Proc. Nati. Acad. Sci. USAVol. 89, pp. 47-51, January 1992Microbiology

Components of the protein-excretion apparatus of Pseudomonasaeruginosa are processed by the type IV prepilin peptidase

(type IV pilin/PilD peptidase substrates/protein export)

DAVID N. NUNN AND STEPHEN LORYDepartment of Microbiology, School of Medicine, University of Washington, Seattle, WA 98195

Communicated by Bernard D. Davis, September 30, 1991

ABSTRACT In the Gram-negative pathogen Pseudomonasaeruginosa, mutants in the gene for the prepilin peptidase (pilD)are pleiotropic, as they not only fail to process pilin but alsoaccumulate in the periplasm, in their mature form, severaltoxins and hydrolytic enzymes that are normally exported tothe external medium (excreted). We have suggested that thisexcretion defect is due to the lack of PilD-dependent processingof proteins that share sequences in common with the prepilinsubunit and that are components of a protein-excretion ma-chinery. In this paper we report the isolation and character-ization of transposon-induced excretion mutants with pheno-types similar to that of a pilD gene mutant. Using oligonucle-otide probes designed to recognize sequences encoding thecleavage site of the type IV prepilins, we have isolated fourlinked genes with the predicted putative PHD-dependent cleav-age site. Site-specific mutations within these genes have shownthat they are required for protein excretion, and PilD-dependent processing of at least one of the four encodedproteins was demonstrated. Evidence suggests that similarcomponents play a role in protein excretion in a wide variety ofGram-negative bacteria.

Translocation of a protein across the bacterial cytoplasmicmembrane requires its interaction with the cellular exportmachinery. In genetic and biochemical studies (1, 2), the sec(or pro genes of Escherichia coli have been shown to encodeproteins that facilitate this translocation by interacting withN-terminal signal sequences, maintaining polypeptides in anexport-competent form during translocation or providingenergy to the export process.

Excretion of proteins to the exterior of Gram-negativebacteria requires translocation across a double membranebarrier. The excretion by E. coli of hemolysin, a proteinsynthesized without an N-terminal leader sequence, requiresthe functions of at least three gene products, HlyB, HlyD,and TolC (3, 4). A number of other bacterial proteins appearto be excreted by a similar mechanism, including the ade-nylate cyclase of Bordetella pertussis (5, 6) and the metallo-proteases of Erwinia chrysanthemi (7). In contrast, the pul-lulanase of Klebsiella oxytoca is synthesized with a typicalN-terminal leader sequence and requires 13 gene products(PulC-O) for excretion (8).Pseudomonas aeruginosa, an opportunistic pathogen, ex-

cretes a number of enzymes that are important for virulence.Several laboratories have isolated and characterized mutantsthat are defective in the excretion of proteins (9-12). We havepreviously shown that one of these mutants, in the gene pilD,is defective in the processing of the type IV prepilins and theproduct of this gene is the prepilin leader peptidase (13, 14).Transposon insertions in pilD lead to an accumulation ofnormally excreted proteins in the periplasmic space of the

organism (12). To account for the role of the pilD geneproduct in protein excretion, we have proposed that theexcretion machinery contains components that are depen-dent on the prepilin peptidase for their cleavage. Here wereport the identification and characterization of four closelylinked genes encoding such proteins.*

MATERIALS AND METHODSBacterial Strains and Culture Conditions. E. coli strain

DH5a (hsdR recA lacZYA 480dlacZAM15) was used as ahost for all cloning experiments. The construction of P.aeruginosa pilD mutants B30 and 2B18 and pilA mutant NPhas been described (13, 15). Cultures were routinely grownon Luria broth (16) or minimal A salts (17) supplemented with50 mM monosodium glutamate and 1% (vol/vol) glycerol.DNA Manipulations, Sequencing, and Analyses. Plasmid

DNA from E. coli (18) and chromosomal DNA from P.aeruginosa (19) were purified as described. Agarose gelelectrophoresis and DNA purification by electroelution (20),DNA blot hybridizations (21), and DNA sequencing (13) weredone as described.

Plasmid Constructions. The transposon delivery vehiclepRK2013::TnSG was constructed as follows. PlasmidColEl::TnS (provided by M. Yanofsky, University of Wash-ington) was digested with Bgl II and the central fragment ofTnS, encoding kanamycin resistance, replaced by ligation toa BamHI gentamicin-resistance cartridge from pPC110 (pro-vided by P. Christie, University of Washington). This con-struction was digested with EcoRI and used to replace theColEl sequences from EcoRI-digested pRK2013 (22), result-ing in plasmid pRK2013::TnSG.A plasmid for overexpressing the P. aeruginosa phospho-

lipase C was constructed as follows. The 4-kilobase (kb) SmaI-BamHI fragment of pSL2 (23) was cloned into the SmaI-BamHI site of pUC18 (24). The cloned fragment wasexcised as an EcoRI-HindIII fragment and ligated intoEcoRI/HindIII-digested pMMB66EH (25), resulting in plas-mid pMMSL2.The 9.2-kb EcoRI fragment containing the Tn5G insertion

T9 and flanking chromosomal sequences was cloned bydigesting chromosomal DNA of this mutant with EcoRI. Thedigest was ligated into the EcoRI site of pUC13Cm, andgentamicin- and chloramphenicol-resistant E. coli DH5atransformants were selected.Three degenerate oligonucleotide probes were designed to

recognize the sequence encoding the consensus PilD cleav-age site, Gly-Phe-Thr-Leu-(Leu/Ile)-Glu, that was deter-mined to be shared by the type IV pilins, PulG-J of K.oxytoca, and three ComG proteins ofBacillus subtilis (14, 26,27). The three oligonucleotides [no. 1, GG(C/T)TT(C/T)-ACCCTG(C/G/T/A)T(C/G)GA; no. 2, GG(C/T)TT(C/T)-ACCCTC(C/G/T/A)T(C/G)GA; no. 3, GG(C/T)TT(C/T)-

*The sequence reported in this paper has been deposited in theGenBank data base (accession no. M80792).

47

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Apr

il 29

, 202

1

48 Microbiology: Nunn and Lory

ACCTTG(C/G/T/A)T(C/G)GA] were synthesized on a Bi-osearch model 8600 DNA synthesizer.A plasmid containing the sequence ofthepddC gene cloned

into pDN18 (13) was constructed as follows. The 1.2-kb XhoI fragment was cloned into Sal I-digested M13mpl9 (24), anduracil-containing single-stranded DNA was prepared. A mu-tagenic oligonucleotide was used to introduce a ribosome-binding site and EcoRV site ahead of the initiation codon ofpddC. Double-stranded DNA was prepared, digested withEcoRV and Xba I, and religated after the Xba I end was filledin. The religated plasmid was digested with EcoRI andHindIII, and the fragment containing pddC was ligated toEcoRI/HindIII-digested pDN18, resulting in pDN18pddC.The T7 RNA polymerase-expressing plasmid, pMMBT7,

was constructed by ligating an EcoRI-HindIII fragment fromthe replicative form of M13mpGP1-2 (provided by S. Tabor,Harvard Medical School), containing the gene for T7 RNApolymerase, into EcoRI/HindIII-digested pMMB66EH.Plasmid pUC7G was constructed by gel purification of the

1.8-kb gentamicin-resistance cassette from BamHI-digestedpPC110. Ends of the purified fragment were filled in with theKlenow fragment of DNA polymerase, Pst I linkers(Promega) were added, and the fragment was cloned into thePst I site of pUC7 (24).A 2.1-kb fragment containing sequences encoding PddA-D

was generated by the polymerase chain reaction (PCR)technique (28) using the two primers highlighted in Fig. 3. The5' primer was synthesized with an extension containing anEcoRI site, and the 3' primer was synthesized with anextension containing an Xba I site. The PCR product wasamplified from the 9.2-kb EcoRI fragment containing the T9insertion. The 2.1-kb PCR product was digested with EcoRIand Xba I and ligated to EcoRI/Xba I-digested pDN18, togive pDN18PCR.

Generation of P. aeruginosa Protein-Excretion Mutants. Arandom library of transposon TnSG insertions in the chro-mosome of P. aeruginosa was generated by conjugating E.coli DH5a containing the suicide plasmid pRK2013: :TnSGwith P. aeruginosa strain PAK-NP. Approximately 70,000gentamicin-resistant exconjugants were obtained.

Defined insertion mutants of P. aeruginosa PAK (PAK-XG1, -XG2, and -XG9, Fig. 1A) were generated as follows.The 7.2-kb EcoRI-BamHI fragment was subcloned intopBR322 (29) and this construction was partially digested with

A Ikb

EcoRIX~hoI BamHI

XhoI XhoIPstlI PstI

T9T4Sal

T2 TI 2XGgT24TIOSalI XGI XG2

B

Xho I. Linearized fragments were purified by electroelutionand ligated to a gentamicin-resistance cassette purified froma Sal I digest ofpUC7G. Clones were selected that containedplasmids with a single insertion in either of two Xho I sites(pXG1 and pXG2) or a deletion and replacement with thegentamicin-resistance gene cartridge of the 1.2-kb Xho Ifragment between the two sites (pXG9). The three construc-tions were individually mobilized into PAK and, by a one-step gene replacement procedure (13), the correspondinginsertions (XG1 and XG2) and deletion (XG9) were intro-duced into the chromosome.T7 Expression Experiments. A broad-host-range T7 RNA

polymerase/promoter gene expression system was used toexpress the proteins encoded by pDN18-PddC in a wild-typeand pilD mutant of P. aeruginosa PAK. The procedure usedwas a modification of that originally described by Tabor andRichardson (30). Cells containing pDN18 and pMMBT7 orpDN18PddC and pMMBT7 were grown in minimal mediumA supplemented with 50 mM monosodium glutamate, 1%(vol/vol) glycerol, and an amino acid mixture lacking me-thionine and cysteine. Isopropyl f8-D-thiogalactopyranosidewas added to the growing cultures to induce 17 RNApolymerase expression from pMMBT7 and, following addi-tion of rifampicin, proteins were labeled with [35S]methionineand [35S]cysteine (Trans35S-label; ICN).

RESULTSIsolation of P. aeruginosa Protein-Excretion Mutants. Mu-

tants resulting from transposon insertions into genes encod-ing components of an excretion apparatus processed by theprepilin peptidase should be unable to excrete exotoxin A,elastase, alkaline phosphatase, and phospholipase C, dis-playing a phenotype similar to that ofthe pilD mutant (12). Totest this hypothesis, a random library of chromosomal trans-poson TnSG insertions was generated in P. aeruginosa PAK-NP, a nonpiliated mutant of PAK. To facilitate the isolationof excretion mutants only, and not mutants in structural orregulatory genes, pMMSL2, a plasmid that overexpresses thehemolytic phospholipase C, was introduced into the P.aeruginosa TnSG mutant library. Nonhemolytic colonieswere identified after plating of the exconjugants on blood-agar plates. Twenty-one clones were identified that werereproducibly nonhemolytic.

PstI EcoRI

SaOl C

EcoRI,

1 2 3 4 5 6 7 8 9 10

* ~~4.-~~-_ -~~d

EcoR!, Pstl

EcoRI, SaU

EcoRI, Xhol

FIG. 1. Restriction map of9.2-kb EcoRI fragment, transposon and insertion mutants, and restriction fragments hybridizing to oligonucleotideprobes designed to recognize sequences encoding the cleavage site of the type IV prepilin and related proteins. (A) Restriction map of the 9.2-kbEcoRI fragment containing transposon insertions (A) and defined insertion and deletion mutations (m). Highlighted region corresponds to DNAsequence shown in Fig. 3. (B) Representations of the restriction fragments hybridizing to oligonucleotide probes 1-3. (C) Ethidiumbromide-stained agarose gel (lanes 1-5) and Southern blot (lanes 6-10) probed with oligonucleotide 1 of restriction fragments of cloned 9.2-kbEcoRI fragment containing T9 insertion and flanking sequences. Lanes 1 and 6, digested with EcoRI; lanes 2 and 7, EcoRI and BamHI; lanes3 and 8, EcoRI and Pst I; lanes 4 and 9, EcoRI and Sal I; lanes 5 and 10, EcoRI and Xho I.

II I

Proc. Natl. Acad. Sci. USA 89 (1992)

Dow

nloa

ded

by g

uest

on

Apr

il 29

, 202

1

Proc. Natl. Acad. Sci. USA 89 (1992) 49

To map the sites of insertions, chromosomal DNA wasprepared from each ofthe mutants and restricted withBamHIor EcoRL. The individual digests were separated in agarosegels, blotted to nitrocellulose, and probed with radiolabeledpRK2013::TnSG DNA. All 21 mutants contained transposoninsertions in a common 9.2-kb EcoRI fragment. Furtherrestriction mapping and hybridization analyses showed that6 independent transposon insertions (T9, T4, T2, T1, T24,and T10) were represented and spanned a region of -6.5 kbwithin the 9.2-kb EcoRI fragment. The location of the inser-tions and a restriction map of the 9.2-kb EcoRI fragment areshown in Fig. 1A.Four of the insertion mutants (T1, T2, T9, and T10) were

characterized for their ability to excrete alkaline phospha-tase, phospholipase C, and exotoxin A. For the first two,cultures of each mutant were grown, cells were harvested,and the enzymatic activity of these proteins was assayed inthe extracellular and cell-associated fractions. Table 1, ex-periment A, shows that the insertion mutants are deficient inthe excretion of both of these proteins.For exotoxin A, the exotoxin A-overexpressing plasmid

pMMD4 (12) was introduced into each of the four mutants byconjugation, and the resultant cultures were induced withisopropyl P-D-thiogalactopyranoside and fractionated (Fig.2). The localization of the exotoxin A was determined byimmunoblot analyses of fractions using exotoxin A-specificantisera. In contrast to wild-type PAK, exotoxin A synthe-sized by mutant T9, as well as T1, T2 and T10, was foundexclusively in the periplasmic fraction. Thus, with respect toprotein excretion, the transposon mutants have the same

phenotype as the pilD mutant.Isolation and Characterization of Sequences Encoding PilD-

Dependent Proteins. To identify genes encoding the proposedPilD-cleavable proteins, three degenerate oligonucleotideswere designed to recognize DNA sequences encoding theN-terminal consensus region shared by the type IV pilins andseveral other proteins required for macromolecular transport(14). Each of the oligonucleotides was labeled with[y-32P]ATP and used to probe a Southern blot of restrictiondigests ofthe cloned 9.2-kb EcoRI fragment containing the T9insertion and flanking sequences. The restriction fragmentsrepresented in Fig. 1B hybridized to oligonucleotide probe 1.Probes 2 and 3 gave similar patterns of hybridization. Hy-bridization to the various restriction digests suggested thatone or more sequences homologous to the oligonucleotideprobes were located in the 1.2-kb Xho I fragment.The DNA sequence of the 1.2-kb Xho I fragment and

regions upstream and downstream was determined (Fig. 3).Four open reading frames, encoding proteins with the pre-dicted consensus cleavage site, were designated pdd (pilD-dependent) and potentially encode proteins with sizes of 15.4(PddA), 18.2 (PddB), 14.4 (PddC), and 24.5 (PddD) kDa.

Expression and Cleavage of Excretion Proteins. To demon-strate that cleavage of the newly identified proteins is de-pendent on the expression of the product of the pilD gene, aT7 RNA polymerase/promoter system was used to expressPddC in vivo. Plasmid pDN18pddC (see Materials and Meth-ods for construction) was conjugated into wild-type PAK andthe pilD mutant 2B18 and, following induction ofthe T7 RNApolymerase gene, proteins were selectively expressed fromthe cloned DNA and radiolabeled.

Cleavage of PddC (and that of prepilin) requires the PilDprepilin peptidase, since the pilD mutant strain produced alarger form of the protein (Fig. 4). Similar attempts to expressdetectable levels of PddA, -B, and -D were unsuccessful.

Generation of Defined Mutations in Excretion-ProteinGenes. To ensure that the excretion defect of the transposonmutants was due to inactivation of the pdd genes, specificmutants were generated in the pdd gene sequences in a

wild-type strain. Mutants XG1 and XG2 contain insertions of

Table 1. Phenotypes and complementation ofexcretion-defective mutants

Alkalinephosphatase Phospholipase C

Extra- Cell- Extra- Cell-Strain* cellular associated cellular associated

Experiment AWt PAK 2010 197 27.7 6.0pilD B30 17 5036 0.4 84.2T9 22 6842 0.7 124.6T2 22 6431 0.3 107.6Ti 20 6548 0.4 105.6T10 19 5733 1.6 102.4

Experiment BXG1 19 5838 2.4 91.6XG2 20 5376 1.8 93.3XG9 20 4926 0.6 95.3

Experiment CWt PAK(pDN18) 957 111 10.7 1.0Wt PAK(pDN-PCR) 671 227 7.2 1.8XG9(pDN18) 4 2811 0.1 39.8XG9(pDN-PCR) 336 1433 4.7 10.3

Units of alkaline phosphatase are as defined by Brickman andBeckwith (31). Units of phospholipase C are as defined by Berka etal. (32), multiplied by 10.*Wt, wild type.

a gentamicin-resistance encoding cassette into the codingsequence of pddA and pddD, respectively (Figs. 1 and 3).Mutant XG9 has a deletion of the sequences between the XhoI sites and replacement with the gentamicin cartridge, result-ing in a loss of the 3' sequence ofpddA, all of the pddB and-C sequences and the 5' sequence of pddD.The excretion phenotypes of XG1, XG2, and XG9 mutants

were determined in the same manner as previously describedfor the four transposon mutants. Phospholipase C and alkalinephosphatase activity in the mutants was entirely cell-associated (Table 1, experiment B). Exotoxin A was found inthe periplasmic space of the deletion mutant XG9 (Fig. 2) andinsertion mutants XG1 and XG2 displayed a similar pheno-type.

Complementation of Mutants. To provide further evidencefor the requirement of the Pdd proteins for excretion, com-plementation experiments with excretion-defective strainswere carried out. A 2.1-kb DNA fragment containing onlysequences encoding PddA-D was generated by the PCRtechnique and subcloned into pDN18, resulting in pDN18-PCR. Plasmids pDN18 and pDN18-PCR were introduced byconjugation into the deletion mutant XG9, transposon mutantsT9 and T10, the pilD mutant B30, and wild-type PAK. Eachstrain was tested for the ability to excrete alkaline phosphatase

wild-type pilD T9 XG9C P E C P E C P E C P E

Exotoxin A-> _ __

FIG. 2. Localization of exotoxin A in P. aeruginosa protein-excretion mutants by immunoblotting. Cells of wild-type, pilD mu-tant B30, transposon mutant T9, and deletion mutant XG9 werefractionated into extracellular (E), periplasmic (P), and cell-associated (C) components as described (12). Equivalent volumes ofeach fraction were electrophoresed in an SDS/l0o polyacrylamidegel, transferred to nitrocellulose, and probed with anti-exotoxin Aserum. In all fractionations, >90% of (3-lactamase activity, assayedby hydrolysis of nitrocefin (33), was found in the periplasmiccompartment.

Microbiology: Nunn and Lory

Dow

nloa

ded

by g

uest

on

Apr

il 29

, 202

1

50 Microbiology: Nunn and Lory

120

GCGTGAATCAGAGCCGCCCATTGCAGCGCGCTCAACA;TCAGGTCCTCICCT TCATCTGGCTOCCGaCATCGGTGCCGCAIX;STGAPddA L uGlnArgrgGlnGlnSer~lyPhe'rL ull uIldMetVal1Ya1Va1IleLeuGlyI1eLeuAlaAlaLeuVa1alProGln~alMetSer

240XhoI

GCTCCCGACCAGGCCAAGGTCACCC;GGCTGGXACA5C TCt; W TCTGCCGCGCTGGACATG CTACAAGCTGGACAACTTCGCCTATCCGAGCACCCAGCAGGGCCTCGA;AGArgProAspGlnhlaLysValThr~a lAlaLya~lyA pIl1*LyzAlaI1 A1aA1 AlaLeuAsp~etTyrLysLeuAsphsnPheAl aTyrProSerThrGl nGl nGlyLeuGluAla

360

CGCTGGTGAAGAAGCCCACCGGCAATCCGCAGCC _ CGGTCGATCCGTGGGGCAATCCCTACCAGTACCTGGCGCCGGGCACCALeuVal1LysLysProThrGlyAsnProGlnProLysAsnTrphsnLysAspGlyTyrL auLysLysLeuProVa lAspProTrpGlyAsnProTyrGl nTyrLeuAl aProGlyThrLys

480

AGGGCCCGTTCGACCTGTATTCGCTGGGCGtCCGACGiGXAGAAGGOCACGGACAACGACGCCGACATCGGCAACTSGAACGACCGGACATGCGGGCTTCGCGQCACCGlyProPheAspLeuTyrSerL uGlyAlaAspGlyLysGluGlyGlyThrAspAsnAspAlaAspIl.GlyAsnTrpAspAsn * PddB MetArgAlaSerArgGlyPheThrLeu

600

IrCCXGCTGATGGTGGTGATGGTCATCATCA<;CGTGCT :I =GG:1:CCCSGC:CTCGCGGGAGCTGGACAGCG;U.CGAGCGGCTCGCCGGGCIleGl uLeuMet~al1Va lletVal IloIlSer~a lLeuI l GlyLeuAlaVa lLeuSerThrGlyPh AlaSerThrSerArgGl uLeuAspSerGl uAlaGluArg~oeuAlaGlyLeu

720

TGATCGGCGTGCTGACCG.ACGAGGCCGTGCTGGACAACCGCGAGTACGGCCTGCGCCTGGAGCGCGATGCCTACCAGGTACTGCGCTACGACGAcAGCGAACGCGCGCTGGTTGCCGG;TGGIl1eGly~alLeuThrAspGluAlaValLeu~sphsnArgGl uTyrGlyL uArgLeuGluArgAsphlaTyrGl nValLeuArgTyrAspGl uAla~snAlaArgTrpLeuProVa lAla

840

CGCGCGACAGCCACCGCCTGCCGGAGTGGG;CGGAGCTGACCTTCGAGCTGGACGGCCAGCCGCTGGTGCTGGCCGG ^AGCAGCG kGGAGCAGAAGAAG CCGACCAGCCGCArgAspSerHisArgLeuProGl uTrpAlaGl uLeuThrPheGl uLeuAspGlyGl nProLeu~a lLeuAlaGlySerLysGlyGl uLysGl uGlnLysLysGlyThrAspGl nProGl n

960

AATTGCTGATCCTCTCCAGGCGAACICGCCGTTCCGCCTGCGCCTGGCCGAGCGCGGACCCGAGGGGCGGGCGTTGTCGCTGAkGCAGCGACGGTTTCCGCCTGCCACGGGTCGAGGLeuLeuI leLeuSerSerGlyGl uTeuSerProPheeArgLeuArgLeuAlaGl uArgGlyProGl uGlyArgAlaLeuSerLeuSerSerAspGlyPheArgLeuProArgValGl uVal1

1080PstI

TGGCGCGGCGATGAAGGCGCGCGCGT _ C 1GGCTGTG1CCTGGCGATCTTCGCCATGGTCGCGGCCAGCGTGCTCAGTGCCAGCG;CGCGCAGCCTGCAGAACGCPddC MetLysArgAlaArgGlyPhe7hrLeuLeuGLalLeuValAlaLeuAlaIlePhaAlaMet~alAlaAlaSerValeuSerAlaSerAlaArgSerLeuGlnAsnAla

AlaArgArg * 1200

CTCGCGGCTGAGCAAGACCCTGGCGATGTG¢A TCGCCGACAACCGTUCTCCGAATTGCAACTGGAACAGAICGCCGCCCTCCAGCGGCCGCAACCAGGGCGAGCTGGAGTTCGCCOGSerArgLouGl uAspLysThrL uAlaetTrpIleAla~pAsnArgL uAsnGluLeuGlnLeuGl uGlnThrProProSerSerGlyArgAsnGl nGlyGl uLeuGl uPheAlaGly

1320SalI

GCGCCGCTGWGTGGCCGCAC~CCAGGTCGACAGCACCGCCGAGCAGGATATGCGGCGGGTGATCGTCTGGGTCGCGGCGAAGCCCCTCGGCCGCGAGCGTGGCAGCATCGAGGAACGCOCArgArgTrpGl uTrpArgThrGlnValAspSerThrAlaGl uGlnAsp~etArgArgVa lIleValTrpVa lAlaAlaLysProLeuGlyArgGl uArgGlySerIleGl uGl uArgAla

1440XhoI

CGCGGCGCGCCTCGTCGGTTTCCTC GGGA GCCAGCCA TGAGGCTACAGC r GCTGATCGCCATCGCCATCTTCGcCCTGCTGGcCCTGGCCACCTACCGCPddD MetArgLeuGlnArgGlyPhe.hrLeuLeuGluLeuLeuIleAlaIleAlaIlePheAlaLeuLeuAlaLeuAlaThrTyrArg

AlaAlaArgLeuValGlyPheLeuGlySerGlnPro * 1560

ATGTTCGQCAGCGTGATGCAGACCGACCAGGCGACTCC;GGCAGAGAGGCATGCGCGAGCTGGTGCGGGCG.ATGGGCGCCCTGGAGCGCGACCTGACCCAGGCGGTCGAACGTCCGM~etPheAspSerValMetGlnThrAspGlnAlaThrArg~alGlnGl uGlnArgMetArgGluLeuValArgAlaMetGlyAla LeuGluArgAspLeuThrGl nAlaVa lGluArgPro

1680

GTACGCGACGAGCTGGGCQATAACCGTGCCGCCTTCCTCAGCGAGCGAGAACGACCAGATCGTCGAACTCACCCGTGGTGGCTGGCGCAACCCGCTCGGCCAGGCGCGCTCGCGCCTGValArgAspGluLeuGlyAsp~snArgGlyAlaPheLeuSerGl uGlyGluAsnAspGlnI leValGluLeuThrArgGlyGlyTrpArgAsnP roLeuGlyGlnAlaArgSerArgLeu

1800PstICAGCGGCTGCGCTGG5 C CC=C1SAXTQCGCCGCTAC;GG~nTGGCAGCAGCAAGCCACGGGTGCAGCAGGTGCTGGACGGGGTTACCGCGCTGGlnArgValArgTrpSerLeuSerGlyGluThrLeuGlu~rgwr~rTrpLeuVal LeuAspArgAlaGl nAspSerLysProArgVal GlnGlnValLeuAspGlyVal1ThrAlaLeu

19202

AGCTGG CGCTTCCTC ACGC CCGACCCCGACG WACGAGGCGCCTGGAAAGCCTGCCGCTGCGCTGGTGACCCTGGAGCACCGCSerTrphrgPheLeuAspLysGluH1isAsnTrpGlnGlyHisTrpProThrAspGl uGlySerGl uGluGluArgLeuGluSerLeuProLeuAlaVal Glut~etThrLeuGl uHlisArg

2040

CACTACGGAGTGTGCGCGTCTGGCGTCTGCTCGATCCGCCGCTCAAGCAGCACGACAGCCGGGCGGCGAG;AATGGC GAGACGGCGAGGGCGGAGTGCCGCAGCCGHisTyrGlyLysLeuValArgValTrpArgLeuLeuAspProProLeuLysGlnAspGlnProGlnGlyGlnProGlyGlyGluAsnGlyGluAsnGlyGl uGlyGlyVa lProGlnPro

CCGGAAGGCATGCCGGGGC MCG C GCTGATCACCGTGCTG-2108bpProGluGlyMetProGlyAlaProGlu

and phospholipase C (Table 1, experiment C). The introduc-tion of the sequences encoding PddA-D restored excretion(albeit incompletely) to deletion mutant XG9. Plasmid pDN18-PCR did not restore excretion to thepilD mutant or transposonmutants T9 or T10, since the PCR product did not containsequences affected in these mutants (data not shown). Theseresults demonstrate that at least one of the pdd genes (pddD)is essential for protein excretion and that downstream geneexpression is unaffected in the XG9 mutant.

DISCUSSIONWe previously proposed that one or more components of theprotein excretion machinery of P. aeruginosa are cleaved bythe PilD prepilin peptidase (12, 14). This conclusion wasbased on the pleiotropic export defect of mutants in the pilDgene and the similarities of the type IV pilin with proteinsrequired for the excretion of pullulanase by K. oxytoca(PulG-J) and uptake of DNA by B. subtilis (ComG openreading frames 3-6) (14, 26). In this study we have isolatedseveral excretion-defective mutants and used oligonucleotideprobes to identify the genes for four proteins that are requiredfor protein excretion. These proteins, PddA-D, share at least

FIG. 3. Nucleotide sequenceof PilD-dependent protein (pdd)genes. DNA sequence, relevantrestriction sites, and translation ofregion encoding the PddA-D pro-teins of P. aeruginosa PAK areshown. Arrows define the se-quence used in designing primersfor PCR amplification of DNAfragment cloned into pDN18-PCR. Sequences underlined arethose homologous to oligonucleo-tide probes designed to recognizethe conserved region (in italics)shared by the type IV pilins, theK. oxytoca PulG-J proteins, andB. subtilis ComG proteins (14).bp, Base pairs.

two distinguishing characteristics, in addition to the consen-sus cleavage site, with the type IV pilins and the pilinhomologues ofK. oxytoca and B. subtilis. Each appears to be

1 2 3 4

IpreilnA* =oo, pre-PddC

,p-~w --_ " PddC

FIG. 4. Dependence of cleavage of PddC on PiID prepilin pep-tidase expression. Autoradiograph of "S-labeled proteins expressedin a coupled T7RNA polymerase-promoter gene expression system.Lane 1, wild-type P. aeruginosa PAK(pDN18, pMMBT7); lane 2,pilD mutant 2B18(pDN18, pMMBT7); lane 3, wild-typePAK(pDN18pddC, pMMBT7); lane 4, pilD mutant 2B18-(pDN18pddC, pMMBT7).

Proc. Natl. Acad. Sci. USA 89 (1992)

Dow

nloa

ded

by g

uest

on

Apr

il 29

, 202

1

Proc. Natl. Acad. Sci. USA 89 (1992) 51

FIG. 5. Comparison of N-terminal se-Prepilin MetLysAlaGlnLy y Ph.ThrLeuIl@G1 uetIleValVaLSlaIle1.GlyIlLe.uASAlallIAlaIl Pro- quences of P. aeruginosa prepilin PilAPddA I*uGlnArgArgGlnGlflS@ 41y Ph-ThrLeuI1eG1lu l*MltValValValVal5I1L*uGlyIlYeuAlUAlaLuValValPro and PddA-D. Boxed sequence repre-PddB MetArgAlaSerAr PheThrLouIleGl lutValVa1MetValIleIleSerValIuIleGlyLuAlaV&lLeu-PddC MtLysArgAlaAr ly PheThrLOuLeuG1 lLeuValAluAla~llPheAlaM~tValAlaaSrValeuSr- sents the consensus cleavage site (v) rec-PddD MtArgIeuGlnAr ly PheThrLeuLeuGl LeulleAlaIleAlallPheAlaLeuLeuklaLouAlaThrTyrArg ognized by the PilD prepilin peptidase.

synthesized with a short, basic leader sequence preceding thepredicted PilD-dependent cleavage site (Fig. 5). In addition,the 16-20 residues that follow show the pronounced hydro-phobic character seen in the type IV pilin subunit.We have demonstrated that the processing of at least one

of the proteins (PddC) requires the pilD gene product. Thisresult strongly suggests that the previously reported excre-tion defect of the pilD mutant is due to an inability of themutant to process the precursor forms of the PddA-D,preventing their proper localization and/or assembly into aprotein-excretion apparatus. It is probable that, like the pilinmonomer, these proteins are located in the bacterial cellenvelope prior to their cleavage and assembly, and thehydrophobic character of the conserved N termini acts as amembrane localization signal (34). The N-terminal hydro-phobic region of mature pilin has also been implicated in thesubunit-subunit interactions during pilus assembly (35). Sim-ilarly, the hydrophobic region of the PddA-D proteins mayplay a role in their assembly into a macromolecular structureessential for protein excretion. The assembly of such astructure will no doubt require the functions of additionalproteins. Preliminary DNA sequence analysis of the regionupstream of the pdd genes has shown the presence of twoopen reading frames encoding proteins with significant over-all homologies to the previously described pilus biogenesisproteins PilB and PilC (13), suggesting that homologues ofPilB and PilC are required for the assembly of an excretionapparatus containing PddA-D.The protein-excretion mutants isolated in this study all

resulted from transposon insertions within a 6.2-kb region ofthe P. aeruginosa chromosome. This size suggests thatadditional gene products in that region are required forprotein excretion. The clustering is reminiscent of the 13genes required for pullulanase excretion by K. oxytoca (8).Two genes in this cluster, pulE and pulF, are located imme-diately upstream of the pulG-J genes and encode proteinsthat show significant homology to PilB (39% identity) andPilC (30%o identity), respectively. These observations suggestthat the expression, cleavage, and assembly of the pilin-likeproteins into a proposed excretion apparatus requires thefunctions ofa large number of accessory gene products (in K.oxytoca, PulE, -F, -G, -H, -I, -J, and -0; in P. aeruginosa,PilB and PilC homologues, PilD, and PddA-D).The primary effect of mutations in the pdd genes is an

export defect leading to the periplasmic accumulation ofproteins that normally are excreted. The accumulated pro-teins appear to be processed correctly by signal peptidase Iand are fully folded, suggesting that the P. aeruginosaexcretion apparatus functions to facilitate the excretion ofproteins after they have been translocated across the cyto-plasmic membrane via the primary export pathway.The PddA-D proteins of P. aeruginosa might play a

structural role in a protein-excretion apparatus by serving tobridge the inner and outer membranes, creating adhesionzones (Bayer's junctions) (36) that have previously beenimplicated in protein excretion (37). Alternatively, theseproteins may play a more active role in excretion by servingas a conduit, generated by continuous polymerization of thesubunits, through or on which the excreted proteins aretransported out of the cell. Because energy is very likelyrequired for the excretion process, this model would allow forphysical coupling of an inner membrane-derived proton-motive force to excretion by providing energy to drive

polymerization of the PddA-D proteins from the cytoplasmicmembrane. Obviously for this process to occur and becontinuous, the depolymerization of the PddA-D proteinsubunits is essential. Support for this model may be providedby the apparent ability of the P. aeruginosa pilin subunit topolymerize into a mature pilus and to depolymerize duringthe course of pilus retraction (38).

We thank Mark Strom for helpful discussions and critical readingofthe manuscript. This work was supported by Public Health ServiceGrant A121451 of the National Institutes of Health and a Researchand Development Program grant from the Cystic Fibrosis Founda-tion. D.N.N. was supported by a postdoctoral fellowship from theCystic Fibrosis Foundation. S.L. is a Research Scholar of the CysticFibrosis Foundation.

1. Bieker, K. L., Phillips, G. J. & Silhavy, T. J. (1990) J. Bioenerg.Biomembr. 22, 291-310.

2. Model, P. & Russel, M. (1990) Cell 61, 739-741.3. Holland, I. B., Kenny, B. & Blight, M. (1990) Biochimie 72, 131-141.4. Wandersman, C. & Delepelaire, P. (1990) Proc. Nati. Acad. Sci. USA 87,

4776-4780.5. Glaser, P., Sakamoto, H., Bellalou, J., Ullmann, A. & Danchin, A. (1988)

EMBO J. 7, 3997-4004.6. Masure, H. R., Au, D. C., Gross, M. K., Donovan, M. G. & Storm,

D. R. (1990) Biochemistry 29, 140-145.7. Letoffe, S., Delepelaire, P. & Wandersman, C. (1990) EMBO J. 9,

1375-1382.8. Pugsley, A. P., d'Enfert, C., Reyss, I. & Kornacker, M. G. (1990) Annu.

Rev. Genet. 24, 67-90.9. Wretlind, B., Sjoberg, L. & Wadstrom, T. (1977) J. Gen. Microbiol. 103,

329-336.10. Wretlind, B. & Pavlovskis, 0. R. (1984) J. Bacteriol. 158, 801-808.11. Filloux, A., Bally, M., Murgier, M., Wretlind, B. & Lazdunski, A. (1989)

Mol. Microbiol. 3, 261-265.12. Strom, M. S., Nunn, D. & Lory, S. (1991) J. Bacteriol. 173, 1175-1180.13. Nunn, D., Bergman, S. & Lory, S. (1990) J. Bacteriol. 172, 2911-2919.14. Nunn, D. N. & Lory, S. (1991) Proc. Natl. Acad. Sci. USA 88, 3281-

3285.15. Saiman, L., Ishimoto, K., Lory, S. & Prince, A. (1990)J. Infect. Dis. 161,

541-548.16. Miller, J. H. (1972) Experiments in Molecular Genetics (Cold Spring

Harbor Lab., Cold Spring Harbor, NY).17. Davis, B. D. & Mingioli, E. S. (1950) J. Bacteriol. 60, 17-28.18. Birnboim, H. C. & Doly, J. (1979) Nucleic Acids Res. 7, 1513-1523.19. Strom, M. S. & Lory, S. (1986) J. Bacteriol. 165, 367-372.20. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular Cloning:A

Laboratory Manual (Cold Spring Harbor Lab., Cold Spring Harbor, NY).21. Southern, E. M. (1975) J. Mol. Biol. 98, 503-517.22. Figurski, D. & Helinski, D. R. (1979) Proc. NatI. Acad. Sci. USA 74,

1658-1665.23. Lory, S. & Tai, P. C. (1983) Gene 22, 95-101.24. Yanisch-Perron, C., Viera, J. & Messing, J. (1986) Gene 55, 103-119.25. Furste, J. P., Panseegrau, W., Frank, R., Blocker, H., Scholz, P.,

Bagdasarian, M. & Lanka, E. (1986) Gene 48, 119-131.26. Albano, M., Breitling, R. & Dubnau, D. A. (1989) J. Bacteriol. 171,

5386-5404.27. Breitling, R. & Dubnau, D. (1990) J. Bacteriol. 172, 1499-1508.28. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R.,

Horn, G. T., Mullis, K. B. & Erlich, H. A. (1988) Science 239,487-491.29. Bolivar, F., Rodriguez, R. L., Greene, P. J., Betlach, M. C., Heynecker,

H. L., Boyer, H. W. & Crosa, J. H. (1977) Gene 2, 95-101.30. Tabor, S. & Richardson, C. C. (1985) Proc. Natl. Acad. Sci. USA 82,

1074-1078.31. Brickman, E. & Beckwith, J. (1975) J. Mol. Biol. 96, 307-316.32. Berka, R. M., Gray, G. L. & Vasil, M. L. (1981) Infect. Immun. 34,

1071-1074.33. Jones, R. N., Wilson, H. W. & Novick, J. W. J. (1982) J. Clin. Micro-

biol. 15, 677-683.34. Strom, M. S. & Lory, S. (1987) J. Bacteriol. 169, 3181-3188.35. Watts, T. H., Kay, C. M. & Paranchych, W. (1983) Biochemistry 22,

3640-3646.36. Bayer, M. E. (1979) in Bacterial Outer Membranes: Biogenesis and

Functions, ed. Inouye, M. (Wiley, New York), pp. 167-202.37. Lory, S., Tai, P. C. & Davis, B. D. (1983) J. Bacteriol. 156, 695-702.38. Bradley, D. E. (1980) Can. J. Microbiol. 26, 146-154.

Microbiology: Nunn and Lory

Dow

nloa

ded

by g

uest

on

Apr

il 29

, 202

1