Cloning, expression and functional characterisation of a peroxiredoxin from the potato cyst nematode...

Molecular and Biochemical Parasitology 111 (2000) 41–49

Cloning, expression and functional characterisation of aperoxiredoxin from the potato cyst nematode Globodera

rostochiensis�

Lee Robertson a,*, Walter M. Robertson a, Miroslaw Sobczak a,1,Johannes Helder b, Emmanuel Tetaud c, Mark R. Ariyanayagam c,

Mike A.J. Ferguson c, Alan Fairlamb c, John T. Jones a

a Department of Nematology, Scottish Crop Research Institute, In6ergowrie, Dundee DD2 5DA, Scotland, UKb Wageningen Uni6ersity, Laboratory of Nematology, P.O. Box 8123, 6700 ES Wageningen, The Netherlands

c Department of Biochemistry, Wellcome Trust Building, Uni6ersity of Dundee, Dundee DD1 5EH, Scotland, UK

Received 27 March 2000; received in revised form 15 June 2000; accepted 21 June 2000

Abstract

We report the cloning, expression and functional characterisation of a peroxidase belonging to the peroxiredoxinfamily from the potato cyst nematode Globodera rostochiensis, the first molecule of this type from any nematodeparasitic on plants. The G. rostochiensis peroxiredoxin catalyses the breakdown of hydrogen peroxide, but not cumeneor t-butyl hydroperoxide, in a trypanosomatid reducing system comprising trypanothione reductase, trypanothioneand tryparedoxin. In common with its homologues from Onchocerca 6ol6ulus and Brugia malayi, the G. rostochiensisenzyme is present on the surface of invasive and post-infective juveniles despite the apparent lack of a cleavableN-terminal signal peptide. The possibility that the G. rostochiensis peroxiredoxin plays a role in protection of theparasite from plant defence responses is discussed. © 2000 Elsevier Science B.V. All rights reserved.

Keywords: Globodera rostochiensis ; Peroxiredoxin; Secretions; Antioxidant protein

www.parasitology-online.com.

Abbre6iations: J2, Second stage juvenile; TpX, Peroxiredoxin; Gr-TpX, Globodera rostochiensis peroxiredoxin; rGr-TpX, Recom-binant G. rostochiensis peroxiredoxin; GST, Glutathione S transferase; EST, Expressed sequence tag.� Note : Nucleotide sequence data reported in this paper are available in the EMBL, GenBank™ and DDBJ databases under the

accession number AJ243736.* Corresponding author. Present address: Universidad Autonoma de Madrid, Departmento de Biologia, Laboratorio de fisiologia

vegetal, Cantoblanco, 28049 Madrid, Spain. Tel.: +34-91-3978197; fax: +34-91-3978344.E-mail address: [email protected] (L. Robertson).1 Present address: Department of Botany, Warsaw Agricultural University (SGGW), Rakowiecka 26/30, 02528 Warsaw, Poland.

0166-6851/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved.

PII: S 0166 -6851 (00 )00295 -4

L. Robertson et al. / Molecular and Biochemical Parasitology 111 (2000) 41–4942

1. Introduction

Like all parasitic organisms, plant parasitic ne-matodes, especially those that are endoparasitic,need effective mechanisms for combating hostdefence responses. In many plants the first line ofdefence involves an oxidative burst which gener-ates toxic reactive oxygen species potentially dam-aging to an invading parasite [1,2]. Hydrogenperoxide has recently been shown to be producedin the defence response of plants to nematodeinfection [3]. As plant parasitic nematodes areaerobic organisms [4], they also need to removeactive oxygen generated by their own metabolism.The active oxygen species which parasites need toremove include the superoxide anion (O2

−), hydro-gen peroxide (H2O2) and the hydroxyl radical(OH�). The most damaging of these, the hydroxylradical, is formed from superoxide and hydrogenperoxide via the Haber-Weiss reaction [5]. Toavoid generation of OH, levels of the precursorsare suppressed using two strategies: Firstly, super-oxide dismutase is used to convert O2

− to oxygenand H2O2. Secondly, H2O2 is removed by a vari-ety of enzymes including catalase, the glutathioneperoxidase/glutathione reductase system and viathe thioredoxin peroxidase/thioredoxin reductasepathway. Although the precise combination ofenzymes used by any particular parasite varies,genes encoding all of these enzymes have beenshown to be present in various parasitic ne-matodes [6–8].

Studies on animal parasitic nematodes indicatethat all of these enzymes can be used as defenceproteins to remove active oxygen species gener-ated in host defence responses. Particular atten-tion has focussed on the putative thioredoxinperoxidases of parasitic nematodes, which havebeen shown to combat both internal and hostderived reactive oxygen in several species includ-ing Dirofilaria immitis [8], Onchocerca 6ol6ulus [9]and Brugia malayi [10].

Compared to animal parasitic nematodes, littleis known about the defence proteins employed byplant parasitic nematodes. Superoxide dismutase,catalase and ascorbate peroxidase activity havebeen detected in some endoparasitic nematodes[11] but little is known about the roles of these

proteins in the host–parasite interaction and noneof these proteins has been characterised in detail.There is no information regarding peroxiredoxinsin plant parasitic nematodes.

We have been studying the secretions of thepotato cyst nematode Globodera rostochiensis.This nematode is an endoparasite of the roots ofsolanaceous plants. In our recent studies we col-lected sufficient secretions from invasive stage ju-veniles to allow direct analysis and demonstratedthe presence of the antioxidant enzyme superoxidedismutase in these secretions [12]. We were alsoable to raise antisera against these collected secre-tions. Here we describe the cloning and functionalcharacterisation of a peroxiredoxin isolated in acDNA library screen using one of the antiseraraised against secretions collected from G.rostochiensis.

2. Materials and methods

2.1. cDNA library screening

A cDNA library made from mRNA extractedfrom freshly hatched second stage juveniles (J2s)of G. rostochiensis, cloned into the pcDNA2.1plasmid vector (Invitrogen) [13] was screened withantiserum GR-5 [12]. Preliminary studies hadshown that this antiserum recognised the surfaceand subventral gland cells of J2s of G. rostochien-sis. Primary and secondary screening were per-formed using standard protocols [14]. After thesecondary screen, at least two well separated posi-tively reacting colonies were removed and spreadon LB-Amp plates. An indication that genuinepositives had been isolated was sought by usingPCR, with SP6 (ATTTAGGTGACACTATAG)and T7 (TAATCGACTCACTATAGGG)primers, to check that the two clones isolatedcontained inserts of the same size and were there-fore likely to be derived from the same primarycolony.

2.2. Plasmid preparation and sequence analysis

Plasmids were purified from 3 ml culturesgrown from colonies of interest using a Wizard

L. Robertson et al. / Molecular and Biochemical Parasitology 111 (2000) 41–49 43

mini-prep kit (Promega) according to manufactur-ers instructions. Sequence analysis of all cloneswas conducted on an ABI 373 Stretch automaticsequencer using an Applied Biosystems BigDye cycle sequencing kit. Sequence comparisonswere made using the GCG package on theDaresbury computer facility or using BLAST ho-mology searches through the Expasy WWWpages (http://expasy.hcuge.ch/www/tools.html).Other predictions were made using a range ofprotein analysis software available through thesame site.

2.3. Expression and purification of recombinantperoxiredoxin

Following sequence analysis, one clone pre-dicted to encode a putative peroxiredoxin (TpX)was chosen for detailed study. A fragment of theG. rostochiensis TpX cDNA (Gr-TpX) corres-ponding to the entire coding region was ampli-fied from plasmid stocks with primers (TpXF-AGCTGGATCCATGTCTTCCAACTCAAAG-GCATTC and TpXR AGCTGGATCCGCGCT-TCTTGCCGAAAAATGTCTG) and cloned intopGEX2T (Pharmacia) using standard protocols.Success of the cloning procedure was confirmedusing restriction mapping and sequence analysisof purified plasmid. The purified plasmid wasthen transformed into BL21 cells (Pharmacia)for expression of fusion protein. Protein expres-sion was induced in log-phase cultures of BL21cells by addition of IPTG to a final concentrationof 100 mM. The glutathione S transferase(GST):Gr-TpX fusion was then affinity-purifiedfrom total protein by binding to glutathione-Sepharose slurry (Pharmacia Biotech) and recom-binant Gr-TpX (rGr-TpX) was liberated fromthe GST moiety by thrombin cleavage. Thepurity of the protein was confirmed by standardSDS-PAGE analysis on 10–20% Tris-GlycineMini-protean polyacrylamide gels (Bio-Rad).Protein yield was quantified by spectrophotome-try using a predicted extinction coefficient at280 nm of 17 900 M−1 cm−1 based on theamino acid composition of the recombinantprotein.

2.4. Biochemical assays

The biochemical function of the rGr-TpX wastested using a reconstituted trypanothione reduc-tase/trypanothione/tryparedoxin system whichtransfers reducing equivalents from NADPH totryparedoxin peroxidase [5]. Tryparedoxin perox-idase was replaced with rGr-TpX in this reactionscheme and the breakdown of various hydroper-oxides was measured by monitoring oxidation ofNADPH to NADP, by decrease in absorbance at340 nm. The final reaction mix contained 50 mMHepes pH 7.5, 50 mM trypanothione disulphide,15 nM trypanothione reductase, 300 nM trypare-doxin and 50 mM H2O2. The test enzyme wasadded at a concentration of 300 nM. Results wereanalysed using Microcal Origin software. The thi-ols present in G. rostochiensis J2s were determinedusing the monobromobimane method [15].Worms (250 000) were washed once with phos-phate buffered saline (137mM NaCl, 1.4mMKH2PO4, 2.6 mM KCl, 8.1 mM Na2HPO4, pH7.4), pelleted by centrifugation (14 000×g, 5 min)and resuspended in 0.1 ml 40 mM (Li+) HEPPS(N-[2hydroxyethyl] piperazine–N %–[3-propanesul-fonic acid]) buffer, pH 8.0, 4 mM DTPA (Di-ethylene triamine pentaaceticacid) followed by 0.1ml 2 mM monobromobimane in absolute ethanol.After heating at 70°C for 3 min, the sample wascooled and protein denatured by the addition of0.2 ml 4 M (Li+) methane sulphonic acid, pH 1.5.Following centrifugation, the clear supernatantwas removed and analysed by HPLC using thegradient modification detailed previously [16].

2.5. Antiserum and immunochemical studies

A rabbit polyclonal antiserum was raisedagainst rGr-TpX using standard protocols. Fourinjections of 250 mg were administered subcuta-neously at 2-week intervals. Freshly hatched sec-ond stage juveniles of G. rostochiensis wereprepared for fluorescence microscopy as previ-ously described [17]. The secondary antibody usedwas Goat anti-rabbit IgG, Cy3 conjugate (Sigma,St. Louis, MO). Nematodes feeding within rootswere also examined to determine the localisationof the TpX at this point in the life cycle. Seeds of


tomato (Lycopersicum esculentum), cv. Money-maker were germinated on 0.8% agar and germi-nating seeds were transferred to 0.2 Knopmedium [18]. After 2 weeks, the aerial parts of theplants were removed and the roots were infectedwith �150 G. rostochiensis J2. The nematodesinside the roots were prepared for transmissionelectron microscopy 3 days later essentially as in[19]. Sections were probed with anti rGr-TpXserum, with goat anti-rabbit IgG conjugated to 15nm gold particles as the secondary antibody, us-ing previously described methods [20] and stainedin uranyl acetate/lead citrate before viewing undera Philips CM10 transmission electron microscope(TEM).

2.6. RT-PCR

An RT-PCR reaction using the TpXR primerin combination with a primer designed to recog-nise the SL1 trans spliced leader sequence(GGTTTAATTACCCAAGTTTGAG) was usedto verify the sequence of the 5% end of the TpXmRNA. Although derived from C. elegans, this22nd sequence is also known to be present at the5% end of many G. rostochiensis mRNAs (J. Jones,unpublished data). mRNA was extracted from G.rostochiensis J2s using a micro-fast track kit (In-vitrogen) and converted to first strand cDNAusing a Riboclone cDNA synthesis kit (Promega).First strand synthesis was primed with an oligodT(15) primer. This cDNA was used as a templatein PCR reactions.

3. Results

3.1. cDNA library screening

After primary and secondary screening, severalindependent cDNA clones were isolated whichcontained the same cDNA sequence. This cDNAsequence had a poly-A tail at the 3% end preceded,13 nucleotides upstream, by a potentialpolyadenylation sequence. The spliced leader se-quence SL1 was present at the 5% end of thesequence. To confirm that the full 5% untranslatedregion had been isolated a product was amplified

using a primer designed to recognise the SL1sequence in combination with the TpXR primer.This product was of the anticipated size. Sequenc-ing of three independently generated clones of thisPCR product gave the same 5% untranslated se-quence, which was also the same as that isolatedfrom the cDNA library screens. No other poten-tial start codons were present in this upstreamsequence. Translation of the cDNA sequence re-vealed that the longest open reading frame couldencode a 199 amino acid protein with a predictedmolecular mass of 22 317 Da (Fig. 1). Compari-son of this amino acid sequence with those invarious databases showed that it had a high levelof similarity to peroxiredoxins from a wide rangeof parasites including O. 6ol6ulus (72% identical),B. malayi (62% identical), Trypanosoma brucei(61% identical) and Crithidia fasciculata (59%identical). The deduced amino acid sequence ap-peared to be complete at the N-terminus whencompared to the other sequences in the database.Several features conserved in thioredoxin peroxi-dases from various organisms were present in theG. rostochiensis sequence. These include two con-served cysteine residues flanked by valine andproline residues (VCP) at positions 32–34 and92–94. A potential O-linked glycosylation site isalso present at residue 183. The SignalP programpredicts that no cleavable signal sequence ispresent at the N-terminus of this protein.

3.2. Expression of recombinant protein

Recombinant Gr-TpX was produced andpurified to homogeneity as indicated by SDS-PAGE analysis (Fig. 2). rGr-TpX had an appar-ent molecular mass of 24 kDa when compared toSDS-PAGE standards.

3.3. Biochemical assays

When used in the C. fasciculata tryparedoxinsystem, rGr-TpX had an activity of 0.13 nmolml−1 min−1 with hydrogen peroxide as substrate(Fig. 3). Under identical conditions recombinantC. fasciculata tryparedoxin peroxidase showed 10-fold higher activity (1.3 nmol ml−1 min−1, calcu-lated from [5]). In contrast to the trypanosomatid


enzyme, which is equally active with cumene hy-droperoxide or t-butyl hydroperoxide in place ofhydrogen peroxide, the nematode enzyme showedB5% activity with these organic peroxides (Fig.3). Analysis of the thiols present in G. rostochien-sis demonstrated that glutathione (4.1 nmol [106

nematodes]−1) is the principal low molecularmass thiol in invasive stage juveniles (J2s) and,unlike in C. fasciculata, no trypanothione, glu-tathionylspermidine or ovothiol was detected.

3.4. Immunolocalisation of rGr-TpX

Western blots using the antiserum raisedagainst rGr-TpX confirmed that it recognised therecombinant protein. The serum also specificallyrecognised a single band of the expected molecu-lar mass in Western blots of separated ho-mogenates of G. rostochiensis J2s (Fig. 4(a)) whilepre-immune serum gave no detectable binding. Inimmunolocalisation experiments, the anti-rGr-TpX antiserum recognised the surface, and mate-

rial shed from the surface, of the nematode (Fig.4(b)). Pre-immune serum gave no detectable bind-ing on G. rostochiensis J2s. Experiments werecarried out to determine the fate of the proteinonce the nematode had entered the roots andsettled to feed. Transmission electron microscopeimmunogold labelling experiments showed theprotein surrounding the nematode and, to a lesserextent, within the parasite (Fig. 5). No labelling ofplant tissues away from the nematode was ob-served, indicating that the antiserum bound solelyto material of parasite origin. Pre-immune serumgave no detectable binding on sections of ne-matodes in roots.

4. Discussion

Screening of a G. rostochiensis cDNA libraryled to the isolation of a full-length cDNA encod-ing a putative peroxiredoxin. When cloned into abacterial expression vector the protein produced

Fig. 1. Alignment of G. rostochiensis peroxiredoxin with orthologues from other parasites. Absolutely conserved residues are boxed.Conserved residues around active site cysteines are highlighted in black. Alignment was generated on Multalin software [26] usingthe Blosum 62 matrix.


Fig. 2. SDS-PAGE analysis of rGr-TpX. A single protein witha molecular mass of �24 kDa is present following expression,cleavage and purification of fusion protein. M, prestainedmolecular weight standards (Bio-Rad); TpX, thioredoxin per-oxidase. Molecular masses of markers (from top to bottom):94, 67, 43, 30, 20.1, and 14.4 kDa, respectively.

nematode. Gr-TpX shows very high similarity tothioredoxin peroxidases from a wide range ofparasite species. Two conserved sequence motifs(VCP) thought to form part of the active site ofthis class of protein [21] are present in the G.rostochiensis sequence. This feature also allowsthe G. rostochiensis protein to be classified as a2-Cys-peroxiredoxin [22].

We used a reconstituted C. fasciculata trypare-doxin peroxidase system to demonstrate the bio-chemical function of Gr-TpX as a peroxidase [5].Subsequent analysis of thiols in G. rostochiensisshowed that the Gr-TpX is unlikely to operate ina similar trypanothione containing pathway invivo and the physiological reducing agent remainsto be determined. The G. rostochiensis enzymeonly catalysed breakdown of hydrogen peroxidein this test system in contrast to the C. fasciculataenzyme, which utilises a broader range of sub-strates [5,23]. Although it is possible that thesedifferences are due to problems in transferring anematode protein to a trypanosome biochemicalpathway, a more likely explanation is that, likeother peroxiredoxins, the Gr-TpX breaks down amore restricted range of substrates than the C.fasciculata protein. In contrast to C. fasciculata,nematodes (including plant parasitic forms) pos-sess a wide range of antioxidant proteins includ-

from this cDNA was shown to have appropriateenzymatic activity. These results allow Gr-TpX tobe identified as a functional peroxiredoxin of G.rostochiensis, the first from any plant parasitic

Fig. 3. Oxidation of NADPH due to breakdown of various hydroperoxides by Gr-TpX. Large ticks on Y axis=0.05 absorbanceunits. a, t-butyl hydroperoxide; b, cumene hydroperoxide; c, hydrogen peroxide. The rate of oxidation of NADPH (nmol min−1

ml−1) is indicated above each curve.


Fig. 4. (a) Binding of anti-rGrTpX antiserum to proteinsextracted from J2s of G. rostochiensis. Antiserum binds to asingle major band (arrowhead) in homogenates of J2s (J2).Molecular masses of markers (M) in ascending order: 7.2,18.7, 31, 45, 86, 123, and 207 kDa, respectively. (b) Binding ofanti-rGr-TpX antiserum to invasive G. rostochiensis J2. Anti-serum binds to the surface of the parasite and to material shedin great quantity from the parasite surface.

Thioredoxin peroxidase is extremely abundantin O. 6ol6ulus, forming �2.5% of the clones in arepresentative cDNA library made from invasivestage juveniles of this nematode. Consequently itis thought to be the major hydrogen peroxideremoval enzyme of this species [9]. PreliminaryEST analysis suggests that the peroxiredoxinmRNA is also extremely abundant in G. ros-tochiensis (Jones et al., in preparation) suggestingit plays an important role in the physiology of thisparasite. The Gr-TpX is present on the surface ofinvasive J2s and on the surface of J2s feeding inthe roots suggesting a role for the protein at thehost–parasite interface, possibly in defence of theparasite from host defence responses mediatedthrough an oxidative burst. This is consistent withthe recent finding that hydrogen peroxide is pro-duced as part of the defence response of plantswhen attacked by nematodes [3]. A similar rolehas been postulated for peroxiredoxins from ani-mal parasitic nematodes. This protein is presenton the surfaces of infective and post-infective O.6ol6ulus larvae [9] and of B. malayi [10] and hasbeen considered to protect these parasites fromactive oxygen species generated by their hosts.

How peroxiredoxins arrive at the nematodesurface is unclear as a common feature of theseproteins in animal parasites and G. rostochiensis isthat they all lack an obvious cleavable N-terminalsignal sequence. Two explanations for this obser-vation are possible. First, it is possible that sur-face localised thioredoxin peroxidases do possesssignal sequences but that none have yet beenidentified and that the labelling observed withantisera represents cross reactivity due to conser-vation of amino acid sequences. However, noexamples of peroxiredoxins with predicted signalsequences have been identified in the large ex-pressed sequence tag (EST) datasets which existfor many parasitic nematodes including G. ros-tochiensis (see http://www.ebi.ac.uk/parasites/parasite–blast–server.html for up to date infor-mation on progress of parasite EST and genomeprojects) or amongst the predicted proteins fromthe C. elegans genome. ESTs have been obtainedfrom two 2-cys peroxiredoxins and one 1-cys per-oxiredoxin of G. rostochiensis ; none of these cD-NAs predicts a protein with a cleavable

ing catalases and the glutathione peroxidase/re-ductase system [11] (Jones, unpublished observa-tions). The broad range of substrates utilised bythe C. fasciculata enzyme may therefore be anadaptation to compensate for the absence of theseother antioxidant proteins [24].


Fig. 5. Binding of anti-rGr-TpX antiserum to G. rostochiensis J2 feeding in host root. Antiserum binds to the nematode (n) and tothe region surrounding the parasite (s), which may contain material shed from the parasite surface. No binding of antiserum to planttissues (p) is observed. Scale bar=1 mM.

N-terminal signal sequence. Our western blotsusing a polyclonal antiserum raised againstrecombinant Gr-TpX showed binding of thisserum to a single band in G. rostochiensis ho-mogenates arguing against the presence of multi-ple forms of this protein. Furthermore, Southernblots using a probe derived from the Gr-TpXdo not suggest the presence of a family of relatedgenes in digested G. rostochiensis genomicDNA (not shown). Given this, it seems thatthese proteins are secreted from nematodes byan as yet uncharacterised mechanism. Someproteins without signal sequences are known to betransported across membranes [25] and it is feasi-ble that a similar mechanism operates in ne-matodes.

Thioredoxin peroxidases have now been clonedfrom a variety of nematodes occupying a diverserange of ecological niches. They are clearlypresent in abundance in many parasitic ne-matodes. Nematode parasites of both animals andplants appear to have adapted this protein to playan analogous role in defence against very differenthost responses.

Acknowledgements

This work was supported by Scottish OfficeAgriculture, Environment and Fisheries Depart-ment project number SCR/514/98 and by EUgrant number Bio4-CT96-0318. MiroslawSobczak was supported by a Royal Society/NATO fellowship and Alan Fairlamb was fundedby the Wellcome Trust. The assistance of ClareMcQuade in running sequencing gels is gratefullyacknowledged. The authors also thank Dr D.L.Trudgill for helpful comments on the manuscriptand for his enthusiasm and encouragement forthis area of work.

References

[1] Baker CJ, Orlandi EW. Active oxygen in plant pathogen-esis. Ann Rev Phytopathol 1995;33:299–321.

[2] Lamb C, Dixon RA. The oxidative burst in plant diseaseresistance. Ann Rev Plant Physiol Mol Biol 1997;48:251–75.

[3] Waetzig GH, Sobczak M, Grundler FMW. Localizationof hydrogen peroxide during the defence response of


Arabidopsis thaliana against the plant parasitic nematodeHeterodera glycines. Nematology 1999;1:681–6.

[4] Atkinson HJ. Respiration in nematodes. In: ZuckermanBM, editor. Nematodes as biological models. New York:Academic Press, 1980. p. 101–142.

[5] Tetaud E, Fairlamb AH. Cloning, expression and recon-stitution of the trypanothione-dependent peroxidase sys-tem of Crithidia fasciculata. Mol Biochem Parasitol1998;96:111–23.

[6] Henkle K, Liebau E, Muller S, Bergmann B, Walter RD.Characterisation and molecular-cloning of a Cu/Zn su-peroxide dismutase from the human parasite Onchocerca6ol6ulus. Infect Immun 1991;59:2063–9.

[7] Cookson E, Blaxter ML, Selkirk ME. Identification ofthe major cuticular glycoprotein of lymphatic filarial ne-matode parasites (gp29) as a secretory homolog of glu-tathione peroxidase. Proc Natl Acad Sci USA1992;89:5837–41.

[8] Klimowski L, Chandrashekar R, Tripp CA. Molecularcloning, expression and enzymatic activity of a thiore-doxin peroxidase from Dirofilaria immitis. Mol BiochemParasitol 1997;90:297–306.

[9] Lu WH, Egerton GL, Bianco AE, Williams SA. Thiore-doxin peroxidase from Onchocerca 6ol6ulus : a major hy-drogen peroxide detoxifying enzyme in filarial parasites.Mol Biochem Parasitol 1998;91:221–35.

[10] Ghosh I, Eisinger SW, Raghavan N, Scott AL. Thiore-doxin peroxidases from Brugia malayi. Mol BiochemParasitol 1998;91:207–20.

[11] Molinari S, Miacola C. Antioxidant enzymes in phytopar-asitic nematodes. J Nematol 1997;29:153–9.

[12] Robertson L, Robertson WM, Jones JT. Direct analysisof the secretions of the potato cyst nematode Globoderarostochiensis. Parasitology 1999;119:167–76.

[13] Smant G, Stokkermans JPWG, Yan Y, et al. Endogenouscellulases in animals: Isolation of b-1,4-endoglucanasegenes from two species of plant parasitic nematodes. ProcNatl Acad Sci USA 1998;95:4906–11.

[14] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning:A laboratory manual. 2nd ed. Cold Spring Harbor: ColdSpring Harbor Laboratory Press, 1989.

[15] Shim H, Fairlamb AH. Levels of polyamines, glutathioneand glutathione spermidine conjugates during growth ofthe insect trypanosomatid Crithidia fasciculata. J GenMicrobiol 1988;134:807–17.

[16] Ariyanayagam MR, Fairlamb AH. Entamoeba histolyticalacks trypanothione metabolism. Mol Biochem Parasitol1999;103:61–9.

[17] Duncan LH, Robertson L, Robertson WM, Kusel JR.Isolation and characterisation of secretions from the plantparasitic nematode Globodera pallida. Parasitology1997;115:429–38.

[18] Sijmons PC, Grundler FMW, Von Mende N, BurrowsPR, Wyss U. Arabidopsis thaliana as a new model host forplant parasitic nematodes. Plant J 1991;1:245–54.

[19] Golinowski W, Grundler FMW, Sobczak M. Changes inthe structure of Arabodopsis thaliana during female devel-opment of the plant-parasitic nematode Heteroderaschachtii. Protoplasma 1996;94:103–16.

[20] Fasseas C, Roberts IM, Murant AF. Immunogold locali-sation of parsnip yellow fleck virus particle antigen in thinsections. J Gen Virol 1989;70:2741–9.

[21] Chae HZ, Kim IH, Kim K, Rhee SG. Cloning, sequenc-ing and mutation of thiol-specific antioxidant gene ofSaccharomyces cere6isiae. J Biol Chem 1993;268:16815–21.

[22] McGonigle S, Dalton JP, James ER. Peroxiredoxins: Anew antioxidant family. Parasitol Today 1998;14:139–45.

[23] Nogoceke E, Gommel DU, Kiess M, Kalisz HM, FloheL. A unique cascade of oxidoreductases catalyses trypan-othione-mediated peroxide metabolism in Crithidia fascic-ulata. Biol Chem 1997;378:827–36.

[24] Fairlamb AH, Cerami A. Metabolism and functions oftrypanathione in the kinetoplastida. Ann Rev Microbiol1992;22:295–314.

[25] Kuchler K, Thorner J. Secretion of peptides and proteinslacking hydrophobic signal sequences — the role ofadenosine triphosphate-driven membrane translocators.Endoc Rev 1992;13:499–514.

[26] Corpet F. Multiple sequence alignment with hierarchicalclustering. Nucl Acids Res 1988;16:10881–90.

.

Cloning, expression and functional characterisation of a peroxiredoxin from the potato cyst nematode...

Documents

Transcript of Cloning, expression and functional characterisation of a peroxiredoxin from the potato cyst nematode...