band pertaining to phosphorylated OsSOS1.

Figure 4. Complementation of Arabidopsis sos1-1 mutant by rice OsSOS1. (A) Six-day old

seedlings grown on MS agar medium were transferred to MS medium supplemented with 50




- 26 -

mM NaCl and imaged after 14 days of salt treatment. Left, transgenic sos1-1 mutant seedling

expressing AtSOS1 from the cauliflower mosaic virus 35S promoter. Center, 5 independent

transgenic lines of sos1-1 mutants expressing the rice OsSOS1 gene under the control of the

35S promoter. Right, a sos1-1 mutant seedling transformed with empty vector pBI321. (B)

Quantitation of seedling growth, expressed as fresh weight after 14 days in MS medium with

and without supplemental 65 mM NaCl. Data are the mean and SE of fresh weight values of 3-6

individual seedlings from each line. Dashed bars, sos1-1 mutant seedlings transformed with

empty vector pBI321; grey bars, sos1-1 mutant seedlings transformed with the rice OsSOS1

gene under the control of the 35S promoter; black bars, sos1-1 mutant seedlings transformed

with Arabidopsis SOS1.

Figure 5. Transcript abundance of OsSOS1 in response to salt stress. Total RNA purified

from root and shoot of rice plants subjected to salt stress with 100 mM NaCl in hydroponic

culture medium for 0, 3, 15, and 48 hours. Hybridization was performed with a probe prepared

from OsSOS1 cDNA. RNA sample loading was normalized by hybridization with a probe derived

from radish 18S rDNA.

Figure 6. Functional interactions between Arabidopsis SOS proteins and rice

counterparts. Strains YP890 carrying the integration of the PGK1PRO:AtSOS1:CYC1TER

cassette (A, C), YP1021 with the analogous integration PMA1PRO:OsSOS1:ADH1TER with the

SOS1 cDNA from rice (D), and AXT3K cells transformed with plasmid pSOS1-1 for the

expression of AtSOS1 (B) were transformed with plasmids directing the expression of the

regulatory proteins SOS2 and SOS3 from Arabidopsis or CIPK24 and CBL4 from rice, as

indicated in each case. CIPK24∆309 bears a C-terminal deletion rendering a constitutive, CBL-

independent protein kinase. Yeast cells were grown overnight in selective SD medium. Five

microliters of serial decimal dilutions were spotted onto plates of AP medium with 1 mM KCl and

200 mM NaCl. Plates were incubated at 28ºC for 3-4 days.

Figure 7. Complementation of Arabidopsis sos2 and sos3 mutants by rice CIPK24 and

CBL4. Six-day old seedlings of mutants sos3-1 (A) and sos2-2 (B) and transformed with cDNAs

of rice genes CBL4 (A) or CIPK24 (B) respectively, were transferred to MS medium

supplemented with 100 mM (CBL4 and sos3) or 75 mM NaCl (CIPK24 and sos2) and imaged

after 14 days of growth. In both panels, from left and right, two wild-type plants, five

complemented lines, and two mutant plants transformed with empty vectors are depicted. The

root length of seven individual plants from each of these lines was measured after 14 days in

salinized media (C, sos3 mutant and rice CBL4; D, sos2 mutant and rice CIPK24). In both plots,

dashed columns represent the root length attained by the mutant lines, gray columns are the

complemented lines, and back columns are the wild-type Col-0.




- 27 -

Supplemental Figure 1. Phylogenetic relationships of SOS1 homologues from various

plant species. (A) Amino acid sequence alignment of SOS1 proteins from Arabidopsis (top

sequence) and rice (bottom sequence). Alignment analysis was performed with CLUSTAL-X

(Thompson et al., 1997). Identical residues are highlighted in black. The predicted 12

transmembrane (TM1-TM12) segments are indicated. The position of 2 unprocessed introns

removed from OsSOS1 cDNA are indicated by asterisks. (B) Putative polypeptides homologous

to A. thaliana SOS1 were aligned by use of CLUSTAL-X. Illustrated is the phylogenetic tree of

proteins from A. thaliana (Accession E84431), O. sativa (Acc. C71771), Physcomitrella patens

(Acc. CAD91921), Cymodocea nodosa (Acc. CAD20320), together with these from Thellungiella

halophila and Mesembryanthemum crystallinum (Valery Poroyko and Hans Bohnert, University

of Illinois; personal communication).

Supplemental Figure 2. Amino acid sequence alignment of AtSOS3 from A. thaliana and

OsCBL4, 7 and 8 from O. sativa. Identical residues in all the proteins are highlighted in black;

residues conserved relative to AtSOS3 but not present in all isoforms are shaded in gray. The

double line indicates the consensus sequence for N-myristoylation (MGXXXS) and the

arrowhead the putative glycine residue to which myristate is attached. Segments corresponding

to the putative EF-hand domains of this Ca2+-binding proteins are indicated as EF1 to EF4.

Supplemental Figure 3. Amino acid sequence alignment of AtSOS2 from A. thaliana and

OsCIPK24 from O. sativa. Identical residues are highlighted. Grey arrowheads indicate the 2

alternative methionine residues (M1 and M7) used for the translational initiation of the

OsCIPK24 cDNA. Only the shorter protein starting at M7 was active. The NAF/FISL domain for

binding to CBL proteins is underlined. The black arrowhead indicates the C-terminal truncation

(leucine at position 308 in AtSOS2; position 309 in OsCIPK24, relative to methionine at position

7) that results in a constitutively active, CBL-independent protein kinase.



0

100

200

300

400

500

600

0 1 1/2 1/2/3

100 mM NaCl

0

1/2/3

1/21/3

12/3

32

Anm

ol N

a+/ m

g

B

200 mM NaCl

PLANTPHYS/2006/092635/Fig. 1 www.plantphysiol.orgon February 10, 2018 - Published by Downloaded from

Copyright © 2006 American Society of Plant Biologists. All rights reserved.


0

500

1000

0 50 100 150 200

∆F min-1

mg-1

Na+ (mM)

110

130

150

170

190

210

230

250

0 200 400 600 800

1

2

3

Time (seconds)

Fluorescence

A

B

C

0

100

200

300

400

500

None SOS1 SOS1/2/3

∆F min-1

mg-1

PLANTPHYS/2006/092635/Fig. 2 www.plantphysiol.orgon February 10, 2018 - Published by Downloaded from

Copyright © 2006 American Society of Plant Biologists. All rights reserved.


0

2

4

6

8

10

12

14

MS 65 mM NaCl

Fre

sh w

eigh

t (m

g)

vectorAtSOS1 OsSOS1A

B

PLANTPHYS/2006/092635/Fig. 4 www.plantphysiol.orgon February 10, 2018 - Published by Downloaded from Copyright © 2006 American Society of Plant Biologists. All rights reserved.


OsSOS1

18S

RootLeaf

0h 3h 15h 48h 0h 3h 15h 48h

PLANTPHYS/2006/092635/Fig. 5 www.plantphysiol.orgon February 10, 2018 - Published by Downloaded from Copyright © 2006 American Society of Plant Biologists. All rights reserved.


PLANTPHYS/2006/092635/Fig. 6

A

B

C

D

AtSOS1, SOS2, SOS3

AtSOS1, SOS2

AtSOS1, CBL4

AtSOS1, SOS2, CBL4

CIPK24∆309

OsSOS1

OsSOS1, CIPK24∆309

AtSOS1, CIPK24

AtSOS1, CIPK24, CBL4

OsSOS1, CIPK24, CBL4

OsSOS1

OsSOS1, CBL4

OsSOS1, CIPK24



Conservation Of The Sos Salt Tolerance Pathway In Rice

Documents

Transcript of Conservation Of The Sos Salt Tolerance Pathway In Rice