Cloning and molecular characterization of Penicillium expansum genes upregulated under conditions...

CloningandmolecularcharacterizationofPenicilliumexpansumgenesupregulatedunderconditionspermissivefor patulinbiosynthesisSandra White, John O’Callaghan & Alan D.W. Dobson

Department of Microbiology, and Environmental Research Institute, University College Cork, National University of Ireland Cork, Cork, Ireland

Correspondence: Alan D.W. Dobson,

Department of Microbiology, University

College, National University of Ireland, Cork,

Ireland. Tel.: 1353 21 4902743; fax:1353 21

4903101; e-mail: [email protected]

Received 13 September 2005; accepted

4 November 2005.

First published online 15 December 2005.

doi:10.1111/j.1574-6968.2005.00051.x

Editor: Geoffrey Gadd

Keywords

patulin; Penicillium expansum; isoepoxydon

dehydrogenase; 6-methylsalicylic acid synthase;

ABC transporters; cytochrome p-450

monooxygenases.

Abstract

Penicillium expansum is commonly associated with patulin production in pomac-

eous fruits. Both the full-length isoepoxydon dehydrogenase (idh) gene and a

470 bp fragment of the 6-methylsalicylic acid synthase (6-msas) gene have been

cloned from P. expansum. In addition, we cloned a 715 bp fragment of a putative

ATP-binding cassette transporter gene peab1, together with part of two putative

cytochrome P450 monooxygenase genes P-450 1 and P-450 2. Increased expression

of all five genes was observed under patulin-permissive conditions, indicating not

only their likely involvement in patulin biosynthesis but indicating for the first

time that regulation of patulin biosynthesis in P. expansum is mediated at the level

of gene transcription.

Introduction

The mycotoxin patulin (4-hydroxy-4H-furo [3,2c] pyran-

2[6H]-one) is produced by a number of different Penicillium

species, including Penicillium griseofulvum, Penicillium pa-

neum, Penicillium patulum, Penicillium carneum and Peni-

cillium sclerotigenum (Frisvad & Samson, 2004; Dombrink-

Kurtzman & Blackburn, 2005). Penicillium expansum is the

species most commonly associated with spoilage and myco-

toxin production in apples, apple juice and in pomaceous

fruits; with production occurring predominantly during

storage of apples (Watanabe & Shimizu, 2005). Patulin is

destroyed by the fermentation process and thus is not found

in either alcoholic or fruit beverages. It will however survive

the pasteurization process if present in the juice. Patulin is

cytotoxic to immortalized cell lines (Barhoumi & Bur-

ghardt, 1996), and is believed to exert its cytotoxic effects

by forming covalent adducts with essential cellular thiols of

amino acids, (Riley & Showker, 1991). The potential adverse

effects of this mycotoxin are reflected in the fact that it was

deemed necessary to set an upper limit of intake because of

the high amounts of fruit juices typically consumed by

children and infants. In Europe, a maximum level of 50mg

patulin per kg has been established for apple juice and apple

cider, while maximum levels for solid apple products and

apple products intended for consumption by young children

have been set at 25mg and 10mg kg�1, respectively (Commi-

sion Regulation, 2003). In addition the USFDA (2004) has

set limits for patulin of 50mg L�1 in single-strength and

reconstituted apple juices.

The pathway leading to the production of patulin from

the polyketide, 6-methylsalicylic acid (6-MSA) has been

established using mutants and by examining the time of

appearance of intermediates in the pathway and is thought

to involve at least 10 different enzymatic steps (Fig. 1) (for a

review, see Moake et al., 2005). However, only two of the

genes encoding these enzymes have been cloned and

sequenced to date namely the 6-methylsalicylic acid

synthase (6-msas) gene (Beck et al., 1990) and the isoepox-

ydon dehydrogenase gene (idh) (Gaucher & Fedeshko,

2000), both from Penicillium urticae. We report here on the

cloning of 6-msas and idh homologues from the other main

patulin producing Penicillium strain, P. expansum; together

with the cloning of part of two cytochrome P450 monoox-

ygenase genes P450-1 and P450-2 and a putative ATP-

binding cassette (ABC) transporter gene PEAB1. These

FEMS Microbiol Lett 255 (2006) 17–26 c� 2005 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

genes appear to be involved in the patulin biosynthesis in

P. expansum, since their transcription is up-regulated under

conditions that are permissive for patulin production.

Materials andmethods

Culture,mediaandgrowth conditions

Penicillium expansum strains IBT 21771, was obtained from

the IBT Culture Collection of Fungi (Technical University of

Denmark). The fungus was grown in a liquid medium

containing either 35 g L�1 czapek-dox broth (CYB) or

24 g L�1 potato dextrose broth (PDB) at 30 1C without shak-

ing in the dark. PDB media supported the production of

patulin (permissive) while CYB media did not (White, 2005).

High-performance liquid chromatography(HPLC)analysis of patulin production

Patulin was extracted from the culture media using ethyl

acetate. Analysis of extracts was performed by high-perfor-

mance liquid chromatography (HPLC) according to stan-

dard protocols (ISO 8128-1:1993) using a Beckman System

Gold HPLC machine and a Beckman Ultraphere C18

(250� 4.6 mm, 5mM) reversed phase column. Fifty micro-

litres of sample was injected using a Beckman 508 auto

sampler (Beckman-Coulter, Fullerton, CA), the mobile

phase was acetonitrile/water (10 : 90) at a flow rate of

1.0 mL min�1 and patulin was detected by UV absorbance

at 276 nm on a Beckman 166 UV-VIS detector (Beckman-

Coulter). Patulin standards (Sigma-Aldrich, St Louis, MO)

were diluted to varying concentration with ethyl acetate and

used to verify results.

RNApreparationand cDNAsynthesis

RNA was isolated from frozen (� 70 1C) mycelial tissue using

an RNeasy Plant Mini kit (Qiagen, Hilden, Germany). One

hundred milligrams of frozen mycelial tissue was ground

under liquid nitrogen with a mortar and pestle and total

RNA was isolated according to the manual. The RNA samples

were treated with DNAse I (Roche Diagnostics, Mannheim,

phyllostine

CH3 CH3

OH

6-methylsalicylic acid

OHm-cresol

m-hydroxybenzyl alcohol

OH

CH2OH

CHO

OH

m-hydroxybenzaldehydeOH

HO

gentisyl alcohol

CH2OH

CHO

OH

HO

gentisaldehyde

M-cresol2-hydroxylase

m-hydroxybenzylAlcohol dehydrogenase

Isoepoxydondehydrogenase

OH

gentisic acid

OH

COOH

OH

CH3

CHO

C

OCH2OH

CH2OH

O

OO

O

OHO

CH2OH

6-MSAsynthase

6-MSAdecarboxylaseAcetyl-CoA

+3 Malonyl-CoA

CO2H

OH

toluquinoneO

OOH

O

patulin

HOCH2

O

(E)-ascladiol

C

HO

CH2OH

O

H

isoepoxydon

neopatulin

Fig. 1. Patulin biosynthetic pathway. The relevant metabolic intermediates and enzymes involved in the biosynthesis of patulin are shown. Adapted

from Moake et al. (2005).

FEMS Microbiol Lett 255 (2006) 17–26c� 2005 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

18 S.White et al.

Germany) and stored at � 80 1C until needed. cDNA was

synthesized from each sample using the SMARTTM PCR

cDNA Synthesis kit (BD Biosciences Clontech, Palo Alto,

CA) according to the manufacturer’s instructions.

Suppression subtractivehybridization (SSH)-PCR

Suppression subtractive hybridization (SSH)-PCR was per-

formed with a PCR-Select kit (BD Biosciences Clontech) as

specified by the manufacturer. cDNA from tissue which

produced patulin served as the tester DNA and cDNA from

tissue which did not produce patulin served as the driver

DNA. All PCR amplifications during the cDNA synthesis and

suppression subtractive hybridization (SSH)-PCR reactions

were performed with an Advantage-2 PCR kit (BD Biosciences

Clontech) as previously described (O’Callaghan et al., 2003).

CloningofPCRproducts

The final pool of PCR products representing the genes

which are expressed under patulin-permissive conditions

but are down-regulated under patulin restrictive conditions

were cloned into the pGEM-T easy vector (Promega, Madi-

son, WI) and the ligation mixtures were transformed into

chemically competent TOP10 Escherichia coli cells

(Invitrogen, Groningen, the Netherlands).

Identificationof up-regulated clones

White colonies, representing cells containing a vector with an

insert, were picked from plates with a sterile wooden stick and

used in colony PCRs containing nested primers from the SSH-

PCR kit. 2.5mL of each PCR product was transferred onto

duplicate nitrocellulose membranes (Hybond-N1, Strata-

gene, La Jolla, CA) and allowed to dry. The PCR samples were

fixed to the membrane by UV cross linking (Stratalinker,

Stratagene). Probes consisting of driver and tester cDNA were

radioactively labeled with a 32P ATP (Amersham Biosciences,

Bucks, UK) using the Prime-a-gene labeling kit (Promega).

Probing was carried out according to standard procedures and

blots were washed to a stringency of 0.1% SSC/0.1% SDS.

Table 1. Polymerase chain reaction primers used in this study

Name Primer sequence 50–30 Annealing temperature ( 1C)

IDH F1 GGNGARGCNATGGTNCATAARTT 58

IDH R1 CCAATGYTCNGTCTCNCCCTCCATATG 58

IDH BSP1 GGTGCATAAATTCCTCCAG 60

NSP1 TGCCCGGACTGTCACCAATA 58

ICP F1 GACGCTCGCTAAGGGTAA 56

ICP R1 GCCCTTCCAATGTTCGGTCTC 56

IDH BSP 2 CCGGAATGGGTGGAGGAACAG 58

NSP 2 GGANGCCCGACAGAGGTG 58

ICP F2 TCTGCCCTTCTTTTCCCTCTGTTG 56

ICP R2 TCCTCTCGCCAGCTTTGTGACG 56

IDH BSP 3 ANCGGGGCTGCCACCTCTGTC 60

NSP 3 AGTCGCTGTTCCTCCACCCATTCC 58

ICP F3 GGATTGGCCCTGGCGAGATGG 57

ICP R3 AGGCGAGACGGAGGACTGGAGAA 57

SD FP1 CAGTTCAAGCTTGTCCAGGAATTCNNNNNNNCCGGT 58

SD FP 2 CAGTTCAAGCTTGTCCAGGAATTCNNNNNNNGCGCT 58

SD FP 3 CAGTTCAAGCTTGTCCAGGAATTCNNNNNNNGGCCT 58

SD FP 4 CAGTTCAAGCTTGTCCAGGAATTCNNNNNNNCGCGT 58

ND primer CAGTTCAAGCTTGTCCAGGAATTCNNNNNNN 58

P450-2F1 AGCGGCCAAACTCATGACTAACTG 58

P450-2R1 CCCGGATTTGTAAAGACTGGAC 58

P450-1F1 ACGCGGCCAGTTTTGAT 59

P450-1R1 TTTGGCCGCGTCTGACCTTCTT 59

MSAS F2 CGAAATCGCGGCCAGTGTTGTG 60

MSAS R2 GACCATGTTGCCGGCCCAGTATTC 60

IDH F1 GGNGARGCNATGGTNCATAARTT 58

IDH R1 CCAATGYTCNGTCTCNCCCTCCATATG 58

G3PDH-F CGGCTTCGGTCGTATTGG 55

G3PDH-R TGGAGGAGGGGATGATGTT 55

ATP 3F TGAGCTCCACCGCCCACAAG 62

ATP 2R GGTGGGAGATGCGAAGATTAGAGG 62

BSP, biotinylated-specific primer; NSP, nested specific primer; ICP, internal control primer.


19Cloning and molecular characterization of P. expansum genes

Fig. 2. (a) Alignment of the deduced amino-acid sequence of the Penicillium expansum 6-methylsalicylic acid synthase (6-MSAS) compared with part of

6-MSAS proteins from Penicillium griseofulvum ( synonyms of Penicillium patulum, Penicillium urticae), Byssochlamys nivea and Aspergillus terreus (Fujii

et al., 1996). Those residues shaded in black are residues common in at least three of the four sequences. (b) (page 5) Alignment of the deduced amino-

acid sequence of the P. expansum IDH with that of the P. urticae IDH (Gaucher & Fedechko, 2000), to a keto-acyl reductase protein from

Rhodopseudomonas palustris (Latimer et al., 2004) and to a short chain alcohol dehydrogenase from Brevibacterium linens. Those residues shaded in

black are residues common to at least three of the four sequences.


20 S.White et al.

Hybridization was detected by autoradiography with KODAK

biomax film after overnight exposure at � 70 1C.

Sequencing of clones

Those PCR products which hybridized strongly to the tester

probe and weakly to the driver probe were sequenced.

Before sequencing the clones were grown in Luria–Bertani/

amp media in 96-well microtiter plates overnight at 37 1C.

Forty percent glycerol (volume in volume) was added and

colonies were frozen at � 80 1C. DNA preparation and

sequencing was carried out by Lark Technologies (Essex,

UK). These sequences were then compared to sequences in

the NCBI database using the BLASTX algorithm.

Amplificationofflanking region (AFR)-PCR

A series of biotinylated primers (Table 1) were designed to

allow the sequential amplification of a full length idh gene

and flanking sequence based initially on the DNA sequence

of the 320 bp idh clone, using an amplification of flanking

region (AFR)-based approach as previously described (So-

den & Dobson, 2003).

Reverse transcriptase-PCR

Complementary DNA was synthesized from mycelia grow-

ing under patulin permissive and patulin restrictive condi-

tions using Expand reverse transcriptase and random

hexamer primers (Roche Diagnostics), as previously de-

scribed (Soden & Dobson, 2001). PCR was carried out on

the cDNA using primers specific to the cloned gene sequence

(P450-2F1, P450-2R1, P450-1F1 and P450-1R1; Table 1).

Primers specific to the constitutively expressed housekeep-

ing gene, glyceraldehyde-3-phosphate dehydrogenase

(G3PDH-F and G3PDH-R; Table 1) were used to equalize

the reaction. The concentration of cDNA used in each PCR

reaction was adjusted such that a G3PDH PCR product

appeared at the same cycle number when using either

permissive or restrictive cDNA as a template in the PCR

reaction. This ensured that equal concentrations of template

cDNA were used in both reactions.

Quantitative real-timePCR

Real-time PCR was carried out on a LightCyclerTM (Roche

Diagnostics). Reactions were carried out in LightCyclerTM

glass capillaries (Roche Diagnostics), as per the manufac-

turer’s instructions for the LightCyclerTM Faststart Master

SYBR Green I kit (Roche Diagnostics) which was used for all

reactions. All LightCyclerTM (LC) assay analysis was carried

out using the fit points option of the LC software (version

3.39, Roche Diagnostics) as previously described (Casey &

Dobson, 2004).

Nucleotide sequenceaccessionnumbers

The nucleotide sequences described in this work have been

assigned the following GenBank accession numbers: msas,

DQ084387; idh, DQ084388; p450-1, DQ084389; p450-2,

DQ084390; peab1, DQ084391.

Results

Cloningofa6-msasgene fragment

Primers MSAS 2F and MSAS 2R (Table 1), designed to

conserved regions in previously cloned 6-msas genes from

other fungal species were used to amplify a 470 bp PCR

product from Penicillium expansum IBT 21771. The nucleo-

tide sequence showed similarity to the previously cloned

Penicillium patulum 6-msas gene (Beck et al., 1990), while

the deduced amino-acid sequence of this product displayed

high levels of similarity to the 6-MSAS proteins from

Byssochlamys nivea and Aspergillus terreus (Fig. 2a). The

gene appears to encode for part of the acyl-transferase

domain of the 6-msas gene; common to many polyketide

synthase (PKS) enzymes involved in mycotoxin biosynth-

esis. The acyl-transferase domain is believed to be involved

in delivering the extender unit, in this case malonlyl-CoA, to

the PKS complex for condensation and linkage to the

polyketide chain.

Cloningofthe idhgene

Degenerate primers IDH F1 and IDHR1 (Table 1) based on

a Penicillium urticae isoepoxydon dehydrogenase gene se-

quence (Gaucher & Fedeshko, 2000), were designed to

amplify a 320 bp isoepoxydon dehydrogenase gene frag-

ment from P. expansum IBT 21771. Upstream and down-

stream regions flanking this 320 bp fragment were then

cloned by using an AFR approach to generate a full-length

idh clone. The full-length idh gene sequence beginning

with a conventional ATG start codon, consisted of a 882 bp

nucleotide ORF capable of encoding a deduced protein of

259 amino acids with two introns of 55 and 54 bp, respec-

tively. The idh gene nucleotide sequence showed 85%

similarity to the previously cloned idh gene from P. patulum.

There was also strong similarity at the deduced amino-

acid level to an IDH from P. urticae, to a keto-acyl reduc-

tase protein from Rhodopseudomonas palustris (Latimer

et al., 2004) and to a short chain alcohol dehydrogenase

from Brevibacterium linens (Fig. 2b). A 153 bp region

located upstream of the idh gene contained a putative

TATA box at � 27 bp and putative CAAT boxes as well as

a putative GC box at � 188 bp. This represents the first

full length patulin biosynthetic gene to be cloned from

P. expansum.



Cloningofpartofa putativeABCtransportergene

PCR primers ATP 3F and ATP 2R (Table 1), designed based

on a gene sequence which had been reported to be located

upstream of the Penicillium urticae idh gene (Gaucher &

Fedechko, 2000), were used to amplify a 715 bp gene

fragment from P. expansum. This 715 bp gene fragment,

peab1, displayed 87% nucleotide identity to a putative ABC

transporter gene in P. urticae while the deduced amino-acid

sequence displaying 45% identity to an ABC transporter

protein in Botyrotinia fuckeliana, 43% identity to a putative

ABC transporter from Candida albicans (Jones et al., 2004)

and 33% identity to an ABC transporter in Penicillium

digitatum (Nakaune et al., 1998), (Fig 3).

Expressionofthemsas, idhandpeab1genes

Reverse transcriptase-PCR was then performed on P. expan-

sum IBT 21771 cultures grown under both patulin permis-

sive and restrictive conditions, to determine whether

expression of these three genes correlated with patulin

production. Transcription of the G3PDH gene was also

monitored as a control. The expression levels of all three

genes were higher under patulin-permissive conditions,

indicating a link between these genes and patulin biosynth-

esis in the fungus (Fig. 4). In contrast, expression of the

housekeeping G3PDH gene was similar in P. expansum

under both patulin permissive and restrictive growth condi-

tions indicating that the observed effects were not occurring

simply as a result of global changes in gene expression.

Suppressionsubtractivehybridization (SSH)-PCR

Having cloned three putative patulin biosynthetic genes we

then used a SSH-PCR-based approach to clone additional

genes involved in patulin production in P. expansum.

Following SSH-PCR a pool of PCR products that repre-

sented transcripts preferentially expressed under patulin-

permissive conditions was obtained. We analysed 800 of

these PCR products, and 197 of these which hybridized

strongly to the permissive cDNA were subsequent sequen-

cing. Nine of these clones showed similarity to previously

cloned cytochrome P450 monooxygensase genes. Subse-

quent analysis indicated that these nine clones in fact

represented two distinct cloned sequences, namely p450-1

and p450-2. The deduced amino-acid sequence of these two

clones displayed 39–43% identity at the deduced amino-

acid level with other fungal cytochrome P450 monooxy-

genases (Figs 5a and b).

Transcriptionof p450-1andp450-2genes

Reverse transcriptase-PCR analysis was then performed, and

high levels of expression of both p450-1 and p450-2 was

shown to occur only during patulin biosynthesis (Fig. 4).

Real-time PCR was then used to quantify this level of up-

regulation, by comparing the copy number of these

Fig. 3. Alignment of the deduced amino-acid sequence of Penicillium expansum PEAB1 with part of ATP-binding cassette transporter proteins of Botryotinia

fuckeliana, Penicillium digitatum and Candida albicans. Those residues shaded in black are residues common to at least three of the four sequences.


22 S.White et al.

transcripts under both permissive and restrictive conditions.

p450-2 transcript levels (1.98� 107 copies per mg�1 RNA, in

permissive medium) and (1.76� 104 copies per mg RNA, in

restrictive medium) were shown to be up-regulated 1127-

fold while the p450-1 gene transcript levels (1.4� 105 copies

per mg�1 RNA, in permissive medium and 5.6� 102 copies

per mg RNA, in restrictive medium) were up-regulated 250-

fold under patulin-permissive conditions, indicating the

likely involvement of both these genes in patulin biosynth-

esis in P. expansum. Expression of the housekeeping G3PDH

gene was similar in P. expansum under both patulin permis-

sive (1.25� 105 copies per mg RNA) and restrictive

(1.35� 105 copies per mg RNA) growth conditions indicat-

ing that the observed effects were not occurring because of

global changes in gene expression.

Discussion

Patulin is a secondary metabolite predominantly produced

by different species of the genera Penicillium with Penicillium

expansum being generally regarded as the main producer in

apples, the major potential dietary sources of patulin in

humans. Particular concerns centres on the consumption of

apple-based products by young children, who are known to

consume increased levels of apple products during their first

years of life; and whose lower body weights means that the

amount consumed per kilogram body mass is high, when

compared with adults (Moake et al., 2005). Strict regulations

exist both in Europe and in the US concerning maximum

levels for patulin in apple-based products intended for

young children Commision Regulation 2003, USFDA 2004.

We set out to genetically characterize the patulin biosyn-

thetic genes from P. expansum, with a view ultimately to

identify potentially useful target genes for molecular-based

detection methods. Patulin is believed to be derived from

the polyketide, methylsalicylic acid following around 10

possible enzymatic modifications (Fig. 1). A number of

these enzymes namely 6-methylsalicylic acid decarboxylase,

isoepoxydon dehydrogenase and a putative cytochrome P-

450, have been biochemically characterized from Penicillium

patulum (Scott & Beadling, 1974; Murphy & Lynen, 1975);

while two of the genes namely the idh gene from Penicillium

urticae (Gaucher & Fedeshko, 2000) and the 6-msas gene

from P. patulum (Beck et al., 1990) have been cloned and

sequenced.

Our aim was to clone homologues of both the 6-msas and

idh genes from P. expansum and to determine whether

expression of these genes correlated with patulin produc-

tion. To this end both a 470 bp fragment of the 6-msas gene

and the full length idh gene were cloned from P. expansum

IBT 21771 and were found to display a high degree of

similarity at both the nucleotide and deduced amino-acid

level with previously cloned fungal genes in the databases

(Fig. 2). Expression of these genes was shown to be higher

under patulin-permissive conditions (Fig. 4); indicating for

the first time that regulation of patulin biosynthesis in P.

expansum is mediated at the level of gene transcription.

Transcriptional regulation of mycotoxin biosynthetic genes

under different physiological conditions is quite common in

mycotoxigenic fungi, for example for aflatoxin and sterig-

matocystin production in Aspergillus parasiticus and Asper-

gillus nidulans (Liu & Chu, 1998; Bhatnagar et al., 2003).

This suggested to us that other genes involved in patulin

Fig. 4. (a) Reverse transcriptase-PCR analysis of gene transcription of (1)

idh gene, (2) msas gene, (3) peab1 gene, (4) p450-1, (5) p450-2 and (6)

glyceraldehyde-3-phosphate dehydrogenase gene as a control in patulin

permissive (1) potato dextrose medium (PDB) and restrictive (� )

Czapek-Dox yeast medium (CYB). (b) Patulin production by Penicillium

expansum in permissive and restrictive media.



biosynthesis might also be transcriptionally regulated and

that the use of a SSH-based approach might prove useful in

identifying these genes in P. expansum.

Using this SSH approach we identified putative cyto-

chrome P450 monooxygenase gene fragments, namely

p450-2 and p450-1 whose expression was shown to be up-

regulated by 1127- and 250-fold, respectively, under patulin-

permissive conditions. Cytochrome P450 monooxygenase

genes have previously been shown to be involved in the

biosynthesis of other mycotoxins; for example in the bio-

synthesis of aflatoxin B1 in both A. parasiticus (Udwary

et al., 2002) and Aspergillus flavus (Keller & Hohn, 1997),

and in trichothecene biosynthesis in Fusarium sporotri-

chioides (Meek et al., 2003). As previously mentioned that

based on biochemical data, at least two cytochrome P450

monooxygenase enzymes may be involved in the

Fig. 5. (a) Alignment of clone P450-1 to cytochrome P450 monooxygenases from Coriolus versicolor, Gibberella fujikuroi and Penicillium paxilli .

Residues shaded in black are common in at least three of the four sequences. (b) alignment of clone P450-2 to cytochrome P450 monooxygenases from

Penicillium paxilli, Gibberella fujiuroi and Neurospora crassa. Residues shaded in black are common to at least three of the four sequences.


24 S.White et al.

biosynthesis of patulin; this indicates a potential role for

both P450-2 and P450-1 in patulin biosynthesis in P.

expansum.

Finally upstream from the idh gene in P. expansum we

cloned part of a putative ABC transporter gene peab1, which

at the nucleotide level showed a high level of identity with

the ABC transporter gene from P. patulum (Gaucher &

Fedechko, 2000). Transcription of this putative ABC trans-

porter gene is also up-regulated under patulin-permissive

conditions in P. expansum (Fig. 3), again indicating its

potential involvement in patulin biosynthesis. ABC trans-

porters are a large family of transmembrane proteins which

play a significant role in fungicide sensitivity and resistance

(Del Sorbo et al., 2000). For example the ABC transporter in

the fungal plant pathogen Magnaporthe grisea helps the

fungus defend itself against anti-microbial compounds

(Urban et al., 1999); while an ABC transporter in the

phytopathogen Leptosphaeria maculans protects the fungus

from the epipolythiodioxopiperazine secondary metabolite

gliotoxin (Gardiner et al., 2005). An ABC transporter gene

has previously also been identified in other Penicillium

species, namely the PMRI1gene in the phytopathogenic

fungus Penicillium digitatum which is involved in the efflux

of demethylation inhibitors out of the fungal cell (Nakaune

et al., 1998). As patulin has been shown to exhibit fungal

toxicity properties (Palmgren & Cielger, 1983), it seems

plausible that this ABC transporter may potentially be

involved in patulin efflux in P. expansum. ABC transporters

have previously been identified which are involved in the

transport of mycotoxins in producing fungi with TOXA in

Cochliobolus carbonum, encoding an efflux pump which

contributes to self-protection against HC-toxin and/or is

involved in HC-toxin secretion (Pitkin et al., 1996). Further

work will however be needed to establish whether peab1, is

involved in patulin biosynthesis in P. expansum.

Acknowledgements

This research was funded under the PRTLI programme for

Irish Third Level Institutions, administered by the Higher

Education Authority and by the Irish government under the

National Development Plan 2000–2006.

References

Barhoumi R & Burghardt RC (1996) Kinetic analysis of the

chronology of patulin- and gossypol-induced cytotoxicity in

vitro. Fund Appl Toxicol 30: 290–297.

Beck J, Ripka S, Siegner A, Schiltz E & Schweizer E (1990) The

multifunctional 6-methylsalicylic acid synthase gene of

Penicillium patulum. Its gene structure relative to that of other

polyketide synthases. Eur J Biochem 192: 487–498.

Bhatnagar D, Ehrlich KC & Cleveland TE (2003) Molecular

genetic analysis and regulation of aflatoxin biosynthesis. Appl

Microbiol Biotechnol 61: 83–93.

Casey GD & Dobson ADW (2004) Potential of using real-time-

PCR based detection of spoilage yeast in fruit juice – a

preliminary study. Int J Food Microbiol 91: 327–335.

Commission Regulation (EC) No 1425/2003 of 11 August 2003

amending Regulation (EC) No 466/2001 as regards patulin.

Official Journal of the European Union L 203/13.

Dombrink-Kurtzman MA & Blackburn JA (2005) Evaluation of

several culture media for production of patulin by Penicillium

species. Int J Food Microbiol 98: 241–2483.

Frisvad JC & Samson RA (2004) Polyphasic taxonomy of

Penicillium subspecies Penicillium. A guide to identification of

food and air-borne terverticillate Penicillia and their

mycotoxins. Stud Mycol (Utrecht) 49: 1–173.

Fujii I, Ono Y, Tada H, Gomi K, Ebizuka Y & Sankawa U (1996)

Cloning of the polyketide synthase gene atX from Aspergillus

terreus and its identification as the 6-methylsalicylic acid

synthase gene by heterologous expression. Mol Gen Genet 253:

1–10.

Gardiner DM, Jarvis RS & Howlett BJ (2005) The ABC

transporter gene in the sirodesmin biosynthetic gene cluster of

Leptosphaeria maculans is not essential for sirodesmin

production but facilitates self-protection. Fung Genet Biol 42:

257–263.

Gaucher GM & Fedechko RW (2000). Isolation and

characterization of the isoepoxydon dehydrogenase gene in

Penicillium urticae. Direct submission to NCBI.

Jones T, Federspiel NA, Chibana H, et al. (2004) The diploid

genome sequence of Candida albicans. Proc Natl Acad Sci USA

101: 7329–7334.

Keller NP & Hohn TM (1997) Metabolic pathway gene clusters in

filamentous fungi. Fung Genet Biol 21: 17–29.

Latimer FW, Chain P, Hauser L, et al. (2004) Complete genome

sequence of the metabolically versatile photosynthetic

bacterium Rhodopseudomonas palustris. Nat Biotechnol 22:

55–61.

Liu B-H & Chu FS (1998) Regulation of aflR and its product,

AflR, associated with aflatoxin biosynthesis. Appl Environ

Microbiol 64: 3718–3723.

Meek IB, Peplow AW, Ake Jr C, Phillips TD & Beremand MN

(2003) Tri1 encodes the cytochrome P450 monooxygenase for

C-8 hydroxylation during trichothecene biosynthesis in

Fusarium sporotrichioides and resides upstream of another new

Tri gene. Appl Environ Microbiol 69: 1607–1613.

Moake MM, Padilla-Zakour OI & Worobo RW (2005)

Comprehensive review of patulin control methods in foods.

Com Rev Food Sci Food Safety 4: 8–22.

Murphy G & Lynen F (1975) Patulin biosynthesis: the

metabolism of m-hydroxybenzyl alcohol and m-

hydroxybenzaldehyde by particulate preparations from

Penicillium patulum. Eur J Biochem 58: 467–75.

Nakaune R, Adachi K, Nawata O, Tomiyama M, Akutsu K & Hibi

T (1998) A novel ATP-binding transporter involved in



multidrug resistance in the phytopathogenic fungus

Penicillium digitatum. Appl Environ Microbiol 64: 3983–3988.

O’Callaghan J, Caddick MX & Dobson ADW (2003) A polyketide

synthase gene required for ochratoxin biosynthesis in

Aspergillus ochraceus. Microbiology 148: 3485–3481.

Palmgren MS & Cielger A (1983) Toxicity and carcinogenicity of

fungal lactones: patulin and penicillic acid. Plant and Fungal

Toxins, Handbook of Natural Toxins, Vol. 1. (Keeler RF & Tu AT,

eds), Marcel Dekker Inc, New York.

Pitkin JW, Panaccione DG & Walton JD (1996) A putative cyclic

peptide efflux pump encoded by the TOXA gene of the plant-

pathogenic fungus Cochliobolus carbonum. Microbiology 142:

1557–1565.

Riley RT & Showker JL (1991) The mechanism of patulin’s

cytotoxicity and its antioxidant activity of indole tetramic

acids. Toxicol Appl Pharmacol 109: 108–126.

Scott A & Beadling L (1974) Biosynthesis of patulin.

Dehydrogenase and dioxygenase enzymes of Penicillium

patulum. Bioorg Chem 3: 281–301.

Soden DM & Dobson ADW (2001) Differential regulation of

laccase gene expression in Pleurotus sajor-caju. Microbiology

147: 1755–1763.

Soden DM & Dobson ADW (2003) The use of amplified flanking

region-PCR in the isolation of laccase promoter sequences

from the edible fungus Pleurotus sajor-caju. J Appl Microbiol

95: 553–562.

Del Sorbo G, Schoonbeek H-J & De Waard MA (2000) Fungal

transporters involved in efflux of natural compounds and

fungicides. Fung Genet Biol 30: 1–15.

Udwary DW, Casillas LK & Townsend CA (2002) Synthesis of 11-

hydroxyl O-methylsterigmatocystin and the role of a

cytochrome P-450 in the final step of aflatoxin biosynthesis.

J Am Chem Soc 124: 5294–5303.

Urban M, Bhargava T & Harmer JE (1999) An ATP-driven efflux

pump is a novel pathogenicity factor in rice blast disease.

EMBO J 18: 512–521.

Watanabe M & Shimizu H (2005) Detection of patulin in apple

juices marketed in the Tohoku district, Japan. J Food Prot 68:

610–612.

White S (2005) Physiology and genetics of patulin biosynthesis in

Penicillium expansum. PhD thesis, National University of

Ireland, Cork, Ireland.

U.S. Food and Drug Administration (USFDA) (2004)

Compliance policy guide. Compliance policy guidance

for FDA staff. Sec. 510.150. Apple juice, apple juice

concentrates, and apple juice products- adulteration with

patulin. http://www.fda.gov/ora/compliance ref/cpg/cpgfod/

cpg510-150.htm


26 S.White et al.

Cloning and molecular characterization of Penicillium expansum genes upregulated under conditions...

Documents

Transcript of Cloning and molecular characterization of Penicillium expansum genes upregulated under conditions...