Cell Reproduction Chromosomes Mitosis Meiosis Chromosomes Mitosis Meiosis.
Chromosomes - Biology Building...
Transcript of Chromosomes - Biology Building...
The E. Coli genome includes approximately 4,000 genes
• Chromosomes Strands of DNA that contain all of
the genes an organism needs to survive and reproduce
Chromosomes
• Genes Segments of DNA that specify
how to build a protein • genes may specify more
than one protein in eukaryotes
Chromosome maps are used to show the locus (location) of genes on a chromosome
• Genetic Variation Phenotypic variation among organisms is due to genotypic variation
(differences in the sequence of their DNA bases)
Differences exist between species and within a species
• Different genes (genomes) different proteins (proteomes)
• Different versions of the same gene (alleles)
• Differences in gene expression (epigenetics)
Chromosomes
• Cell Division (mitosis) Cells must copy their chromosomes
(DNA synthesis) before they divide so that each daughter cell will have a copy
A region of the chromosome remains uncopied (centromere) in order to hold the sister chromatids together – Keeps chromatids organized to help
make sure each daughter cell gets exactly one copy
– Nondisjunction is when sister chromatids do not assort correctly and one cell ends up with both copies while the other cell ends up with none
DNA Replication
• DNA Synthesis The DNA bases on each
strand act as a template to synthesize a complementary strand • Recall that Adenine (A)
pairs with thymine (T) and guanine (G) pairs with cytosine (C)
The process is semiconservative because each new double-stranded DNA contains one old strand (template) and one newly-synthesized complementary strand
DNA Replication
A G C T G
T C G A C
A G C T G
T C G A C
A G C T G
T C G A C
A G C T G
T C G A C
T C G A C
A G C T G
DNA Replication • DNA Polymerase Enzyme that catalyzes the covalent bond between the phosphate of one
nucleotide and the deoxyribose (sugar) of the next nucleotide
DNA Polymerization
3’ end has a free deoxyribose
5’ end has a free phosphate DNA polymerase:
can only build the new strand in the 5’ to 3’ direction
Thus scans the template strand in 3’ to 5’ direction
DNA Replication
Initiation • Primase (a type of RNA polymerase) builds an RNA primer
(5-10 ribonucleotides long)
• DNA polymerase attaches onto the 3’ end of the RNA primer
DNA Replication
DNA polymerase
Elongation • DNA polymerase uses each strand as a template in the 3’ to 5’ direction
to build a complementary strand in the 5’ to 3’ direction
DNA Replication
DNA polymerase
Elongation • DNA polymerase uses each strand as a template in the 3’ to 5’ direction
to build a complementary strand in the 5’ to 3’ direction results in a leading strand and a lagging strand
DNA Replication
Leading Strand 1. Topisomerase unwinds DNA and then Helicase breaks H-bonds 2. DNA primase creates a single RNA primer to start the replication 3. DNA polymerase slides along the leading strand in the 3’ to 5’ direction
synthesizing the matching strand in the 5’ to 3’ direction 4. The RNA primer is degraded by RNase H and replaced with DNA nucleotides by
DNA polymerase, and then DNA ligase connects the fragment at the start of the new strand to the end of the new strand (in circular chromosomes)
DNA Replication
Lagging Strand 1. Topisomerase unwinds DNA and then Helicase breaks H-bonds 2. DNA primase creates RNA primers in spaced intervals 3. DNA polymerase slides along the leading strand in the 3’ to 5’ direction
synthesizing the matching Okazaki fragments in the 5’ to 3’ direction 4. The RNA primers are degraded by RNase H and replaced with DNA nucleotides
by DNA polymerase 5. DNA ligase connects the Okazaki fragments to one another (covalently bonds the
phosphate in one nucleotide to the deoxyribose of the adjacent nucleotide)
DNA Replication
Topoisomerase - unwinds DNA Helicase – enzyme that breaks H-bonds DNA Polymerase – enzyme that catalyzes connection of nucleotides to form complementary DNA strand in 5’ to 3’ direction (reads template in 3’ to 5’ direction) Leading Strand – transcribed continuously in 5’ to 3’ direction Lagging Strand – transcribed in segments in 5’ to 3’ direction (Okazaki fragments) DNA Primase – enzyme that catalyzes formation of RNA starting segment (RNA primer) DNA Ligase – enzyme that catalyzes connection of two Okazaki fragments
DNA Replication
Web Resources
DNA Replication (synthesis) • http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter11/animation_quiz_2.html
• http://www.wiley.com/college/pratt/0471393878/student/animations/dna_replication/index.html
• http://www.biostudio.com/d_%20DNA%20Replication%20Coordination%20Leading%20Lagging%20Strand%20Synthesis.htm
• http://www.biostudio.com/d_%20DNA%20Replication%20Nucleotide%20Polymerization.htm
• http://www.dnalc.org/resources/3d/DNAReplicationBasic_w_FX.html (download this video file from the website to view it without interruptions)
• http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/dna-rna2.swf
• http://www.bioteach.ubc.ca/TeachingResources/MolecularBiology/DNAReplication.swf
• • Each gene dictates how to build a single protein in prokaryotes
• The sequence of nucleotides (AGCT) in DNA dictate the order of amino acids that make up a protein
Protein Synthesis
Nucleotide sequence of His gene
Protein Synthesis
Nucleotide sequence of His gene Amino acid sequence of His protein
• DNA provides the instructions for how to build proteins • Each gene dictates how to build a single protein in prokaryotes
• The sequence of nucleotides (AGCT) in DNA dictate the order of amino acids that make up a protein
• Protein synthesis occurs in two primary steps
Protein Synthesis
mRNA is used by ribosome to build protein
(Ribosomes attach to the mRNA and use its sequence of nucleotides to determine the order of amino acids in the protein)
Cytoplasm of prokaryotes and eukaryotes
Some proteins feed directly into rough ER in eukaryotes
2
(eukaryotes)
Protein Synthesis 1) INITIATION
•
RNA polymerase binds to a
region on DNA known as the promoter, which signals the start of a gene
Promoters are specific to genes RNA polymerase does not need
a primer Transcription factors assemble
at the promoter forming a transcription initiation complex – activator proteins help stabilize the complex
Gene expression can be regulated (turned on/off or up/down) by controlling the amount of each transcription factor
Protein Synthesis 1) INITIATION
• Transcription Elongation RNA polymerase unwinds
the DNA and breaks the H-bonds between the bases of the two strands, separating them from one another
Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template) • recall RNA uses uracil
instead of thymine
AGTCAT
UCA GUA
Protein Synthesis • Transcription
Elongation RNA polymerase unwinds
the DNA and breaks the H-bonds between the bases of the two strands, separating them from one another.
Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template) • recall RNA uses uracil
instead of thymine
RNA polymerase catalyzes bond to form between ribose of 3’ nucleotide of mRNA and phosphate of incoming RNA nucleotide
3’
5’
3’
5’
+ ATP
+ ADP
Protein Synthesis • Transcription
Elongation The gene occurs on only one of the DNA strands; each strand possesses a separate set of genes
Protein Synthesis 1) INITIATION
• Transcription Termination A region on DNA known as
the terminator signals the stop of a gene
RNA polymerase disengages the mRNA and the DNA
Exons are
“coding” regions
Introns are removed
different combinations of exons form different mRNA resulting in multiple proteins from the same gene
Humans have 30,000 genes but are capable of producing 100,000 proteins
Protein Synthesis • Alternative Splicing (eukaryotes only)
mRNA copy of a gene is synthesized
Cytoplasm of prokaryotes Nucleus of eukaryotes
1
Protein Synthesis
mRNA is used by ribosome to build protein
(Ribosomes attach to the mRNA and use its sequence of nucleotides to determine the order of amino acids in the protein)
Cytoplasm of prokaryotes and eukaryotes
Some proteins feed directly into rough ER in eukaryotes
mRNA
Transcription
Translation
mRNA
tRNA synthesis
Transcription
Translation
mRNA
tRNA synthesis
Protein Synthesis • Translation Every three mRNA nucleotides (codon) specify an amino acid
Protein Synthesis • Translation tRNA have an anticodon region that specifically binds to its codon
Transcription
Translation
mRNA
tRNA synthesis
Protein Synthesis • Translation Each tRNA carries a
specific amino acid
Transcription
Translation
mRNA
tRNA synthesis
Protein Synthesis
Aminoacyl tRNA synthetases attach amino acids to their specific tRNA
Protein Synthesis • Translation
Initiation Start codon signals where the gene
begins (at 5’ end of mRNA)
AUGGACAUUGAACCG… 5’ 3’
start codon
Translation
mRNA
Protein Synthesis • Translation
Initiation Start codon signals where the gene
begins (at 5’ end of mRNA) Ribosome binding site (Shine
Dalgarno sequence) upstream from the start codon binds to small ribosomal subunit – then this complex recruits the
large ribosomal subunit
Small ribosomal subunit
Small ribosomal subunit
Ribosome
Large ribosomal subunit
Protein Synthesis • Translation
Scanning The ribosome moves in 5’ to 3’ direction “reading” the mRNA and
assembling amino acids into the correct protein
large ribosome subunit
small ribosome subunit
Protein Synthesis • Translation
Scanning The ribosome moves in 5’ to 3’ direction “reading” the mRNA and
assembling amino acids into the correct protein
Protein Synthesis • Translation
Termination Ribosome disengages from the mRNA
when it encounters a stop codon
Practice Question Translate the following mRNA sequence
AGCUACCAUACGCACCCGAGUUCUUCAAGC
Protein Synthesis • Multiple RNA polymerases can
engage a gene at one time
• Multiple ribosomes can engage a single mRNA at one time
DNA mRNAs Transcription
Translation
Protein Synthesis • Eukaryotes:
transcription occurs in the nucleus and translation occurs in the cytoplasm
• Prokaryotes: Transcription and translation occur simultaneously in the cytoplasm
• There are four main types of RNA: 1. mRNA
- RNA copy of a gene used as a template for protein synthesis
2. rRNA - part of structure of ribosomes
3. tRNA - amino acid carrier that matches to mRNA codon
4. snRNA - found in nucleus where they have several important jobs
RNA
1. Why is DNA synthesis said to be “semiconservative”? 2. What role do DNA polymerase, DNA primase (a type of RNA polymerase),
helicase, topoisomerase, RNase H, and ligase play in DNA replication? 3. What is the difference between how the leading strand and lagging strand are
copied during DNA replication? Why do they have to be synthesized differently in this fashion?
4. What would happen if insufficient RNase H were produced by a cell? What if insufficient ligase were produced by a cell?
5. What are four key differences between DNA polymerase and RNA polymerase? (“they are difference molecules” doesn’t count as one!)
6. Compare and contrast codons and anticodons? 7. What is alternative splicing? Why is it necessary in eukaryotes? 8. During translation, what amino acid sequence would the following mRNA
segment be converted into: AUGGACAUUGAACCG? 9. How come there are only 20 amino acids when there are 64 different codons? 10. How come prokaryotes can both transcribe and translate a gene at the same
time, but eukaryotes cannot?
Practice Questions
Web Resources
Translation • Eukaryotic: http://www.youtube.com/watch?v=5bLEDd-PSTQ&feature=related • Prokaryotic: http://www.biostudio.com/d_%20Protein%20Synthesis%20Prokaryotic.htm • http://www.biostudio.com/d_%20Peptide%20Bond%20Formation.htm • http://www.johnkyrk.com/DNAtranslation.html • http://www.dnalc.org/resources/3d/TranslationBasic_withFX0.html • http://www.dnalc.org/resources/3d/TranslationAdvanced.html
Web Resources
Transcription • http://www.biostudio.com/d_%20Transcription.htm • http://www.youtube.com/watch?v=WsofH466lqk • http://www.dnalc.org/resources/3d/TranscriptionBasic_withFX.html
Translation • Eukaryotic: http://www.youtube.com/watch?v=5bLEDd-PSTQ&feature=related • Prokaryotic: http://www.biostudio.com/d_%20Protein%20Synthesis%20Prokaryotic.htm • http://www.biostudio.com/d_%20Peptide%20Bond%20Formation.htm • http://www.johnkyrk.com/DNAtranslation.html • http://www.dnalc.org/resources/3d/TranslationBasic_withFX0.html • http://www.dnalc.org/resources/3d/TranslationAdvanced.html
Alternative Splicing • http://www.youtube.com/watch?v=FVuAwBGw_pQ&feature=related
Insulin Example of Protein Synthesis http://www.biotopics.co.uk/as/insulinproteinstructure.html
Hemoglobin Example of Protein Synthesis http://www.biotopics.co.uk/as/insulinproteinstructure.html
Collagen Example of Protein Synthesis http://www.biotopics.co.uk/JmolApplet/collagen.html
Web Resources
Images • http://www.kscience.co.uk/as/module1/pictures/bacteria.jpg • http://www.biologie.uni-hamburg.de/b-online/library/onlinebio/14_1.jpg • http://pharmamotion.com.ar/wp-content/uploads/2009/12/nrti_mechanism_action_antiretrovirals.jpg • http://biology200.gsu.edu/houghton/4564%20%2704/figures/lecture%204/AAAreverse.jpg • http://www.ebi.ac.uk/thornton-srv/databases/pdbsum/2d8x/traces.jpg • http://www.ncbi.nlm.nih.gov • http://xarquon.jcu.cz/edu/uvod/09nucleus/092function/images/activation3.jpg • http://www.ncbi.nlm.nih.gov • http://bass.bio.uci.edu/~hudel/bs99a/lecture23/lecture4_4.html • http://selfhpvdna.diagcorlab.com/images/images/CervicalCancer.jpg