Comparative Proteomic Analysis of Triclabendazole Response in The

Comparative Proteomic Analysis of Triclabendazole Response in the

Liver Fluke Fasciola hepatica

Gustavo Chemale,†,‡ Samirah Perally,†,‡ E. James LaCourse,*,‡,§ Mark C. Prescott,|

Laura M. Jones,† Deborah Ward,| Myles Meaney,⊥ Elizabeth Hoey,⊥ Gerard P. Brennan,⊥

Ian Fairweather,⊥ Alan Trudgett,⊥ and Peter M. Brophy†

Institute of Biological, Environmental and Rural Sciences, Aberystwyth University, United Kingdom SY23 3DA,Liverpool School of Tropical Medicine, United Kingdom L3 5QA, School of Biological Sciences, Queens

University Belfast, United Kingdom, and School of Biological Sciences, The University of Liverpool, Liverpool,United Kingdom L69 7ZB

Received February 24, 2010

Control of Fasciola hepatica infections of livestock in the absence of vaccines depends largely on thechemical triclabendazole (TCBZ) because it is effective against immature and adult parasites. Overde-pendence on a single drug and improper application is considered a significant factor in increasingglobal reports of fluke resistant to TCBZ. The mode(s) of action and biological target(s) of TCBZ arenot confirmed, delaying detection and the monitoring of early TCBZ resistance. In this study, to furtherunderstand liver fluke response to TCBZ, the soluble proteomes of TCBZ-resistant and TCBZ-susceptibleisolates of F. hepatica were compared with and without in vitro exposure to the metabolically activeform of the parent drug triclabendazole sulphoxide (TCBZ-SO), via two-dimensional gel electrophoresis(2-DE). Gel image analysis revealed proteins displaying altered synthesis patterns and responses bothbetween isolates and under TCBZ-SO exposure. These proteins were identified by mass spectrometrysupported by a F. hepatica expressed sequence tag (EST) data set. The TCBZ responding proteins weregrouped into three categories; structural proteins, energy metabolism proteins, and “stress” responseproteins. This single proteomic investigation supported the reductionist experiments from manylaboratories that collectively suggest TCBZ has a range of effects on liver fluke metabolism. Proteomicshighlighted differences in the innate proteome profile of different fluke isolates that may influencefuture therapy and diagnostics design. Two of the TCBZ responding proteins, a glutathione transferaseand a fatty acid binding protein, were cloned, produced as recombinants, and both found to bind TCBZ-SO at physiologically relevant concentrations, which may indicate a role in TCBZ metabolism andresistance.

Keywords: Fasciola hepatica; triclabendazole • 2-DE • glutathione transferase • fatty acid binding protein

Introduction

The trematode liver fluke, Fasciola hepatica, along withFasciola gigantica are the causative agents of fasciolosis, afoodborne zoonotic disease affecting grazing animals andhumans worldwide. Liver fluke causes economic losses of overUS$ 3 billion worldwide per annum to livestock via mortality,reduction in host fecundity, susceptibility to other infections,decrease in meat, milk, and wool production, and condemna-tion of livers.1 The disease is increasing in livestock worldwide,2,3

with a number of potential contributing factors: climate change(warmer winters and wetter summers supporting larger inter-

mediate mud snail host populations); fragmented diseasemanagement (only treating sheep not cattle and limitingveterinary interaction); encouragement of wet-lands; livestockmovement; and/or failure/resistance of chemical control treat-ments in the absence of commercial vaccines. Fasciolosis isalso a re-emerging human disease with estimates of between2.4 and 17 million people infected worldwide.4 Climate changes,altered land use, socio-economic factors and livestock move-ments have been considered in providing the opportunity forincreased spread and introduction of pathogenic isolates tohumans. The World Health Organisation’s recent shift in policyfor this emerging disease has paved the way for fasciolosis tobe added to the preventative chemotherapy concept.5 Thismove is in response to the re-emergence of human fasciolosisand is supported by Novartis Pharma AG to implement large-scale drug distributions where fasciolosis is a public healthconcern.6

Control programs for F. hepatica, in the absence of com-mercial vaccines, rely on chemical treatments.7 Most flukicidal

* To whom correspondence should be addressed. E. James LaCourse.E-mail: [email protected]. Tel: +44 (0) 151 705 3153. Fax: +44 (0) 151 7053370.

† Aberystwyth University.‡ These authors contributed equally to this work.§ Liverpool School of Tropical Medicine.| The University of Liverpool.⊥ Queens University Belfast.

4940 Journal of Proteome Research 2010, 9, 4940–4951 10.1021/pr1000785 2010 American Chemical SocietyPublished on Web 07/19/2010

drugs target adult worms responsible for chronic fasciolosis andnot acute pathogenic infections caused by immature flukemigrating through liver.8 Triclabendazole (TCBZ; Fasinex andEgaten, Novartis Animal Health), a novel benzimidazole-derivative, offers high activity against both young pathogenicjuvenile fluke and the adults present in chronic infections.9

TCBZ has been the front-line defense against liver fluke diseasefor over 20 years, both in domestic livestock and humans.However, TCBZ-resistant liver fluke are spreading throughoutEurope and Australia, compromising control efforts.8-10 Fol-lowing end of patent protection, generic forms of TCBZ willlikely lead to wider application, potential misuse and exacerba-tion of the spread of resistance.

The mode of action of TCBZ at the molecular level has yetto be resolved. Laboratories report a variety of effects of TCBZon liver fluke including disruption of egg formation,11 proteinsynthesis inhibition12 and stimulation of glucose-derived for-mation of acetate and priopionate.13 Many studies focused onmicrotubule-disrupting action, inferring that, like other ben-zimidazole-derivative anthelmintics (BZs) in nematodes, TCBZmay also exert its effect directly or indirectly via tubulin.7,9 Theinhibition of cell division in the vitelline, spermatogenic andoogonial cells11,14,15 the inhibition of transport of secretorybodies in the tegument16 and the inhibition of tubulin stain-ing16 all support this idea. However, TCBZ-resistant isolates ofF. hepatica remain susceptible to the benzimidazole, albenda-zole (ABZ), with TCBZ resistance appearing unrelated to singlemutations in the �-tubulin gene from liver fluke.18-19 Moreover,TCBZ is not effective against other helminths. TCBZ must atleast have different tubulin binding site(s) from other BZs ifnot different primary and/or biological system targets.20,21

TCBZ-resistant fluke have also been shown to accumulateless TCBZ and its metabolites than susceptible fluke,22 withdrug entry into the parasite occurring mainly through passivelipophilic diffusion across the tegument rather than orally.23

Uptake of the related BZ compound albendazole (ABZ) doesnot differ between resistant/susceptible fluke, indicating thatperhaps the efflux of drug is only one of several potentialcontributory factors to resistance.24 Possible transporters fordrug efflux include the P-glycoproteins (Pgp), of which ahomologue has been identified in F. hepatica, although onlyfound to be expressed in immature fluke.25 Additionally,treatment of fluke with ivermectin, a substrate of Pgp, returnsaccumulation of TCBZ in resistant F. hepatica to that ofsusceptible isolates.28 Furthermore, it has been reported thatthe co-treatment of resistant fluke with TCBZ and another Pgpinhibitor, R(+)-verapamil, demonstrated severe disruption tothe tegument surface, in contrast to the minimal disruptionfound in the absence of R(+)-verapamil, thus supporting a rolefor efflux pumps in TCBZ resistance.8

The increased efflux of TCBZ is unlikely to be solely res-ponsible for resistance phenotype. Biotransformation andmetabolism of TCBZ is also hypothesized to play a major rolein detoxification. TCBZ is, mainly oxidized by host liver to formthe major active metabolite, triclabendazole sulphoxide (TCBZ-SO), and a lesser proportion of other metabolities (triclabenda-zole Sulphone (TCBZ-SO2) and hydroxylated metabolites (OH-TCBZ, OH-TCBZ-SO and OH-TCBZ-SO2).26 Fluke have alsobeen shown to metabolize TCBZ, with TCBZ-resistant flukeoxidizing TCBZ more efficiently than susceptible isolates,converting the proposed major active form TCBZ-SO, to apotentially less active form, TCBZ-SO2.22,27 Although the en-zymes mediating this biotransformation have yet to be identi-

fied, the use of cytochrome P450 and flavin mono-oxygenasesubstrates and inhibitors in studies with fluke support thepotential for existence and involvement of these enzymes inthe metabolism of and resistance to TCBZ.22,28 It may be thatthe increased production of oxidized and hydroxylated me-tabolites in resistant fluke allows more efficient detoxificationvia phase II and phase III conjugation, inactivation and effluxmechanisms. Passive protein-binding of TCBZ has also beenproposed as a mode of resistance restricting drug availabilityat the specific intracellular target site of action.24

The multiple effects on the biochemistry and physiology onF. hepatica suggests that TCBZ interacts both directly andindirectly with many different biological systems.8 Unravelingsuch potentially complex interactions requires a nonreduc-tionist approach. Array technologies offer such an opportunityto study fasciolicidal activity on a wider scale and, in the caseof proteomics technologies supported by an EST data set29 forprotein identification, at the functionally relevant phenotype-directing protein level.

We report differences between soluble proteome profilesfrom well-characterized TCBZ-susceptible (Cullompton isolate)and TCBZ-resistant (Sligo isolate) F. hepatica when exposedor not exposed to the active form TCBZ-SO.

Experimental Procedures

Fluke Isolates. Fluke isolates were maintained at QueensUniversity Belfast. TCBZ-susceptible F. hepatica isolate (termed“Cullompton isolate”) was originally obtained from an abattoirin Cullompton, Devon, U.K. in 1998 and was shown to besusceptible to TCBZ.30,31 TCBZ-resistant F. hepatica isolate(termed “Sligo isolate”) was originally obtained from sheeplivers in Sligo, Ireland in 1998 and shown to be resistant toTCBZ.30,32

In Vitro Drug Treatment. Eight-week-old fluke of Cullomp-ton and Sligo isolates were removed from the bile ducts of rathosts under sterile conditions, and washed in sterile NCTC 135culture medium at 37 °C (Flow Laboratories, Oxfordshire, U.K.),containing antibiotics (penicillin, 50 IU/mL; streptomycin, 50mg/mL. Sigma, U.K.). Whole fluke were transferred indepen-dently to fresh culture medium (1 fluke per 5 mL) containingeither solvent control or TCBZ-SO at a clinically relevantconcentration of 15 µg/mL or a higher concentration routinelyused within the laboratory to ensure fluke exhibit the resistantphenotype, of 50 µg/mL26,33 and incubated for 6 or 12 h at 37°C. Following incubation, fluke from the range of cultures werevisually assessed regarding their relative movement. Thisrelative assessment was to ensure tolerance or susceptibilityto drug exposure remained evident at a phenotypic level in theisolates. A relative scoring system based on the extent ofmovement in comparison to that of controls was used and isdisplayed in Table 1. ++++ represented movement similar tocontrols while a decrease in the number of + means a relativedecrease in movement. Survival at the end of culture time isindicated by “/S”. Finally, fluke were removed, washed inphosphate buffered saline, snap frozen in liquid nitrogen andstored at -80 °C. At least four individual F. hepatica were usedin each experiment.

Cytosol Preparations. F. hepatica extracts were obtained byhomogenization of frozen fluke at 4 °C in a glass grinder inlysis buffer, containing 50 mM Tris-HCl, pH 7.4, 0.2% Triton-X100, 5 mM DTT and a cocktail of protease inhibitors (Roche,Mini-Complete, EDTA-free). After homogenization, sampleswere sonicated with four pulses of 30 s on ice and centrifuged

Triclabendazole Response in Fasciola hepatica research articles

Journal of Proteome Research • Vol. 9, No. 10, 2010 4941

at 100 000× g for 1 h at 4 °C and the supernatant was termedthe cytosolic fraction.

2-DE. Cytosolic protein extracts were precipitated with anequal volume of ice-cold 20% TCA in acetone (w/v) and washedtwice in ice-cold acetone before solubilization into isoelectricfocusing buffer (IEF buffer) consisting of 7 M urea, 2 Mthiourea, 4% w/v CHAPS, 66 mM DTT and 0.5% carrierampholytes v/v (Biolyte 3-10, Bio-Rad). One mg of eachreplicate sample was passively in-gel rehydrated for 16 h andisoelectrically focused on 17 cm pH 3-10NL IPG strips (BioRad)to 60 000 Vh on a Protean IEF Cell (Bio-Rad). After focusing,strips were equilibrated for 15 min in reducing equilibrationbuffer (30% v/v glycerol, 6 M urea, 1% DTT) followed by 15min in alkylating equilibration buffer (30% v/v glycerol, 6 Murea, 4% iodoacetamide). IPG strips were run upon sodiumdodecyl sulfate polyacrylamde gel electrophoresis (SDS-PAGE)(12.5% acrylamide) using the Protean II xi 2-D Cell (BioRad).Gels were Coomassie blue stained (Phastgel Blue R, AmershamBiosciences) and scanned on a GS-800 calibrated densitometer(BioRad).

Gel Image Analysis. Gel image quantitative differencesbetween protein spots were analyzed via Progenesis PG220software, version 2006 (Nonlinear Dynamics). Spots weremanually detected on gels with background subtraction per-formed according to mode of nonspot, accepting the defaultmargin parameter of 45 and normalization performed usingtotal spot volume multiplied by 100. Gel images were thenwarped and spots manually matched to the reference gel.Averaged gels (based on mean normalized spot volumes) werecreated from four biological replicates. When creating anaveraged gel the maximum number of gels in which spots maybe absent was set to 0. Differences between normalized spotvolumes with Student t test values of p < 0.05 were consideredsignificant when average gels were compared.

Protein Identification.Excision and In-Gel Tryptic Digest of Protein Spots. Protein

spots were manually excised and destained in 50% (v/v)acetonitrile (ACN), 50 mM ammonium bicarbonate (Ambic) at37 °C until clear of blue stain before dehydration in 100% ACNat 37 °C for 30 min. Proteins were digested by rehydrating gelplugs overnight with 10 ng/µL trypsin in 50 mM Ambic at 37°C. Following digestion, 30 µL 60% (v/v) Ambic, 5% (v/v) formicacid was added to gel plugs before water bath sonication for 3min. Gel plugs were centrifuged for 30 s at 16 000× g andsupernatant removed to a clean tube. This “Ambic/formic acid/sonication” step was repeated, supernatants pooled, and

vacuum-dried before resuspension of peptides in 20 µL 0.1%(v/v) formic acid for LC-MS/MS analysis.

Liquid Chromatography-Tandem Mass Spectrometry(LC-MS/MS). Peptide mixtures from trypsin digested gel spotswere separated using a LC Packings Ultimate nano-HPLCSystem. Sample injection was via an LC Packings Famosautosampler and the loading solvent was 0.1% formic acid. Theprecolumn used was a LC Packings C18 PepMap 100, 5 mm,100 A and the nano HPLC column was a LC Packings PepMapC18, 3 mm, 100 A. The solvent system was: solvent A (2% ACNwith 0.1% formic acid), and solvent B (80% ACN with 0.1%formic acid). The LC flow rate was 0.2 µL/min. The gradientemployed was 5% solvent A to 100% solvent B in 1 h. The HPLCeluent was sprayed into the nano-ES source of a WatersQ-TOFµ MS via a New Objective Pico-Tip emitter. The MS wasoperated in the positive ion ES mode and multiply charged ionswere detected using a data-directed MS/MS experiment. Col-lision induced dissociation (CID) MS/MS mass spectra wererecorded over the mass range m/z 80-1400 Da with scantime 1 s.

Mass Spectra Analysis. MassLynx v 3.5 (Waters, U.K.)ProteinLynx suite of tools was used to process raw fragmenta-tion spectra. Each spectrum was combined and smoothed twiceusing the Savitzky-Golay method at (3 channels with back-ground noise subtracted at polynomial order 15 and 10% belowcurve. Monoisotopic peaks were centered at 80% centroidsetting.

Sequest compatible (.dta) file peak mass lists for eachspectrum were exported, and spectra common to each 2-DEspot were merged into a single MASCOT generic format (.mgf)file using the online Peak List Conversion Utility available atwww.proteomecommons.org.34 Merged files were submitted toa MASCOT MS/MS ions search within a locally installed Mascotserver (www.matrixscience.com) to search an “in-house” da-tabase constructed from 6260 (858 763 residues) Fasciolahepatica EST sequences downloaded and translated from theSanger Institute (ftp://ftp.sanger.ac.uk/pub/pathogens/fasciola/hepatica/ESTs/).

Search parameters were as follows: enzyme set at trypsinwith one missed cleavage allowed; fixed modification set forcarbamidomethylation with variable modification consideredfor oxidation of methionine; monoisotopic masses with unre-stricted protein masses were considered with peptide andfragment mass tolerances at (1.2 and (0.6 Da respectively foran ESI-QUAD-TOF instrument. Protein identifications resultingfrom MASCOT ions scores greater than 25 were considered asshowing significant identity or extensive homology (p < 0.05)to the predicted identification displayed (www.matrixscience.com).

Spectra that did not match any proteins, or scored nonsig-nificantly within F. hepatica EST database were researchedthrough MASCOT against the NCBI nonredundant database(NCBI http://www.ncbi.nlm.nih.gov/ nr release 20091112 con-taining 10 032 801 sequences; 3 422 028 181 residues). MASCOTscores for individual ions greater than 23 indicate significanthomology while scores above 51 indicate significant identityor extensive homology (p < 0.05). All MASCOT search param-eters and settings were as described above except that tax-onomy was restricted to “Metazoa” (1 804 634 sequences).

Spectra containing large amounts of low abundance ionmasses with mass peak lists too large to provide significantMASCOT scores, were interpreted via BioLynx automatedpeptide sequencing tools (MassLynx v 3.5). Raw spectra were

Table 1. Evaluation of Activity and Survival of Cullompton(Susceptible) and Sligo (Resistant) Liver Fluke Isolates afterTCBZ-SO Treatmenta

treatment Cullompton fluke (susceptible) Sligo fluke (resistant)

culture time 6h 12h 6h 12h

Nontreated ++++/S ++++/S ++++/S ++++/S15 µg/mL +++/S ++/S ++++/S ++++/S50 µg/mL +/S ND ++/S ND

a Fluke were exposed to TCBZ-SO and their movement assessed toprovide information about activity and tolerance to drug exposure.++++ represents movement similar to controls while a decrease in thenumber of + means a decrease in movement. Survival at the end ofculture time is indicated by “/S”.

research articles Chemale et al.

4942 Journal of Proteome Research • Vol. 9, No. 10, 2010

combined, smoothed, subtracted and centered as describedabove and deconvoluted using MaxEnt 3 software (MassLynxv 3.5). Precursor ion tolerance was set to 0.5 Da, fragment masstolerance was set to 0.1 Da and intensity threshold was set at1%. Amino acid modifications considered were carboxyami-domethylcysteine, cysteine acrylamide and methionine sul-phoxide, and trypsin was specified as the enzyme used forprotein digestion, two missed cleavages were permitted. Mini-mum mass standard deviation was set at 0.025 Da and thesequence display threshold (% Prob) set to 1. Highest rankedpeptide sequences were accepted. Where significant low abun-dance mass peaks (noise) made automated sequencing prob-lematic, fragmentation spectra were semiautomatically inter-preted using the sequence tag function of peptide sequencingsoftware (MassLynx v 3.5) with identical parameters as outlinedabove.

Protein Identification and Annotation of F. hepatica ESTSequences. The F. hepatica ESTs used here are at presentunannotated as to predicted protein identifications. F. hepaticaproteins identified via LC-MS/MS, were assigned putativeidentification based upon similarity to proteins with existingannotation within GenBank nonredundant database (all non-redundant GenBank CDS translations+PDB+Swiss-Prot+PIR+PRF excluding environmental samples from WGS projects(9 636 254 sequences; 3 294 494 089 total letters; Posted dateSep 2, 2009 5:42 p.m.; downloaded at ftp://ftp.ncbi.nih.gov/blast/db/).

Automated/manually interpreted peptide sequences fromMS/MS spectra were searched via BLASTp35 within the BioEditprogram (version 7.0.5.336 against an “in-house” database ofFasciola hepatica sequences (described earlier in ExperimentalProcedures). Where no significant matches were obtained,BLASTp was performed against GenBank (see below for data-base details).

F. hepatica EST sequences identified by either; MASCOTMSMS ions searches, and/or BLASTp of LC-MS/MS automated/manually interpreted peptides, were searched further viaBLASTp (version 2.2.20 [Feb-08-2009]37,38 against GenBank (allnonredundant GenBank CDS translations+PDB+Swiss-Prot+PIR+PRF excluding environmental samples from WGS projects(9 636 254 sequences; 3 294 494 089 total letters; Posted dateSep 2, 2009 5:42 p.m.; downloaded at ftp://ftp.ncbi.nih.gov/blast/db/) according to default settings.37,38 Proteins showingsimilarity with significant E-values (<1) were accepted asproviding putative homology for the purposes of identificationand annotation.

Recombinant Protein Production and Purification. Fh15(Acc. Q7M4G0) was amplified from mRNA isolated from F.hepatica adult worms in a PCR reaction containing forwardprimer 5′ GGTACCATATGGCTGACTTTGTGGGTTCGTGGA 3′and reverse primer 5′ CCTTGCGGCCGCTCAAATTCGTTTAAT-TCATAAGTGA 3′. Restriction enzyme sites for NotI and NdeI(shown in underlined bold text) were included for ease ofdirectional cloning into the pET23a (Novagen) expressionvector. mRNA was isolated from fluke via an RNAeasy kit(Qiagen) using the plant tissue protocol.

Peptides from 2-DE gel spot No. 16, matched F. hepaticaexpressed sequence tag (EST) database clone Fhep40e02(incomplete sequence) and GenBank protein sequence GST-51 (Acc. P30112). EST clone Fhep40e02 was supplied by Dr. E.Hoey, Queens University, Belfast for use as template for cloningand expressing this GST for further characterization. Forwardand reverse primers used to amplify GST clone Fhep40e02 were

5′ GGAATTCCATATGCCAGCCAAACTCGGA 3′ and 5′ ATAA-GAATGCGGCCGCTCAAGCCGGTGCAGCG 3′ respectively (re-striction sites indicated in underlined bold text). The subse-quent full clone sequence was submitted to GenBank (http://www.ncbi.nlm.nih.gov/Genbank/) receiving Accession numberACF59730.1 (Gene name Fh GST-26b).

Both Fh15 and GST-26b were expressed via the Escherichiacoli BL21(DE3) and pET23a expression vector system (Novagen).Recombinant F. hepatica Fh15 protein was purified from E. colicytosolic extract.39 Recombinant GST-26b was purified accord-ing to the method of van Rossum et al. 2004.40 Purity wasassessed by electrospray ionization (ESI) mass spectrometryand SDS-PAGE. Native FABPs were purified from F. hepaticasoluble cytosolic supernatants prepared as described.39 Purityof the proteins was assessed by SDS-PAGE.

Competitive Binding Assays with FABP. Binding of TCBZ-SO to recombinant Fh15 and native preparations of FABP fromfluke collected from a local abattoir (Dunbia, Llanybydder, U.K.)were examined by competitive fluorescence spectroscopy aspreviously described39,41 using a Shimadzu spectrofluorometer(RF-5301 PC). Binding of TCBZ-SO to Fh15 was measured bydisplacement of 8-anilino1-sulfonaphthalene (ANS) from theprotein. Briefly, 1 µM of recombinant Fh15 in 2.5 mL of 50 mMTris-HCl, pH 8.0, 150 mM NaCl was titrated with 0-120 µM ofANS, whereby saturation of Fh15 with ANS was achieved using100 µM of the compound. Competitive binding assays werecarried out using 1 µM protein in 2.5 mL of 50 mM Tris-HCl,pH 8.0, 150 mM NaCl. Freshly prepared TCBZ-SO solution in100% ethanol was titrated into the Fh15-ANS sample. Theprotein was allowed to equilibrate for 2 min upon the additionof 100 µM ANS prior to each fluorescence measurement. Thedisplacement of ANS was measured as the corresponding lossof fluorescence and was calculated as the decrease in areaunder the emission spectra between 430 and 600 nm followingexcitation at 400 mm. The final concentration of ethanol addedto the assay mixture was <10% v/v. Readings were correctedfor dilution and the ANS-only control, and titrating with ethanolalone did not affect ANS binding. The apparent dissociationconstant for rFh15 and TCBZ-SO, KD was estimated from adouble reciprocal plot of fluorescence quenching of the rFh15-ANS complex versus drug concentration. The essential fattyacid linoleic acid and known ligand of FABPs was used as apositive control for the displacement of ANS and to confirmfunctionality of our recombinant protein.

GST Inhibitor Concentration Assay. TCBZ-SO binding wasassessed by testing its inhibition of GST activity using CDNBas second substrate.42 Values were reported as the concentra-tion of inhibitor required to bring GST specific activity to 50%of its original activity (IC50). At least six different inhibitorconcentrations were used in each IC50 determination intriplicate. Inhibitors were preincubated for 5 min prior tostarting reactions. IC50 values were estimated graphically.43

Assays replacing inhibitor solutions with the equivalent volumeof ethanol did not significantly affect GST activity towardCDNB.

Results and Discussion

Phenotypic Effects of TCBZ-SO Exposure on Motility ofFluke. Exposure to TCBZ-SO in culture over six hours wasobserved to alter activity and movement of the drug-sensitiveCullompton liver fluke isolate compared to control cultureswithout drug; the higher dose (50 µg/mL) showing a markedreduction in movement. The more resistant Sligo isolate did



not exhibit any observable changes in motility after drugexposure at 15 µg/mL, and retained a relatively increased level

of motility after 50 µg/mL (6 h) compared to Cullomptonisolates (Table 1).

Table 2. Differential Protein Synthesis of F. hepatica Isolates Following Exposure to TCBZ-SO at 15 µg/mL or 50 µg/mL for 6 h, orNonexposed for 12 h in vitroa

% change in protein expression response to treatmentb

2-DE spot no. TCBZ-SO responding protein F. hepatica isolate 6 h 15 µg/mL 6 h 50 µg/mL 12 h 0 µg/mL

2 hsp90 Cullompton v35 (P 0.374) v11 (P 0.715) v80 (P 0.052)Sligo V-14 (P 0.393) V-22 (P 0.200) V-44 (P 0.037)

3.1 hsp70 Cullompton V-12 (P 0.692) V-15 (P 0.714) V-5 (P 0.881)Sligo V-56 (P 0.001) v-9 (P 0.344) V-22 (P 0.069)

3.2 hsp70 Cullompton V-11 (P 0.654) V-3 (P 0.903) V-29 (P 0.313)Sligo V-41 (P 0.034) V-12 (P 0.492) V-44 (P 0.037)

4 aldehyde dehydrogenase Cullompton V-14 (P 0.503) v66 (P 0.105) V-83 (P 0.006)Sligo v6 (P 0.866) v147 (P 0.015) V-40 (P 0.332)

5.1 Acetyl/propionyl-CoA carboxylase R Cullompton v109 (P 0.021) v159 (P 0.0001) v60 (P 0.009)Sligo V-29 (P 0.007) V-28 (P 0.048) V-39 (P 0.458)

5.2 Acetyl/propionyl-CoA carboxylase R Cullompton v87 (P0.002) v46 (P 0.004) v40 (P 0.078)Sligo V-22 (P 0.172) V-58 (P 0.010) V-29 (P 0.237)

5.3 Acetyl/propionyl-CoA carboxylase R Cullompton v131 (P 0.001) v70 (P 0.064) v111 (P 0.021)Sligo V-18 (P 0.013) V-44 (P 0.013) V-46 (P 0.020)

6 Acetyl/propionyl-CoA carboxylase � Cullompton v6 (P 0.759) v26 (P 0.258) v1 (P 0.947)Sligo v4 (P 0.760) V-35 (P 0.145) V-31 (P 0.002)

7 leucyl aminopeptidase Cullompton v107 (P 0.004) v258 (P 0.009) v215 (P 0.002)Sligo v24 (P 0.452) v1 (P 0.943) v106 (P 0.020)

8 PEPCK Cullompton v88 (P 0.126) NP V-60 (P 0.031)Sligo v130 (P 0.267) v1 (P 0.943) v106 (P 0.020)

9 enolase Cullompton v58 (P 0.141) v6 (P 0.863) v35 (P 0.240)Sligo v30 (P 0.217) v180 (P 0.117) v206 (P 0.047)

10.1 glutamate dehydrogenase Cullompton v23 (P 0.442) v91 (P 0.039) v111 (P 0.011)Sligo v26 (P 0.197) V-33 (P 0.009) V-15 (P 0.083)

10.2 glutamate dehydrogenase Cullompton v66 (P 0.158) v246 (P 0.004) v239 (P 0.008)Sligo v61 (P 0.309) v61 (P 0.022) v38 (P 0.009)

11 Actin Cullompton V-7 (P 0.260) V-17 (P 0.048) V-18 (P 0.017)Sligo V-14 (P 0.037) V-18 (P 0.013) V-9 (P 0.044)

12.1b fructose-1,6-bisphosphatase Cullompton v-107 (P 0.198) v-155 (P 0.017) v-90 (P 0.006)Sligo V-25 (P 0.253) V-33 (P 0.029) V-47 (P 0.002)

12.2 fructose-1, 6-bisphosphatase Cullompton v25 (P 0.234) v141 (P 0.005) v134 (P 0.002)Sligo V-48 (P 0.004) V-32 (P 0.023) V-71 (P 0.001)

13.1 GAPDH Cullompton V-14 (P 0.343) v5 (P 0.793) V-11 (P 0.447)Sligo V-18 (P 0.179) V-17 (P 0.0002) V-51 (P 0.007)

13.2 GAPDH Cullompton V-30 (P 0.305) V-40 (P 0.151) V-65 (P 0.097)Sligo v34 (P 0.289) v13 (P 0.246) V-52 (P 0.001)

14.1 Thioredoxin peroxidase Cullompton v22 (P 0.323) V-53 (P 0.001) v1 (P 0.925)Sligo V-1 (P 0.970) V-31 (P 0.140) V-19 (P 0.230)

14.2 Thioredoxin peroxidase Cullompton V-1 (P 0.974) V-68 (P 0.005) V-42 (P 0.041)Sligo V-1 (P 0.974) V-47 (P 0.045) V-26 (P 0.121)

15 GST1 Cullompton V-14 (P 0.465) V-93 (P 0.002) V-79 (P 0.003)Sligo v7 (P 0.819) V-11 (P 0.751) V-13 (P 0.681)

16 GST26b Cullompton v70 (P 0.023) V-62 (P 0.004) V-13 (P 0.217)Sligo V-1 (P 0.930) V-24 (P 0.335) v1 (P 0.937)

18.1 Fatty acid binding protein Cullompton V-2 (P 0.880) V-15 (P 0.473) v7 (P 0.636)Sligo v62 (P 0.012) v89 (P 0.001) v101 (P 0.001)

18.2 Fatty acid binding protein Cullompton V-20 (P 0.426) V-43 (P 0.142) V-25 (P 0.333)Sligo v131 (P 0.002) v141 (P 0.019) v187 (P 0.005)

18.3 Fatty acid binding protein Cullompton V-29 (P 0.215) V-78 (P 0.021) V-83 (P 0.051)Sligo v187 (P 0.003) v95 (P 0.060) v85 (P 0.043)

18.4 Fatty acid binding protein Cullompton v15 (P 0.510) V-18 (P 0.156) v12 (P 0.001)Sligo v105 (P 0.176) v235 (P 0.005) v414 (P 0.001)

19 cyclophilin A Cullompton V-86 (P 0.427) v649 (P 0.002) v755 (P 0.0005)Sligo v100 (P 0.607) v32725 (P 0.0001) v25813 (P 0.0001)

a Comparison is made with nonexposed control Cullompton (susceptible) or Sligo (resistant) fluke in culture over 6 h. Changes in normalized spotvolumes of 2-DE gels (Figure 1.) were analyzed with Progenesis PG220 image analysis software. Within isolate values were as follows (exposure time isgiven in h; concentration of TCBZ-SO is given in µg/mL for exposures); Cullompton (CUL) 6 h non-treated (NT) 84% (Standard Deviation (SD) ( 2); CUL12 h NT 79% (SD ( 12); CUL 6 h 15 µg/mL TCBZ-SO 91% (SD ( 3); CUL 6 h 50 µg/mL TCBZ-SO 76% (SD ( 1); Sligo (SLI) 6 h NT 88% (SD ( 2); SLI 12 hNT 68% (SD ( 21); SLI 6 h 15 µg/mL TCBZ-SO 81% (SD ( 1); SLI 6 h 50 µg/mL TCBZ-SO 85% (SD ( 14). b ‘Protein Expression’ is taken as the normalizedspot volume detected upon 2-DE gels. ‘% Change’ refers to the change in normalized spot volume relative to control values. ‘NP’ for 2DE spot 8. (50 µg/mL, 6 h) indicates this spot was not present on all gels, and was therefore removed from analysis. Student t test values are shown in parentheses.



2-DE and MS/MS Identification of Proteins. Cytosolicproteins expressed from TCBZ sensitive Cullompton andresistant Sligo liver fluke isolates, with or without two levels ofclinically relevant TCBZ-SO exposures were resolved by 2-DE.Coomassie stained gels from four biological replicates pertreatment were analyzed by Progenesis 220 Software, version2006 (Molecular Dynamics). Individual fluke protein profileswere very similar, especially within isolates, showing a meanautomated match of just over 80% (81% (SD ( 7).

Comparative analysis of average gels from each isolate andtreatment revealed differential protein synthesis (Table 2).Protein gel spots highlighted as significantly different (Studentt test p < 0.05) between isolates and in response to TCBZ-SOexposure were selected for identification by MS/MS (Figure 1,Table 3) and further investigation. We noted several respondingproteins including energy metabolic enzymes, detoxificationenzymes and structural proteins (Table 2).

Influence of TCBZ-SO on Energy Metabolic Pathways inFluke. In the drug sensitive Cullompton isolate, there wasincreased synthesis of several major metabolic enzymes in-volved in carbohydrate-derived formation of acetate and pro-pionate, which are the main metabolic products formed inadult fluke.44 Significant increases in acetyl/propionyl CoAcarboxylase R and glutamate dehydrogenase were observedfollowing treatment with both doses of drug in the susceptibleisolate. Fructose 1, 6- bisphosphatase (FBPase) and glyceral-dehyde-3-P dehydrogenase (GAPDH) levels also increasedsignificantly in Cullompton following treatment with 50 µg/mL TCBZ-SO. Increases in both enolase and phosphoenolpyru-vate carboxykinase (PEPCK) were also observed after exposure

at the lower sublethal dose of 15 µg/mL TCBZ-SO in the drug-susceptible isolate, but fell just outside significance margins(p > 0.05). This supports previous biochemical studies showingbenzimidazole drug-stimulated increases of energy metabolicproducts in fluke.4,13,45 While several metabolic enzymes aremore abundant in the drug-resistant Sligo isolate, for example,FBPase, acetyl/propionyl CoA carboxylase R, and glyceralde-hyde-3-P dehydrogenase (GAPDH), we noted decreases in theirexpression following exposure to TCBZ-SO, suggesting alterna-tive routes of energy metabolism may exist in Sligo isolates. Inaddition, significant increases in the proteolytic enzyme leucylaminopeptidase (LAP) were observed in the Cullompton isolate,although we did not observe any significant changes in thecathepsin proteases.

Influence of TCBZ-SO on Structural Cytoskeletal Proteins.Benzimidazole drugs are known to target �-tubulin in nema-todes, thus preventing microtubule formation.46 Benzimidazoleaction in parasitic nematodes prevents glucose uptake, thusaffecting energy metabolic pathways.47,48 F. hepatica tubulinshowever, may have an uncharacterised association with TCBZ-SO. Previous electron microscopy and immunolocalizationstudies revealed severe disruption of tubulin organizationwithin the tegument of susceptible worms following in vitrotreatment with 50 µg/mL TCBZ-SO for 24 h, while very littledisruption was observed in drug-resistant isolates.17,18 Thereare 5 R- and 6 �-tubulin isotypes currently known in F.hepatica,19 however sequenced peptides from spot cluster A,B, C, D (Figure 1) revealed only R-tubulins -1 and -2, and�-tubulin 3 to be present. No significant differences in tubulinprotein volumes were shown between isolates or in response

Figure 1. Representative 2-DE profile of adult Fasciola hepatica. Cullompton (susceptible) and Sligo (resistant) fluke isolates were exposedto TCBZ-SO at 15 µg/mL or 50 µg/mL for 6 h, or nonexposed for 6 or 12 h as described (section 2). Protein spots altered in normalizedvolume from control, nonexposed 6 h cultured fluke were identified via QToF MSMS (Table 3). Spot No. 14.3 (box inset) was found tobe unique to the susceptible isolate, and may serve as a potential isolate marker. One mg of the F. hepatica cytosolic protein wasisoelectrically focused on 17 cm pH 3-10NL BioRad IPG strips. Second dimension was run on 12.5% acrylamide SDS-PAGE, and gelsstained with Coomassie Blue. 2-DE gel images were analyzed with Progenesis PG220 image analysis software. Significant differencesin protein levels according to treatment are highlighted (Student t test p < 0.05). Gel image shown is of Sligo (resistant) isolate exposedat 50 µg/mL for 6 h.



to TCBZ-SO exposure. The relative normalized spot volumeratio of R-tubulin to �-tubulin within isolates was broadlysimilar (results not shown), although variability across gels andthe proximity of the spots made analysis problematic upon aglobal proteomic level. Thus, a more focused subproteomicapproach to enrich for and better resolve the tubulins isrequired before their role in TCBZ resistance can be furtherevaluated in light of their potential for involvement.

The apparent lack of detectable change in tubulins wasaccompanied by a significant decrease in actin in both isolatesfollowing treatment with 50 µg/mL TCBZ-SO (p < 0.05). Thecytoskeletal protein actin has been localized in the subtegumentaland gut musculature, testis, tegumental cell bodies and tegumen-tal spines.49 The observed disruption of fluke somatic musclefollowing TCBZ exposure50,51 supports the possibility that changes

in levels of actin may be related to TCBZ-induced muscle damage.In F. hepatica, both microtubules and actin filaments have beenlocalized to tegumental cell bodies, supporting their role in themovement of secretory granules.17,49

Effect of TCBZ-SO on Stress Response Proteins. Changesin potential TCBZ-SO detoxifying enzymes were observed inboth isolates. Two distinct GSTs displayed altered levels ofprotein. GST-1showed decreased levels following drug treat-ment in the susceptible isolate, while GST-26b increasedsignificantly following treatment with the lower 15 µg/mL doseof TCBZ-SO (p ) 0.023) in the Cullompton isolate (Figure 2).The higher and more physiologically damaging dose of 50 µg/mL led to a significant decrease in the GST-26b expressionlevels in the susceptible isolate, while there were no significantchanges in the enzyme’s expression levels at either drug dose

Table 3. Identification and Annotation of Prominent Protein Spots and TCBZ-SO Differentially Responding Expressed Proteins fromF. hepatica through LC-MS/MS, MASCOT, and BLASTa

MS/MS ions searchhighest scoring BLAST hit within GenBank against F. hepatica EST identified

via MS/MS ions search

2-DE gel spot F. hepatica EST hit MASCOT score protein organism accession number e-value

A HAN4011c12.p1kT7 97 Tubulin beta-3 Fasciola hepatica CAP72051.1 4.00 × 10-103B HAN30071f04.q1k 63 Tubulin alpha-2 Fasciola hepatica CAP72045.1 3.00 × 10-130

HAN30071f10.q1k 33 Alpha-tubulin (similar toAlpha-tublin 1)

Fasciola hepatica CAO79602.1 2.00 × 10-129

C HAN4008c03.p1kT7 32 Tubulin alpha-2 Fasciola hepatica CAP72045.1 2.00 × 10-151

Fhep52e12.q1k 32 2.00 × 10-122

D HAN4011c12.p1kT7 73 Tubulin beta-3 Fasciola hepatica CAP72051.1 4.00 × 10-1032 HAN5021g05.p1kT7 70 SJCHGC00820 protein (similar

heat shock protein 90)Schistosoma japonicum AAW27659.1 9.00 × 10-88

3.1 Fhep13a09.q1k 171 Heat shock protein 70 Fasciola hepatica ABS52704.1 1.00 × 10-117

3.2 Fhep13a09.q1k 229 Heat shock protein 70 Fasciola hepatica ABS52704.1 1.00 × 10-117

4 Nonesignificant-NCBIsearch instead

68 Putative aldehydedehydrogenase 1B1 precursor

Schistosoma japonicum CAX73522.1 NA

5.1 Fhep50h11.q1k 97 Acetyl-CoA carboxylase Schistosoma mansoni XP_002579139.1 3.00 × 10-1205.2 Fhep50h11.q1k 134 Acetyl-CoA carboxylase Schistosoma mansoni XP_002579139.1 3.00 × 10-1205.3 Fhep50h11.q1k 161 Acetyl-CoA carboxylase Schistosoma mansoni XP_002579139.1 3.00 × 10-1206 HAN5006d03.q1kaT3 142 Propionyl-CoA carboxylase � Schistosoma mansoni XP_002578796.1 4.00 × 10-1077 Fhep08e11.q1k 113 Leucyl aminopeptidase Fasciola hepatica AAV59016.1 8.00 × 10-117

Fhep42b03.q1k 107 3.00 × 10-114

8 Fhep07g02.q1k 139 Cytosolic phosphoenolpyruvatecarboxykinase 1

Rattus norvegicus NP_942075.1 1.00 × 10-80

9 Fhep28b10.q1k 154 Enolase Fasciola hepatica CAK47550.1 6.00 × 10-143

10.1 HAN5011a07.p1kT7 382 Glutamate dehydrogenase Schistosoma mansoni XP_002580330.1 7.00 × 10-79

10.2 HAN5011a07.p1kT7 350 Glutamate dehydrogenase Schistosoma mansoni XP_002580330.1 7.00 × 10-79

11 Fhep27d08.q1k 235 Actin Schistosoma mansoni XP_002578518.1 1.00 × 10-97

12.1 Fhep54g11.q1k 216 Fructose-16-bisphosphatase-related

Schistosoma mansoni XP_002580627.1 3.00 × 10-100

12.2 Fhep54g11.q1k 74 Fructose-16-bisphosphatase-related

Schistosoma mansoni XP_002580627.1 3.00 × 10-100

13.1 Fhep10c01.q1k 84 glyceraldehyde 3-phosphatedehydrogenase

Petromyzon marinus AAT70328.1 3.00 × 10-75

13.2 Fhep40d12.q1k 176 Glyceraldehyde 3-phosphatedehydrogenase

Petromyzon marinus AAT70328.1 3.00 × 10-92

14.1 Fhep22e12.q1k 208 Thioredoxin peroxidase Fasciola gigantica ABY85785.1 4.00 × 10-10414.2 Fhep28c09.q1k 376 Thioredoxin peroxidase Fasciola gigantica ABY85785.1 4.00 × 10-112

14.3 Fhep28c09.q1k 628 Thioredoxin peroxidase Fasciola gigantica ABY85785.1 4.00 × 10-112

15 Nonesignificant-NCBIsearch instead

76 Glutathione S-transferaseclass-mu; GST1; Fh1

Fasciola hepatica P56598 NA

16 Fhep40e02.q1k 144 Glutathione transferase classmu; GST26b

Fasciola hepatica ACF59730.1 3.00 × 10-86

18.1 HAN30041f09.p1k 354 Fatty acid-binding proteintype 3

Fasciola hepatica Q9U1G6.1 1.00 × 10-68

18.2 Fhep46d02.q1k 45 Fatty acid-binding protein Fh15 Fasciola hepatica Q7M4G0.3 1.00 × 10-56

18.3 Fhep20f11.q1k 93 Fatty acid-binding proteintype 2

Fasciola hepatica Q7M4G1.2 9.00 × 10-55

18.4 HAN30041f09.p1k 354 Fatty acid-binding proteintype 3

Fasciola hepatica Q9U1G6.1 1.00 × 10-68

19 Fhep25c09.q1k 374 Similar to Mal s 6 allergen(cyclophilin_ABH_like)

Ciona intestinalis XP_002129564.1 5.00 × 10-61

a MS/MS ions searches within a locally installed MASCOT server were against a F. hepatica unannotated translated protein sequence database.Matching F. hepatica sequences were searched via BLASTp against GenBank to reveal proteins of similarity and provide putative homology for purposes ofidentification and annotation (see Experimental Procedures). 2-DE spots 4 and 15 did not provide significantly scoring matches via MS/MS ions searchesto sequences within the F. hepatica database, and were instead searched against Genbank. 2-DE spots 2 and 4 provided only one significantly scoringpeptide sequence via the MS/MS ions search method, and so MS/MS fragmentation spectra were additionally interpreted manually (see ExperimentalProcedures) before BLASTp searches as described above. Spot Nos correspond to the representative 2-DE gel shown in Fig. 1. For further details, refer toSupplementary Tables S1 and S3, and Supplementary Figures S1 and S2 (Supporting Information).



Figure 2. Changes in expression of normalized spot volumes of GST-26b and FABP after TCBZ-SO exposure in Cullompton and Sligoliver fluke isolates. 2-DE gels (Figure 1) were analyzed with Progenesis PG220 image analysis software. Comparison was made betweenaverage gels built from four technical replicates of samples containing four individual fluke: (a) 3-D relief profile of spot 16 (GST-26b)in Cullompton nontreated worms (A) and Cullompton TCBZ-SO 6 h treated worms (B) with 2-DE gel image section (inset); (b) bar chartshowing relative percentage change in GST-26b synthesis for all conditions; (c) 3-D relief profiles of major isoform of FABP in Sligonontreated worms (C1, C2), Sligo TCBZ-SO 6 h treated worms (D1, D2) and Cullompton nontreated worms (E1, E2) with 2DE gel imagesections (inset); (d) bar charts showing relative percentage changes in synthesis for the major FABP isoforms for all conditions. * p <0.05, ** p < 0.001, ***, p < 0.0001.



in the resistant isolate. F. hepatica GSTs previously investigatedwere localized to the parenchyma, subtegument and intestinallamella.52 However, in the study by Creaney et al., (1995),52

cross reactivity between the antisera and different GSTs couldonly enable GST-1 to be resolved from among the four F.hepatica Mu class GSTs known. These four GSTs are also shownto have different activities with a variety of substrates followingpurification and have been shown to bind but not glutathione-conjugate anthelmintic drugs,53 although TCBZ undergoesbiotransformation by both host and parasitic enzymes.22,26

Therefore, at less cellular damaging TCBZ-SO levels, highconcentration of GSTs could support neutralization of TCBZ-SO or its metabolites.

The phase I drug metabolizing enzyme aldehyde dehydro-genase levels increased only in the Cullompton isolate followingtreatment with 50 µg/mL TCBZ-SO, although just outsideassigned significance margins (p ) 0.105). Three protein spotswere identified as thioredoxin peroxidase (TPx) in 2-DE (Spots,14.1, 14.2, 14.3. Figure 1, Table 3). The spot 14.3 was onlyobserved in the TCBZ sensitive Cullompton flukes, suggestinga possible different isoform/modification in this isolate com-pared to the TCBZ resistant Sligo isolate. TPx enzymes aresecreted in F. hepatica excretory/secretory (ES) products andhave been shown to induce Th2 responses in infected mice.54

They are also involved in detoxification of host immune-generated reactive oxygen species.55 Two isoforms of TPx weresignificantly reduced in the Cullompton susceptible isolatefollowing treatment with 50 µg/mL of TCBZ-SO.

Several apparent isoforms of FABP were identified upon2-DE gels (Figure 1; Table 3). Cullompton strain (TCBZ sus-ceptible) displayed marginally higher basal levels of FABP thanthe Sligo strain (TCBZ resistant), although this was not signifi-cantly different at p < 0.05. However, four FABP 2-DE spots inSligo strain responded unanimously to TCBZ exposure at bothdoses (15 µg/mL and 50 µg/mL) and longer culture timesthrough a significantly increased synthesis of FABP (Figure 2;Table 2). In contrast, Cullompton strain fluke displayed apredominant reduction in FABP synthesis, although this re-sponse was more variable (Figure 2; Table 2).

FABP is an abundant component of the soluble tegumentalproteome of adult liver fluke. Trematodes such as Fasciola spp.are unable to synthesize their own sterols or fatty acids (FA),particularly cholesterol and long-chain FA’s56 and rely on theuptake of exogenous FA’s from host to synthesize their owncomplex lipids. Differential FABP expression may reflect dif-ferential TCBZ damage in the isolates. In the related F.gigantica, FABP’s were localized to parenchymal cells, whichare in direct contact with several tissues including the tegu-ment.57

Tegumental FABPs could also be involved in the uptakeof TCBZ-SO as well as lipids, and pass these molecules toparenchymal cells for storage or sequestration.57 TCBZ resis-tance in F. hepatica through passive binding of drug by proteinshas previously been suggested, while FABPs have also beenshown to interact with a range of anthelmintics.24,39,40,58 Estevesand Ehrlich (2006),59 report FABP from Schistosoma japonicum

Figure 3. Interaction of FABP and GST-26b with TCBZ-SO. (a) Purification of native FABP’s from liver fluke (fractions 12-16 were run);(b) titrations of the recombinant Fh15 with TCBZ-SO with A representing the spectrum of the Fh15-ANS complex without any drug,and B representing the spectrum of Fh15 without ANS. Titrations with TCBZ-SO led to the quenching of fluorescence (Em λ 485 nm).(c) Double reciprocal plot of quenching of fluorescence versus concentration of TCBZ-SO for the Fh15-ANS complex. (d) Estimation ofIC50 value for TCBZ-SO by inhibition of rGST-26b conjugating activity following the addition of drug metabolite and using CDNB assubstrate.



to have a putative role in drug binding and sequestration, whileupregulation of FABP mRNA has also been reported in resistantstrains of Anopheles gambiae during insecticide exposure.60

The tegument itself consumes a substantial portion of lipidssince the surface membrane undergoes rapid turnover. Becauseof TCBZ-SO’s detrimental action to the surface tegument ofFasciola spp.,51 it is possible that increased expression of FABP’sfollowing drug exposure (Figure 2; Table 2) could allow SligoTCBZ-resistant worms to compensate for the damage-inducingeffects of TCBZ-SO.

The innate levels of heat shock proteins hsp90 and hsp70were found to be higher in the Sligo drug resistant isolatecompared to Cullompton drug sensitive flukes. Hsp70 proteindecreased following exposure to 15 µg/mL of TCBZ-SO in theSligo resistant isolate. We also observed a highly significantincrease in cyclophilin A in both isolates following exposureto 50 µg/mL drug for 6 h. The role of cyclophilin A is not fullyresolved in parasites, but has been reported to be involved inseveral processes including cell signaling, molecular chaperon-ing, parasite virulence and host immunomodulation.61 Cyclo-philin A may simply be involved as part of the parasite’s generalstress response pathways as a molecular chaperone becauseof its peptidyl prolyl cis-trans isomerase activity, especiallysince this activity is also conserved in the related blood flukeSchistosoma mansoni.62

Binding of TCBZ-SO to Fh15 and GST. Fh15 and GST pro-teins were selected for TCBZ-SO interaction studies given theirsignificant response to TCBZ-SO (15 µg/mL for 6 h) (Figure 3).A recombinant form of the F. hepatica FABP-15 was producedand purified, and binding to TCBZ-SO was determined bycompetitive spectrofluorimetry using ANS as fluorescent bind-ing probe. Upon maximum binding of ANS, fluorescence wasquenched following titrations with TCBZ-SO (Figure 3). Thedissociation constant of drug from the ANS binding site, KD

was estimated to be 16.4 ( 0.5 µM (3 independent replicates)from a double-reciprocal plot of fluorescence quenching versusdrug concentration. Interaction of TCBZ-SO with native FABPpreparations was also tested, revealing a KD of approximately10 µM. Given that data match the physiologically relevantconcentration range observed for TCBZ-SO levels in F. he-patica,22 it is plausible that a high intracellular level of proteinsuch as FABP (up to 3% total soluble protein) could play a partin TCBZ-SO tolerance/resistance by passive binding, as previ-ously suggested,24,39 or in contrast, TCBZ-SO may compete withessential FAs for FABP. Native F. hepatica FABPs have previ-ously been biochemically characterized, and have been shownto interact with several other anthelmintics.39,58

While gel analysis revealed an increase in several isoformsof FABP in the Sligo isolate after in vitro drug exposure, GST-26b was the only putative soluble detoxification protein de-tected that responded significantly to TCBZ-SO in the Cullomp-ton isolate. Recombinant GST-26b (ACF59730.1) was alsoproduced in E. coli and assayed for TCBZ-SO interaction.Enzyme inhibition assays with TCBZ-SO using CDNB as acompetitor substrate revealed an IC50 of 10.9 ( 1.5 µM (Figure3). Therefore, rGST-26b shows a similar affinity for the drugcompared to FABP’s. Thiol depletion assays were unable todetect TCBZ-SO glutathione dependent conjugation by rGST-26b (result not shown). Passive drug binding and a ligandinrole for GST-26b may then be a potential factor in reducingintracellular available drug and lowering toxicity.

Conclusions

Our single proteomics experiment supports previous reduc-tionist based approaches that collectively highlight a broadTCBZ-induced range of effects and potential modes andmechanisms of TCBZ action in liver fluke. In addition, 2-DEapproaches to investigate the global soluble proteome showthat isolates may respond differentially to TCBZ-SO. TCBZ-SOresponse and TCBZ binding proteins (GST and FABP) havebeen isolated for further functional and resistant diagnosticstudies. GST and FABP drug selection pressure may reveal,following sequencing analysis, single nucleotide polymor-phisms (SNPs) for resistance monitoring, while RNAi assays,having been optimized in juvenile liver fluke, may reveal theimportance of TCBZ responding proteins in this pathogeniclifecycle stage.63

While this study has focused upon the soluble proteome ofF. hepatica, further proteomic approaches to investigate hy-drophobic and insoluble proteins of the membranes andtegument are currently underway within our collaborativegroup. The aim of these further studies is to complement oursoluble protein investigations to build a more complete un-derstanding of the total protein response to TCBZ and revealadditional drug targets, resistance mechanisms and links withinthe metabolic and drug response pathways of F. hepatica. Thefluke tegument is at the host-parasite interface, and thus theseinsoluble proteins may play a significant role in drug efflux andaction, as well as revealing antigens important in the ongoingsearch for vaccines.

Abbreviations: TCBZ, triclabendazole; TCBZ-SO, triclabenda-zole sulphoxide; GST, glutathione transferase; FABP, fatty acidbinding protein; BZ, benzimidazole; ABZ, albendazole: GAPDH,glyceraldehyde-3-phosphate dehydrogenase.

Acknowledgment. G.C., S.P., A.T., I.F., E.H., M.M. andP.M.B. acknowledge the BBSRC (BBC503638) for support.S.P., E.J.L., E.H., I.F., A.T., and P.M.B. acknowledge the EUDeLiver project (FOOD-CT-2005-023025). All authors thankJames Heald for technical expertise and assistance withmass spectrometry analysis.

Supporting Information Available: Supplementarytables and figures. This material is available free of charge viathe Internet at http://pubs.acs.org.

References(1) Boray, J. C. Disease of domestic animals caused by flukes; Food

and Agricultural Organization of the United Nations: Rome, 1994.(2) Kenyon, F.; Sargison, N. D.; Skuce, P. J.; Jackson, F. Sheep helminth

parasitic disease in south eastern Scotland arising as a possibleconsequence of climate change. Vet. Parasitol. 2009, 163, 293–297.

(3) Wolstenholme, A. J.; Fairweather, I.; Prichard, R.; von Samson-Himmelstjerna, G.; Sangster, N. C. Drug resistance in veterinaryhelminths. Trends Parasitol. 2004, 20 (10), 469–476.

(4) Mas-Coma, S.; Valero, M. A.; Bargues, M. D. Fasciola, lymnaeidsand human fascioliasis, with a global overview on disease trans-mission, epidemiology, evolutionary genetics, molecular epide-miology and control. Adv. Parasitol. 2009, 69, 41–147.

(5) The world Health Organisation. Report of the WHO InformalMeeting on use of triclabendazole in fascioliasis controlWHO headquarters, Geneva, Switzerland 17-18 October 2006.Available online: http://www.who.int/neglected_diseases/preventive_chemotherapy/WHO_CDS_NTD_PCT_2007.1.pdf.

(6) World Health Organisation. Action Against worms. Iss. 10. Dec.2007. Available online: http://www.who.int/neglected_diseases/preventive_chemotherapy/Newsletter10.pdf.

(7) Fairweather, I.; Boray, J. C. Fasciolicides: efficacy, actions, resis-tance and its management. Vet. J. 1999, 158 (2), 81–112.



(8) Brennan, G. P.; Fairweather, I.; Trudgett, A.; Hoey, E.; McCoy, M.;McConville, M.; Meaney, M.; Robinson, M.; McFerran, N.; Ryan,L.; Lanusse, C.; Mottier, L.; Alvarez, L.; Solana, H.; Virkel, G.;Brophy, P. M. Understanding triclabendazole resistance. Exp. Mol.Pathol. 2007, 82 (2), 104–109.

(9) Fairweather, I. Triclabendazole: new skills to unravel an oldish,enigma. J. Helminthol. 2005, 79 (3), 227–234.

(10) Mooney, L.; Good, B.; Hanrahan, J. P.; Mulcahy, G.; de Waal, T.The comparative efficacy of four anthelmintics against a naturalacquired Fasciola hepatica infection in hill sheep flock in the westof Ireland. Vet. Parasitol. 2009, 164, 201–205.

(11) Hanna, R. E. B.; Edgar, H. W. J.; McConnell, S.; Toner, E.;McConville, M.; Brennan, G. P.; Devine, C.; Flanagan, A.; Halferty,L.; Meaney, M.; Shaw, L.; Moffett, D.; McCoy, M.; Fairweather, I.Fasciola hepatica: Histological changes in the reproductive struc-tures of triclabendazole (TCBZ)-sensitive and TCBZ-resistant flukesafter treatment in vivo with TCBZ and the related benzimidazolederivative. Compound Alpha. Vet. Parasitol. 2010, 168, 240–254.

(12) Stitt, A. W.; Fairweather, I.; Mackender, R. O. The Effect ofTriclabendazole “Fasinex”, on protein synthesis by the liver fluke,Fasciola hepatica. Int. J. Parasitol. 1995, 25 (4), 421–429.

(13) Bennett, J. L.; Kohler, P. Fasciola hepatica: action in vitro oftriclabendazole on immature and adult stages. Exp. Parasitol. 1987,63 (1), 49–57.

(14) Stitt, A. W.; Fairweather, I. Fasciola hepatica: disruption of thevitelline cells in vitro by the sulphoxide metabolite of triclabenda-zole. Parasitol. Res. 1996, 82, 333–339.

(15) Stitt, A. W.; Fairweather, I. Spermatogenesis in Fasciola hepatica:an ultrastructural comparison of the anthelmintic, triclabendazole(“Fasinex”) and the microtubule inhibitor, tubulozole. Invertebr.Reprod. Dev. 1992, 22, 139–150.

(16) Stitt, A. W.; Fairweather, I. The effect of the sulphoxide metaboliteof triclabendazole ‘Fasinex’, on the tegument of mature andimmature stages of the liver fluke, Fasciola hepatica. Parasitology1994, 108 (5), 555–567.

(17) McConville, M.; Brennan, G. P.; McCoy, M.; Castillo, R.; Hernán-dez-Campos, A.; Ibarra, F.; Fairweather, I. Adult triclabendazole-resistant Fasciola hepatica: surface and subsurface tegumentalresponses to in vitro treatment with the sulphoxide metaboliteof the experimental fasciolicide compound alpha. Parasitology2006, 133, 195–208.

(18) Robinson, M. W.; Trudgett, A.; Hoey, E. M.; Fairweather, I.Triclabendazole-resistant Fasciola hepatica: beta-tubulin andresponse to in vitro treatment with triclabendazole. Parasitology2002, 124 (3), 325–338.

(19) Ryan, L. A.; Hoey, E.; Trudgett, A.; Fairweather, I.; Fuchs, M.;Robinson, M. W.; Chambers, E.; Timson, D. J.; Ryan, E.; Feltwell,T.; Ivens, A.; Bentley, G.; Johnston, D. Fasciola hepatica expressesmultiple alpha- and beta-tubulin isotypes. Mol. Biochem. Parasitol.2008, 159 (1), 73–78.

(20) Robinson, M. W.; McFerran, N.; Trudgett, A.; Hoey, E. M.;Fairweather, I. A possible model of benzimidazole binding toß-tubulin disclosed by invoking an interdomain movement. J. Mol.Graph. Model. 2004, 23, 275–284.

(21) Chambers, E.; Ryan, L. A.; Hoey, E. M.; Trudgett, A.; McFerran,N. V.; Fairweather, I.; Timson, D. J. Liver fluke ß-tubulin isotype 2binds albendazole and is thus a probable target of this drug.Parasitol. Res. 2010, in press.

(22) Alvarez, L. I.; Solana, H. D.; Mottier, M. L.; Virkel, G. L.; Fairweather,I.; Lanusse, C. Altered drug influx/efflux and enhanced metabolicactivity in triclabendazole-resistant liver flukes. Parasitology 2005,131 (4), 501–510.

(23) Mottier, L.; Alvarez, L.; Fairweather, I.; Lanusse, C. Resistanceinduced changes on TCBZ-transport in Fasciola hepatica: iver-mectin reversal effect. J. Parasitol. 2006, 6, 1355–1360.

(24) Alvarez, L. I.; Mottier, M. L.; Lanusse, C. Drug transfer into targethelminth parasites. Trends Parasitol. 2007, 23 (3), 97–104.

(25) Reed, M.; Panaccio, M.; Strugnell, R. A.; Spithill, T. W. Develop-mental expression of a Fasciola hepatica sequence homologousto ABC transporters. Int. J. Parasitol. 1998, 28, 1375–1381.

(26) Hennessy, D. R.; Lacey, E.; Steel, J. W.; Prichard, R. K. The kineticsof triclabendazole disposition in sheep. J. Vet. Pharmacol. Ther.1987, 10 (1), 64–72.

(27) Robinson, M. W.; Lawson, J.; Trudgett, A.; Hoey, E. M.; Fairweather,I. The comparative metabolism of triclabendazole sulphoxide bytriclabendazole-susceptible and triclabendazole-resistant Fasciolahepatica. Parasitol. Res. 2004, 92 (3), 205–210.

(28) Devine, C.; Brennan, G. P.; Lanusse, C. E.; Alvarez, L. I.; Trudgett,A.; Hoey, E.; Fairweather, I. Inhibition of cytochrome P450-mediated metabolism enhances ex vivo susceptibility of Fasciolahepatica to triclabendazole. Parasitology 2010, 135, 871–880.

(29) Chemale, G.; Morphew, R.; Moxon, J. V.; Morassuti, A. L.; Lacourse,E. J.; Barrett, J.; Johnston, D. A.; Brophy, P. M. Proteomic analysisof glutathione transferases from the liver fluke parasite Fasciolahepatica. Proteomics 2006, 6 (23), 6263–6273.

(30) McConville, M.; Brennan, G. P.; Flanagan, A.; Edgar, H. W. J.;Hanna, R. E. B.; McCoy, M.; Gordon, A. W.; Castillo, R.; Hernández-Campos, A.; Fairweather, I. An evaluation of the efficacy ofcompound alpha and triclabendazole against two isolates ofFasciola hepatica. Vet. Parasitol. 2009, 162, 75–88.

(31) Toner, E.; Brennan, G. P.; Hanna, R. E. B.; Edgar, H. W.; Fair-weather, I. Tegumental surface changes in adult Fasciola hepaticain response to treatment in vivo with triclabendazole in the sheephost. Vet. Parasitol. 2010, in press.

(32) Flanagan, A. M.; Edgar, H. W. J.; Forster, F.; Gordon, A.; Hanna,R. E. B.; McCoy, M.; Brennan, G. P.; Fairweather, I. Standardisationof a coproantigen reduction test (CRT) protocol for the diagnosisof resistance to triclabendazole in Fasciola hepatica. Vet. Parasitol.2010, in press.

(33) Robinson, M. W.; Trudgett, A.; Hoey, E. M. And Fairweather, I.Triclabendazole-resistant Fasciola hepatica: b-tubulin and re-sponse to in vitro treatment with triclabendazole. Parasitology2002, 124, 325–338.

(34) Falkner, J. A.; Falkner, J. W.; Andrews, P. A. ProteomeCommons.orgIO Framework: reading and writing multiple proteomics dataformats. Bioinformatics. 2007, 23 (2), 262–263.

(35) Altschul, S. F.; Gish, W.; Miller, W.; Myers, E. W.; Lipman, D. J.Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410.

(36) Hall, T. A. BioEdit: a user-friendly biological sequence alignmenteditor and analysis program for Windows 95/98/NT. Nucleic AcidsSymp. Ser. 1999, 41, 95–98.

(37) Altschul, S. F.; Madden, T. L.; Schaffer, A. A.; Zhang, J.; Zhang, Z.;Miller, W.; Lipman, D. J. Gapped BLAST and PSI-BLAST: a newgeneration of protein database search programs. Nucleic Acids Res.1997, 25 (17), 3389–3402.

(38) Altschul, S. F.; Wootton, J. C.; Gertz, E. M.; Agarwala, R.; Morgulis,A.; Schaffer, A. A.; Yu, Y. K. Protein database searches usingcompositionally adjusted substitution matrices. FEBS J. 2005, 272(20), 5101–5109.

(39) Timanova-Atanasova, A.; Jordanova, R.; Radoslavov, G.; Deevska,G.; Bankov, I.; Barrett, J. A native 13-kDa fatty acid binding proteinfrom the liver fluke Fasciola hepatica. Biochim. Biophys. Acta 2004,1674 (2), 200–204.

(40) van Rossum, A. J.; Jefferies, J. R.; Rijsewijk, F. A.; LaCourse, E. J.;Teesdale-Spittle, P.; Barrett, J.; Tait, A.; Brophy, P. M. Binding ofhematin by a new class of glutathione transferase from the blood-feeding parasitic nematode Haemonchus contortus. Infect. Immun.2004, 72 (5), 2780–2790.

(41) Velkov, T.; Chuang, S.; Wielens, J.; Sakellaris, H.; Charman, W. N.;Porter, C. J.; Scanlon, M. J. The interaction of lipophilic drugs withintestinal fatty acid-binding protein. J. Biol. Chem. 2005, 280 (18),17769–17776.

(42) Habig, W. H.; Pabst, M. J.; Jakoby, W. B. Glutathione S-transferases.The first enzymatic step in mercapturic acid formation. J. Biol.Chem. 1974, 249 (22), 7130–7139.

(43) Hayes, J. D.; Mantle, T. J. Inhibition of hepatic and extrahepaticglutathione S-transferases by primary and secondary bile acids.Biochem. J. 1986, 233 (2), 407–415.

(44) Lloyd, G. M.; Barrett, J. Fasciola hepatica: carbohydrate metabolismof the adult. Exp. Parasitol. 1983, 56 (1), 81–88.

(45) Cornish, R. A.; Bryant, C. Changes in energy metabolism due toanthelmintics in Fasciola hepatica maintained in vitro. Int. J.Parasitol. 1976, 6 (5), 393–398.

(46) Kwa, M. S.; Veenstra, J. G.; Van Dijk, M.; Roos, M. H. Beta-tubulingenes from the parasitic nematode Haemonchus contortus modu-late drug resistance in Caenorhabditis elegans. J. Mol. Biol. 1995,246 (4), 500–510.

(47) Bennet, E. M.; Bryant, C. Energy metabolism of adult Haemonchuscontortus in vitro: a comparison of benzimidazole-susceptible and-resistant strains. Mol. Biochem. Parasitol. 1984, 10 (3), 335–346.

(48) Behm, C. A.; Bryant, C. Anthelmintic action. A metabolic approach.Vet. Parasitol. 1979, 5, 39–49.

(49) Stitt, A. W.; Fairweather, I.; Trudgett, A. G.; Johnston, C. F.;Anderson, S. M. Localisation of actin in the liver fluke Fasciolahepatica. Parasitol Res. 1992, 78 (2), 96–102.

(50) Halferty, L.; Brennan, G. P.; Trudgett, A.; Hoey, L.; Fairweather, I.Relative activity of triclabendazole metabolites against the liverfluke, Fasciola hepatica. Vet. Parasitol. 2009, 159, 126–138.

(51) Toner, E.; Brennan, G. P.; Hanna, R. E. B.; Edgar, H. W.; Fair-weather, I. Time-dependent changes to the tegumental system andgastrodermis of adult Fasciola hepatica following treatment in vivowith triclabendazole in the sheep host. Vet Parasitol. 2010, in press.



(52) Creaney, J.; Wijffels, G. L.; Sexton, J. L.; Sandeman, R. M.; Spithill,T. W.; Parsons, J. C. Fasciola hepatica: localisation of glutathioneS-transferase isoenzymes in adult and juvenile liver fluke. Exp.Parasitol. 1995, 81 (1), 106–116.

(53) Brophy, P. M.; Crowley, P.; Barrett, J. Detoxification reactions ofFasciola hepatica cytosolic glutathione transferases. Mol. Biochem.Parasitol. 1990, 39 (2), 155–161.

(54) Donnelly, S.; O’Neill, S. M.; Sekiya, M.; Mulcahy, G.; Dalton, J. P.Thioredoxin peroxidase secreted by Fasciola hepatica induces thealternative activation of macrophages. Infect. Immun. 2005, 73 (1),166–173.

(55) Salazar-Calderon, M.; Martın-Alonso, J. M.; Ruiz de Eguino, A. D.;Parra, F. Heterologous expression and functional characterizationof thioredoxin from Fasciola hepatica. Parasitol. Res. 2001, 87 (5),390–395.

(56) Meyer, F.; Meyer, H.; Bueding, E. Lipid metabolism in the parasiticand free-living flatworms, Schistosoma mansoni and Dugesiadorotocephala. Biochim. Biophys. Acta 1970, 210 (2), 257–266.

(57) Pankao, V.; Sirisriro, A.; Grams, R.; Vichasri-Grams, S.; Meepool,A.; Kangwanrangsan, N.; Wanichanon, C.; Ardseungneon, P.;Viyanant, V.; Upatham, E. S.; Sobhon, P. Classification of theparenchymal cells in Fasciola gigantica based on ultrastructureand their expression of fatty acid binding proteins FABPs. Vet.Parasitol. 2006, 142 (3-4), 281–292.

(58) Barrett, J.; Saghir, N. Lipid binding proteins in parasitic helminths.Res. Rev. Parasitol. 1999, 59, 107–112.

(59) Esteves, A.; Ehrlich, R. Invertebrate intracellular fatty acid bindingproteins. Comp. Biochem. Physiol. C: Toxicol. Pharmacol. 2006,142 (3-4), 262–274.

(60) Vontas, J.; Blass, C.; Koutsos, A. C.; David, J. P.; Kafatos, F. C.; Louis,C.; Hemingway, J.; Christophides, G. K.; Ranson, H. Gene expres-sion in insecticide resistant and susceptible Anopheles gambiaestrains constitutively or after insecticide exposure. Insect Mol. Biol.2005, 14 (5), 509–521.

(61) Bell, A.; Monaghan, P.; Page, A. P. Peptidyl-prolyl cis-transisomerases immunophilins, and their roles in parasite biochem-istry, host-parasite interaction and antiparasitic drug action. Int.J. Parasitol. 2006, 36 (3), 261–276.

(62) Gourlay, L. J.; Angelucci, F.; Baiocco, P.; Boumis, G.; Brunori, M.;Bellelli, A.; Miele, A. E. The three-dimensional structure of tworedox states of cyclophilin A from Schistosoma mansoni. Evidencefor redox regulation of peptidyl-prolyl cis-trans isomerase activity.J. Biol. Chem. 2007, 282 (34), 24851–24857.

(63) McGonigle, L.; Mousley, A.; Marks, N. J.; Brennan, G. P.; Dalton,J. P.; Spithill, T. W.; Day, T. A.; Maule, A. G. The silencing ofcysteine proteases in Fasciola hepatica newly excysted juvenilesusing RNA interference reduces gut penetration. Int. J. Parasitol.2008, 38 (2), 149–155.

PR1000785



Comparative Proteomic Analysis of Triclabendazole Response in The

Documents

Transcript of Comparative Proteomic Analysis of Triclabendazole Response in The