Cholesterol and Cholate Components of an Atherogenic Diet InduceDistinct Stages of Hepatic Inflammatory Gene Expression*□S

Received for publication, June 9, 2003, and in revised form, August 14, 2003Published, JBC Papers in Press, August 15, 2003, DOI 10.1074/jbc.M306022200

Laurent Vergnes‡§, Jack Phan‡§, Merav Strauss, Sherrie Tafuri¶, and Karen Reue‡§�

From the ‡Departments of Medicine and Human Genetics, UCLA, Los Angeles, California 90095, §Veterans AffairsGreater Los Angeles Healthcare System, Los Angeles, California 90073, and ¶Pfizer Global Research and Development,Ann Arbor Laboratories, Ann Arbor, Michigan 48105

Atherosclerosis in inbred mouse strains has beenwidely studied by using an atherogenic (Ath) diet con-taining cholesterol, cholic acid, and fat, but the effect ofthese components on gene expression has not been sys-tematically examined. We employed DNA microarrays tointerrogate gene expression levels in liver of C57BL/6Jmice fed the following five diets: mouse chow, the Athdiet, or modified versions of the Ath diet in which eithercholesterol, cholate, or fat were omitted. Dietary choles-terol and cholate produced discrete gene expressionpatterns. Cholesterol was required for induction ofgenes involved in acute inflammation, including threegenes of the serum amyloid A family, three major histo-compatibility class II antigen genes, and various cyto-kine-related genes. In contrast, cholate induced expres-sion of genes involved in extracellular matrix depositionin hepatic fibrosis, including five collagen family mem-bers, collagen-interacting proteins, and connective tis-sue growth factor. The gene expression findings wereconfirmed by biochemical measurements showing thatcholesterol was required for elevation of circulating se-rum amyloid A, and cholate was required for accumula-tion of collagen in the liver. The possibility that thesegene expression changes are relevant to atherogenesisin C57BL/6J mice was supported by the observation thatthe closely related, yet atherosclerosis-resistant, C57BL/6ByJ strain was largely resistant to dietary induction ofthe inflammatory and fibrotic response genes. Theseresults establish that cholesterol and cholate compo-nents of the Ath diet have distinct proatherogeniceffects on gene expression and suggest a strategy tostudy the contribution of acute inflammatory responseand fibrogenesis independently through dietarymanipulation.

The mouse has become established as a key animal model forstudies of lipid metabolism and atherosclerosis, due to thedevelopment of techniques for genetic manipulation and toolsfor gene discovery in this species (reviewed in Refs. 1–4). Thefirst studies to demonstrate that the mouse might provide auseful model for characterization of genetic factors affecting

atherosclerosis susceptibility appeared more than 30 years ago.These studies surveyed several inbred laboratory mousestrains and demonstrated that some strains develop early ath-eromatous lesions when fed experimental diets. These dietscontained high concentrations of cholesterol (5%) and fat (30%)supplemented either with cholic acid (2%) (5) or fed in combi-nation with irradiation treatments (6). These early diets pro-duced high mortality and were subsequently modified to reducethe concentrations of cholesterol (1.25%), fat (15%), and cholate(0.5%). By using this modified atherogenic (Ath)1 diet, Paigenet al. (7, 8) demonstrated that fatty streak lesion formation isreproducible within a strain, and that strains differ in theirsusceptibility. The C57BL/6J strain was among the most sus-ceptible and has been extensively used as a model for diet-induced atherosclerosis.

Although the Ath diet has been widely used to study athero-genesis in C57BL/6J and other mouse strains, the effects of theindividual dietary components have not been well character-ized. In susceptible mouse strains, the Ath diet produces anatherogenic lipoprotein profile and induces inflammatory geneexpression in the liver. For example, C57BL/6J mice fed theAth diet exhibit dramatically elevated low density/very lowdensity lipoprotein (LDL/VLDL) and reduced high density li-poprotein (HDL) cholesterol levels (8, 9). In this strain, the Athdiet also induces inflammatory and oxidative stress genes suchas serum amyloid A, monocyte chemotactic protein-1, colony-stimulating factors, and heme oxygenase (10). It is unclear atpresent which component(s) of the atherogenic diet produce theobserved effects on lipoproteins and inflammation. Further-more, previous work (11, 12) indicates that reduction in theconcentration of either cholesterol or cholate in the Ath dietdecreases the rate of aortic lesion formation and that the twocomponents differentially affect gallstone formation and lipidaccumulation in liver. This suggests that cholesterol andcholate may have independent pro-atherogenic effects.

To test this hypothesis, we undertook a systematic analysisof plasma lipid and gene expression changes that occur inresponse to the cholesterol, cholate, and fat components of theAth diet. C57BL/6J mice were fed one of five diets: mouse chow,the Ath diet, or modified versions of the Ath diet in whicheither cholesterol, cholate, or fat were omitted. We examinedplasma lipid profiles and used DNA microarrays to screen theresponse of more than 11,000 mouse genes and expressed se-quence tags (ESTs). A comparison of gene expression levelsacross all five diets allowed the identification of genes thatwere activated or repressed specifically by dietary cholesterol,

* This work was supported by National Institutes of Health GrantsHL58627 and HL28481 (to K. R.) and the Philippe Foundation, Inc. (toL. V.). The costs of publication of this article were defrayed in part bythe payment of page charges. This article must therefore be herebymarked “advertisement” in accordance with 18 U.S.C. Section 1734solely to indicate this fact.

□S The on-line version of this article (available at http://www.jbc.org)contains supplemental Table I.

� To whom correspondence should be addressed: 11301 WilshireBlvd., Bldg. 113, Rm. 312, Los Angeles, CA 90073. Tel.: 310-478-3711(ext. 42171); Fax: 310-268-4981; E-mail: Reuek@ucla.edu.

1 The abbreviations used are: Ath, atherogenic diet; LDL/VLDL, lowdensity/very low density lipoprotein; HDL, high density lipoprotein;EST, expressed sequence tag; SAA, serum amyloid A; RT, reversetranscriptase.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 44, Issue of October 31, pp. 42774–42784, 2003Printed in U.S.A.

This paper is available on line at http://www.jbc.org42774

by guest on July 11, 2020http://w

ww

.jbc.org/D

ownloaded from

cholate, or fat. We identified more than 300 genes that wereactivated or repressed by one of the three diet components,with more than a quarter of those (89:316) exhibiting at least a10-fold response to either cholesterol, cholate, or fat. Choles-terol and cholate were found to induce expression of genesinvolved in different aspects of the inflammatory response,with cholesterol being required for the acute inflammatoryresponse, whereas cholate was responsible for activating genesassociated with hepatic fibrosis. Biochemical measurements ofrepresentative proteins from the acute inflammatory and fi-brotic responses confirmed the gene expression data. We fur-ther investigated the potential role of these gene expressionchanges in atherogenesis by examining their expression in anatherosclerosis-resistant substrain of C57BL/6 mice. The acti-vation of both the inflammatory and fibrotic genes was dramat-ically attenuated in the resistant mice, suggesting that theirresponse to the Ath diet at the level of gene transcription maybe one mechanism contributing to their resistance to diet-induced atherosclerosis. Overall, our results establish that cho-lesterol and cholate components of the Ath diet have distinctproatherogenic effects on gene expression, which correlate withgenetic differences in atherosclerosis susceptibility in twoclosely related C57BL/6 mouse strains.

EXPERIMENTAL PROCEDURES

Mice and Diets—Male C57BL/6J and C57BL/6ByJ mice were ob-tained from The Jackson Laboratory (Bar Harbor, ME). Mice were fedad libitum Purina Mouse Chow 5001, or one of four experimental diets(Teklad Research Diets, Madison, WI) containing various combinationsof cholesterol, sodium cholate, and fat (in the form of cocoa butter). TheAth diet (Teklad TD90221) contained (by weight) 75% Purina MouseChow, 7.5% cocoa butter, 1.25% cholesterol, and 0.5% sodium cholate.The other three diets were equivalent to the Ath diet, with the omissionof cholesterol (TD98232), cholate (TD94059), or fat (TD98233). At 3months of age, mice were housed individually and fed the specified dietfor 3 weeks before harvesting tissue and blood. The care of the mice andall procedures used in this study were conducted in accordance with theNational Institutes of Health animal care guidelines.

Lipid Determinations—Blood was obtained after a 16-h fast. Enzy-matic assays for total cholesterol, HDL cholesterol, unesterified choles-terol, triglyceride, and free fatty acids were performed using enzymaticassays (13). LDL/VLDL cholesterol levels were determined as the dif-ference between total and HDL cholesterol levels. For hepatic choles-terol and triglyceride determinations, lipids were extracted from 100mg of tissue as described (14).

Oligonucleotide Microarray Hybridization—Liver samples compris-ing the identical lobe were harvested from each mouse and flash-frozenin liquid nitrogen. Total RNA was prepared from mouse liver usingTrizol reagent (Invitrogen). Each microarray hybridization was per-formed using 10 �g of total liver RNA pooled from four mice. Oligonu-cleotide microarrays (MU11K) were from Affymetix (Santa Clara, CA)and contained representations of more than 11,000 full-length mousegenes and EST clusters. cRNA synthesis, hybridization, washing, andscanning were performed according to standard Affymetrix protocols.Fluorometric data were generated by Affymetrix software, and the genechips were globally scaled to all the probe sets with an identical targetintensity value. Transformation of the fluorescent signals into numer-ical values and filtering of the data were accomplished as described (15).Only genes with an absolute expression level (expressed as averagedifference, or Avg Diff, value from Affymetrix software output) above athreshold of 30 were analyzed. Identification of genes that are activatedor repressed by specific diet components was accomplished using Mi-crosoft EXCEL. The full set of microarray data for strains C57BL/6Jand C57BL/6ByJ is available in supplemental data online.

mRNA Quantitation—Confirmation of mRNA expression differencesobserved on microarrays was performed by Northern blot and RT-PCR.Total liver RNA was isolated using the Trizol reagent (Invitrogen).Poly(A)� RNA was prepared from total RNA using the Poly(A)TractmRNA isolation system (Promega, Madison, WI) and 2 �g loaded perlane for Northern analysis. Hybridizations were performed as described(16) with cDNA probes generated by RT-PCR. RT-PCR was performedusing 2 �g of total liver RNA (cDNA Cycle Kit, Invitrogen). Primersequences for examples shown in Fig. 2 were as follows: Saa3-f, agaga-catgtggcgagcctac, and Saa3-r, cagcacattgggatgtttagg; W34845-f, gccag-

gccttcacctttcag, and W34845-r, acagttcagtcacccttacaag; Col3a1-f, cccat-gactgtcccacgtaag, and Col3a1-r, cagggccaatgtccacaccaa; Mup1-f,ggcatactattatcctggcctc, and Mup1-r, gatggtggagtcctggtgaga; Igfbp-f,ttctcatctctctcgtacatg, and Igfbp-r, acgcagctttccacgttcag; and Gck-f, gtg-gccacaatgatctcctgc, and Gck-r, tcggcgacagagggtcgaaggc.

Expression levels for activated hepatic stellate cell transcripts wereexamined by RT-PCR using previously published primer sets for plate-let-derived growth factor receptor �, transforming growth factor �1,collagen 1�1, tissue inhibitor of metalloproteinases-1, �-smooth muscleactin (17), and TATA box-binding protein (18). Total RNA was treatedwith DNase (Ambion, Austin, TX) to remove contaminating genomicDNA, and cDNA was prepared from 2 �g of total liver RNA. 5% of theresulting cDNA sample was amplified for 32 cycles using a Touchdownprotocol with a beginning annealing temperature of 63 °C and a finalannealing temperature of 53 °C (18). PCR products were analyzed byelectrophoresis in agarose, and quantitation of digital images was per-formed using 1D Image Analysis software (Eastman Kodak Co.).

Serum Amyloid A and Collagen Quantitation—Serum amyloid Alevels in mouse plasma were determined by enzyme-linked immunosor-bent assay (BioSource International, Camarillo, CA). Collagen concen-tration in liver was determined using the Sircol collagen assay (Accu-rate Chemicals, Westbury, NY). Briefly, 50 mg of liver washomogenized, and total acid pepsin-soluble collagens were extractedovernight using 5 mg/ml pepsin in 500 �l of 0.5 M acetic acid. One ml ofSircol dye reagent was added to 100 �l of each sample, in duplicate, andincubated at 25 °C for 30 min. After centrifugation, the pellet wassuspended in 1 ml of alkali reagent, and absorbance was read at 540nm.

RESULTS

Effects of Ath Diet Components on Circulating Lipid Lev-els—To investigate the effect of specific components of the Athdiet on circulating lipid levels, C57BL/6J mice were fed a chowdiet, the Ath diet, or one of three modified Ath diets in whicheither cholesterol, cholate, or fat was omitted (Table I). Com-pared with chow, the Ath diet produced more than a 2-foldincrease in plasma cholesterol levels, due to an increase of morethan 100 mg/dl in LDL/VLDL cholesterol (Fig. 1), as observedpreviously (9). In contrast to previous reports, HDL cholesterollevels were not significantly reduced on the Ath diet. This maybe a result of using male, as opposed to female mice, and/or theshorter (3 week) duration of the diet compared with someprevious studies. The amount of unesterified cholesterol morethan doubled on the Ath diet, whereas triglyceride levels werereduced �50%, and free fatty acid levels were unchanged.

The diets lacking cholesterol, cholate, and fat componentseach produced distinct plasma lipid profiles (see Fig. 1). Theomission of fat from the Ath diet did not alter plasma choles-terol, triglyceride, or fatty acid levels compared with the com-plete Ath diet, indicating that the fat added to this diet haslittle effect on the circulating lipid levels. In contrast, omissionof cholesterol prevented any significant increase in total cho-lesterol or unesterified cholesterol above the levels on a chowdiet. The cholate-free diet produced elevated cholesterol levelsthat were intermediate between values on the chow and Athdiets and were significantly higher than the chow values. Al-though total cholesterol levels were not statistically differentbetween Ath and no cholate diets, the distribution of choles-terol among LDL/VLDL and HDL fractions was dramaticallyaffected by dietary cholate. LDL/VLDL cholesterol increased10-fold on the Ath diet but only 2-fold on the cholate-free diet,whereas HDL cholesterol was at it highest on the cholate-freediet. The omission of cholesterol from the Ath diet also blunted

TABLE IComposition of the five diets

Chow Ath No cholate No cholesterol No fat

Cholate � � � � �Cholesterol � � � � �Fat � � � � �

Cholesterol and Cholate Induce Inflammatory Gene Expression 42775

by guest on July 11, 2020http://w

ww

.jbc.org/D

ownloaded from

the increase in LDL/VLDL cholesterol levels seen with thecomplete diet, indicating that cholesterol and cholate act syn-ergistically to elicit the large increase in LDL/VLDL cholesterolthat occurs on the Ath diet. A similar diet effect was observedwith hepatic cholesterol levels. Thus, although hepatic choles-terol levels increased 6-fold on the Ath diet, this required theinclusion of both cholesterol and cholate.

Triglyceride levels were suppressed about 2-fold on the Athdiet (Fig. 1). Omission of either cholate or cholesterol from theAth diet produced a significant elevation in triglyceride levelsabove those seen on either chow or Ath diets, suggesting thatthe two components act together to effect the reduced triglyc-eride levels observed with the Ath diet. Hepatic triglyceridelevels were also repressed on the Ath diet, but omission ofcholate prevented this repression. Free fatty acid levels werenot significantly affected by the Ath diet components. Thus,cholesterol and cholate components appear to have both inde-pendent effects and synergistic effects on plasma and hepaticlipid levels.

Cholesterol and Cholate Induce Distinct Sets of Inflamma-tory Genes—To investigate gene expression changes underlyingthe diet-induced alterations in lipid levels, we performed mi-croarray hybridization studies. Liver RNA from mice fed eachof the five diets was hybridized to Affymetrix MU11K oligonu-cleotide microarrays to assess the relative expression levels ofthousands of mouse genes and ESTs. Data were filtered toexclude signals below a defined threshold of absolute expres-sion level and to ensure specificity of hybridization for perfectmatch versus mismatch oligonucleotides (see “ExperimentalProcedures”) (15). By using these criteria, 7200 of the 13,104DNA elements on the array were scored as present in at leastone diet sample. Comparison of gene expression profiles for thetwo most extreme diets, chow and Ath, revealed that the com-

bination of cholesterol, cholate, and fat produces widespreadchanges in hepatic gene expression levels. 839 genes wereactivated, and 454 genes were repressed by at least 3-fold onthe Ath diet compared with basal levels on the chow diet.

A systematic comparison of expression levels among all fivediets allowed the identification of genes that are regulated byspecific dietary components. Approximately 1.4% of genes rep-resented on the array exhibited altered expression specificallyin response to cholesterol, cholate, or fat. By comparing theexpression levels of genes across all five diets, we defined sixgene expression patterns with respect to regulation by specificdiet components: cholesterol-activated, cholesterol-repressed,cholate-activated, cholate-repressed, fat-activated, and fat-re-pressed. For example, “cholesterol-activated genes” were thosehaving at least 2-fold higher levels on all three diets containingcholesterol (Ath, No Cholate, and No Fat diets) than on the twodiets lacking cholesterol (Chow and No Cholesterol diets). Rep-resentative expression profiles for each of the six groups areshown in Fig. 2. A full list of genes activated or repressed bycholesterol, cholate, or fat is given in Table II, and a summaryof each group is given below.

Cholesterol-regulated Genes—Expression of 38 of the genesassayed was altered by the presence of dietary cholesterol,including 25 genes that were activated and 13 repressed bycholesterol (Table II). The magnitude of activation by choles-terol was striking, with 30% of the cholesterol-activated genesshowing more than 10-fold induction in response to cholesterol.An example of a cholesterol-activated gene, serum amyloid A3(Saa3), showed equivalent high levels of expression on thecomplete Ath diet and the No Fat diet, and lowest levels on theNo Cholesterol diet (Fig. 2a). The nearly identical expressionlevels on the Ath and No Fat diets indicate that fat had littleeffect on expression of this group of genes and also illustrate

FIG. 1. C57BL/6J mouse plasma and hepatic lipid levels on 5 diets. Plasma and hepatic lipid determinations were performed after 3 weeksfeeding on each of five diets: Chow, Ath, No Cholate, No Cholesterol, and No Fat. Plasma lipid values are given as mg/dl and hepatic lipid valuesas �g/mg tissue. Values represent the average of 5 mice (plasma lipids) or 4 mice (hepatic lipids) on each diet. Error bars indicate S.D. Significantlydifferent from Chow value: *, p � 0.05; **, p � 0.01. Significantly different from Ath value: �, p � 0.05; ��, p � 0.01.

Cholesterol and Cholate Induce Inflammatory Gene Expression42776

by guest on July 11, 2020http://w

ww

.jbc.org/D

ownloaded from

FIG. 2. Expression levels of genes activated or repressed by dietary cholesterol, cholate, or fat. Expression levels are taken frommicroarrays probed with RNA samples pooled from five C57BL/6J mice on each diet. Genes were classified based on activation or repression of atleast 2-fold by cholesterol, cholate, or fat across all five diets. The list of genes in each panel is given under the corresponding heading in Table II.Representative Northern blots are shown below each graph, with liver samples from two mice on each diet analyzed for the gene indicated.Fat-activated genes were expressed at a lower magnitude, so RT-PCR was used instead of Northern blot to confirm expression levels. a, genesactivated by cholesterol component of the diet; b, genes repressed by cholesterol; c, genes activated by cholate; d, genes repressed by cholate; e,genes activated by fat; and f, genes repressed by fat. Saa3, serum amyloid A3; W34845, mouse EST; Col3a1, procollagen, type III, �1; Mup1, majorurinary protein 1; Gck, glucokinase; Igfbp1, insulin-like growth factor binding protein 1.

Cholesterol and Cholate Induce Inflammatory Gene Expression 42777

by guest on July 11, 2020http://w

ww

.jbc.org/D

ownloaded from

TABLE IIGenes activated or repressed by cholesterol, cholate, or fat

Cholesterol and Cholate Induce Inflammatory Gene Expression42778

by guest on July 11, 2020http://w

ww

.jbc.org/D

ownloaded from

TABLE II—continued

Cholesterol and Cholate Induce Inflammatory Gene Expression 42779

by guest on July 11, 2020http://w

ww

.jbc.org/D

ownloaded from

TABLE II—continued

Cholesterol and Cholate Induce Inflammatory Gene Expression42780

by guest on July 11, 2020http://w

ww

.jbc.org/D

ownloaded from

the consistency of gene expression measurements across indi-vidual microarray hybridizations. Most of these genes had ex-pression levels on the No Cholate diet that were intermediatebetween those on Ath and the No Cholesterol diets. This sug-gests that whereas cholesterol has the strongest effect on ex-pression of these genes, cholate plays an additive role withcholesterol to achieve the peak expression levels.

Notable among the cholesterol-activated genes were 12genes known to be involved in acute inflammation and theimmune response: genes of the serum amyloid A (SAA) family(Saa2, Saa3, and Saa4), histocompatibility antigens (H2-1A-�,H2-1A-�, H2-1E-�, and Ia-associated invariant chain), and ad-ditional inflammation/immune-associated genes including in-terleukin-2 receptor � (Il2rg), small inducible cytokine B9(Scyb9), SAM domain and HD domain 1 (Samhd1), paired-Ig-like receptor A5 (Pira5), and galectin-3 (Lgals3) (Table II). SAAgene expression was induced from 7- to 8-fold (Saa2 and Saa4)to 37-fold (Saa3) on the Ath diet. Whereas omission of cholatefrom the diet diminished the response, cholesterol was abso-lutely critical for activation of SAA gene expression (Fig. 2a).Similar cholesterol requirements were observed for the other

inflammation-related genes shown in Fig. 2a, although magni-tude of expression was lower.

Genes that were repressed by dietary cholesterol includedaquaporin-8, which has been implicated in canalicular bilesecretion in liver (19), Cyp17a1, a key enzyme in C-21 steroidbiosynthesis, and apolipoprotein A-IV, a component of highdensity lipoproteins, that has been shown previously (20) to berepressed by the Ath diet. An additional 7 novel ESTs of un-known function were also repressed by cholesterol (for examplesee Fig. 2b).

Cholate-regulated Genes—Of the three Ath diet componentsexamined here, cholate affected expression levels of the great-est number of genes, with 81 genes induced and 23 repressedby cholate (Table II; see examples in Fig. 2, c and d). Moststriking was the induction of numerous genes encoding colla-gen and non-collagen extracellular matrix components. Theexpression and excretion of extracellular matrix proteins isindicative of fibrogenesis, a wound healing process that occursin response to inflammation induced by infectious or metabolicagents (21). Five collagen genes were activated up to 70-fold bythe Ath diet: Col1a1 and Col1a2 (which encode procollagen,type I, subunits �1 and �2), Col3a1 (procollagen, type III, �1),Col4a1 (procollagen, type IV, �1), Col6a1 (procollagen, type VI,�1), and nidogen (a glycoprotein that binds type IV collagen).Omission of cholesterol from the diet had little effect on colla-gen gene expression, but omission of cholate prevented induc-tion (Fig. 2c). Additional cholate-activated genes involved inextracellular matrix synthesis included nidogen and lumican,two proteins that have direct interactions with extracellularcollagens, as well as vimentin, a cytoskeletal intermediate fil-ament protein, and connective tissue growth factor (Ctgf),which modulates extracellular matrix secretion. Thus, dietarycholate appears to have a specific effect on activation of genesinvolved in the response to chronic inflammation.

Several additional genes induced by cholate have recognizedroles in lipid metabolism. For example, cholate induced phos-pholipid transfer protein (Pltp), which is involved in lipoproteinremodeling and has been shown recently to be regulated by bileacids through the farnesoid X-activated nuclear hormone re-ceptor (22), Also induced by cholate was liver X receptor �, anoxysterol-binding nuclear hormone receptor that activates sev-eral genes involved in cellular cholesterol efflux. Dietarycholate also induced choline kinase and lipocalin 2, genes in-volved in phospholipid synthesis and intracellular lipid trans-port, respectively. The list of genes repressed by cholate wasless extensive than those activated by this component (Table

FIG. 3. Circulating serum amyloid A and hepatic collagen lev-els in response to diet components. a, plasma SAA levels (�gSAA/ml plasma) were determined by enzyme-linked immunosorbentassay for C57BL/6J mice fed the diets indicated for 3 weeks. *, signif-icantly different from Chow, p � 0.05; �, significantly different from NoCholate diet, p � 0.05. b, total acid-pepsin soluble collagens (�g ofcollagen/mg of tissue) were quantitated in liver homogenates ofC57BL/6J mice fed the diets indicated for 3 weeks. �, significantlydifferent from No Cholate diet, p � 0.05. For a and b, values representthe mean and error bars indicate S.D. for 3–4 mice on each diet.

FIG. 4. Hepatic stellate cell markers in C57BL/6J mice areactivated in response to dietary cholate. Hepatic stellate cellmarker expression was evaluated via RT-PCR (16) for mice on theChow, Ath, and No Cholate diets. Expression levels of platelet-derivedgrowth factor receptor� (Pdgfrb), transforming growth factor �1(Tgfb1), procollagen, type I, �1 (Col1a1), and tissue inhibitor of metal-loproteinases-1 (Timp1) were elevated on Ath compared with the Chowdiet, but activation was attenuated when cholate was omitted from thediet. Shown are samples from two mice on each diet. TATA box-bindingprotein (Tbp) was amplified as a normalization control that is unaf-fected by strain or diet.

Cholesterol and Cholate Induce Inflammatory Gene Expression 42781

by guest on July 11, 2020http://w

ww

.jbc.org/D

ownloaded from

II). These included chemokine orphan receptor 1, a choline/ethanolamine kinase (Chk1), a gene implicated in very longchain fatty acid elongation (Elovl3), and cytochrome P450, 7b1(Cyp7b), a key enzyme in the alternate pathway of bile acidsynthesis.

Fat-regulated Genes—Of the Ath diet components, fat af-fected expression of the fewest genes, with 6 fat-activated and9 fat-repressed genes identified by our criteria of at least 2-foldeffects in response to fat across all five diets (Table II). Themagnitude of expression of most of these genes was quitemodest. A notable exception was insulin growth factor-likebinding protein-1 (Igfbp1), which was expressed at high levelson the chow and no fat diets, but repressed on all diets con-taining fat (Fig. 2f).

Confirmation of Independent Cholesterol and Cholate Effectson SAA and Fibrogenic Gene Expression—The data above dem-onstrated that cholesterol was required for the large inductionof SAA gene expression, whereas cholate was required forinduction of collagen gene expression. To confirm that thesegene expression changes resulted in corresponding increases inprotein levels, we quantitated SAA protein levels in blood and

collagen levels in liver under the various diet conditions. Inagreement with the mRNA expression results, SAA proteinlevels in the circulation increased about 30-fold on Ath com-pared with a chow diet. The same high SAA levels were presentwhen cholate was omitted from the Ath diet, but omission ofcholesterol prevented any increase above chow values (Fig. 3a).Analogously, hepatic collagen levels were elevated specificallyin diets containing cholate, regardless of the other components(Fig. 3b). These results establish that the cholesterol- andcholate-specific changes in SAA and collagen gene expressiongive rise to altered protein levels as well.

Additional confirmation that the fibrotic process is activatedby dietary cholate was obtained by examining additional mark-ers of fibrotic gene expression. The major source of collagen andother extracellular matrix proteins in liver fibrosis is hepaticstellate cells, a population of perisinusoidal cells comprising15% of the resident liver cells (23, 24). Hepatic stellate cellstypically exist in a quiescent state, serving as the principalstorage site for retinoids. In response to stimuli such as bacte-rial infection or inflammation, the stellate cells become acti-vated and transform into proliferative, fibrogenic cells. To char-

FIG. 5. Attenuated gene expression response to cholesterol and cholate in the atherosclerosis-resistant C57BL/6ByJ strain.C57BL/6J and C57BL/6ByJ mice were fed the five diets indicated for 3 weeks, and mRNA expression levels were determined by microarrayhybridizations. Expression values are taken from microarrays probed with RNA samples pooled from five mice of each strain on each diet. a,expression profile of cholesterol-activated inflammatory genes in C57BL/6J; b, profile of genes shown in a for the C57BL/6ByJ strain; c, expressionprofile of cholate-activated fibrotic genes in C57BL/6J; and d, profile of genes shown in c for the C57BL/6ByJ strain. Full gene names are givenin Table II.

Cholesterol and Cholate Induce Inflammatory Gene Expression42782

by guest on July 11, 2020http://w

ww

.jbc.org/D

ownloaded from

acterize further the fibrogenic response to dietary cholate, weexamined established markers of activated stellate cells viaRT-PCR (17). The Ath diet increased expression of severalhepatic stellate cell markers including platelet-derived growthfactor �-receptor (Pdgfrb), tissue inhibitor of metalloprotein-ases-1 (Timp1), transforming growth factor �1 (Tgfb1) (see Fig.4), and �-smooth muscle actin (not shown). The induction ofhepatic stellate cell genes was attenuated when cholate wasomitted from the diet, consistent with the observed induction ofcollagen and other fibrotic genes specifically by cholate.

Attenuated Response to Cholesterol and Cholate in an Ath-erosclerosis-resistant C57BL/6 Substrain—As described above,the Ath diet induces expression of several inflammatory genesin C57BL/6J mice, primarily through the cholesterol andcholate components. This raises the possibility that inductionof these genes contributes to the pro-atherogenic effect of thisdiet. To address this issue, we investigated whether the samegene expression patterns occur in an atherosclerosis-resistant,but otherwise genetically similar, mouse strain C57BL/6ByJ.C57BL/6ByJ mice were derived from the same original progen-itor as C57BL/6J but have been bred independently for manyyears (25). Although very few DNA polymorphisms have beendetected between the two C57BL/6 substrains, the C57BL/6ByJ strain is resistant to hypercholesterolemia and aorticlesion formation in response to the Ath diet (26). To determinewhether this strain also differs in gene expression response tocholesterol and cholate, C57BL/6ByJ mice were fed the fivediets described earlier, and expression levels of inflammatorygenes induced by cholesterol and cholate were compared withthose seen for C57BL/6J.

C57BL/6ByJ mice were found to differ dramatically fromC57BL/6J mice in gene expression response to cholesterol. Theinflammatory genes activated by cholesterol in C57BL/6J micewere expressed at similar levels on the chow diet but were notinduced significantly in C57BL/6ByJ by the Ath diet or otherdiets (Fig. 5, a and b). Although the SAA genes were induced7–37-fold in C57BL/6J, Saa2 and Saa4 were induced only 2–3-fold and Saa3 was not induced at all in C57BL/6ByJ. Manyother cholesterol-responsive inflammatory genes showed eitherno induction at all (Scyb9, Samhd1, Pira5, Lgals, and Ly6), orincreased expression slightly on cholesterol-containing diets(H2-Aa, H2-Ab1, H2-Ebi, Ii, and Il2rg) (Fig. 5b). The inductionof fibrosis-related gene expression in C57BL/6ByJ was alsoattenuated compared with C57BL/6J, but less dramaticallythan the cholesterol-responsive genes (Fig. 5, c and d). Al-though nidogen, lumican, vimentin, and Ctgf were similarlyactivated by cholate in both strains, most collagen genes wereeither not activated at all (Col6a1 and Col1a2) or activated at25–50% the levels seen in C57BL/6J (Col1a1 and Col3a1).Thus, the two C57BL/6 substrains differ substantially in theirgene expression response to dietary cholesterol, and C57BL/6ByJ mice also fail to induce collagen family members to thelevels seen in C57BL/6J mice in response to cholate.

The gene expression differences between C57BL/6J andC57BL/6ByJ in SAA and collagen were confirmed by biochem-ical measurements. Circulating SAA levels in C57BL/6J micefed the Ath diet were 5–8-fold higher than in C57BL/6ByJ mice(Fig. 6a). Hepatic collagen levels also remained significantlylower in the C57BL/6ByJ mice in response to the Ath diet (Fig.6b), consistent with the gene expression data. Thus, the closelyrelated C57BL/6 substrains exhibit clearly different responsesto the cholesterol and cholate components of the Ath diet, atboth the transcriptional and protein levels. These findings areconsistent with the possibility that attenuated inflammatoryand fibrotic gene expression contributes to the atherosclerosisresistance in C57BL/6ByJ compared with C57BL/6J mice.

DISCUSSION

The atherogenic diet containing cholesterol, cholate, and fathas been used for more than 25 years by several investigatorsto study the pathology and genetics of atherosclerosis in inbredmouse strains. Although it has been shown that both choles-terol and cholate are required to produce aortic lesions insusceptible mouse strains in a practical period of time (12), it isnot clear what effect each component produces. To begin toaddress this issue, we have used microarrays to quantitategene expression levels in response to Ath diet components. Bycomparing expression patterns on the Ath diet with those ondiets in which one component was omitted, we identifiedgroups of genes that are activated or repressed specifically bycholesterol, cholate, or fat. Although some genes were regu-lated by more than one component, many genes were stronglyinduced or repressed primarily by a single dietary component.Two key groups of genes that are likely to play a role inatherogenesis were found to be induced by the Ath diet: 1) morethan 20 genes involved in acute inflammation/immune re-sponse, and 2) extracellular matrix proteins, characteristic ofhepatic fibrosis in response to chronic injury.

Inflammatory gene activation was dependent on the pres-ence of cholesterol in the diet, whereas the collagen gene familymembers were induced specifically by cholate. These resultsextend previous observations showing that the Ath diet inducesSAA genes in C57BL/6J liver (27) by demonstrating that acti-vation of SAA and other acute inflammatory genes occurs

FIG. 6. Reduced induction of serum amyloid A and hepaticcollagen levels in Ath fed C57BL/6ByJ mice. a, circulating SAAlevels (�g SAA/ml plasma) in C57BL/6J compared with C57BL/6ByJmice fed the Ath diet for 3 or 16 weeks. *, strains differ significantly, p �0.01. b, hepatic collagen levels (�g collagen/mg tissue) in C57BL/6Jcompared with C57BL/6ByJ mice fed the Ath diet for 3 or 7 weeks. *,strains differ significantly, p � 0.05.

Cholesterol and Cholate Induce Inflammatory Gene Expression 42783

by guest on July 11, 2020http://w

ww

.jbc.org/D

ownloaded from

largely in response to cholesterol. Furthermore, the fact thatSAA levels were elevated on the cholate-free diet demonstratesthat the dramatic elevation in LDL/VLDL seen on the Ath dietis not required to activate SAA gene expression, nor do elevatedHDL levels protect against it (see Fig. 1). Likewise, fibroticgene expression was induced even when cholesterol was omit-ted from the Ath diet, indicating that fibrosis is not dependenton elevated plasma or hepatic cholesterol levels (Fig. 1). Theseresults indicate that the cholesterol and cholate components ofthe Ath diet have distinct proatherogenic effects and suggest astrategy to study the contribution of the acute inflammatoryresponse and fibrogenesis independently through dietarymanipulation.

To evaluate the potential relationship between the Ath diet-induced expression of inflammatory and fibrogenic genes andsusceptibility to atherosclerosis, we compared gene expressionin two substrains of C57BL/6 mice, one susceptible and theother resistant to atherosclerosis. We determined previously(26) that C57BL/6ByJ mice fed the Ath diet maintain lowerplasma LDL/VLDL cholesterol levels than C57BL/6J. Here weshow that an important consequence of this may be attenuatedexpression in C57BL/6ByJ of cholesterol-responsive inflamma-tory genes in the liver, resulting in reduced levels of SAA in thecirculation. We also observed reduced collagen gene activationin C57BL/6ByJ. This is intriguing in light of our finding thatC57BL/6ByJ mice exhibit increased bile acid excretion com-pared with C57BL/6J mice (28). Thus, reduced bile acid accu-mulation in B6By mice may protect these animals from fibrosisvia reduced bile acid-induced stellate cell activation and/orapoptosis (29, 30). Inhibition of stellate cell activation has beensuggested as a strategy for treatment of conditions character-ized by hepatic inflammation and fibrosis, including chronicviral hepatitis, alcoholic liver disease, and other causes of livercirrhosis (23, 31–35). Because C57BL/6ByJ mice are resistantto atherosclerosis and exhibit reduced hepatic fibrosis, theymay provide a valuable model to establish whether inhibition ofstellate cell activation is a useful strategy for treatment ofchronic viral hepatitis, alcoholic liver disease, and other causesof liver cirrhosis.

Acknowledgment—We thank Ping Xu for excellent technicalassistance.

REFERENCES

1. Knowles, J. W., and Maeda, N. (2000) Arterioscler. Thromb. Vasc. Biol. 20,2336–2345

2. Fazio, S., and Linton, M. F. (2001) Front. Biosci. 6, D515–D5253. Reardon, C. A., and Getz, G. S. (2001) Curr. Opin. Lipidol. 12, 167–1734. Sheth, S. S., Deluna, A., Allayee, H., and Lusis, A. J. (2002) Curr. Opin.

Lipidol. 13, 181–1895. Thompson, J. S. (1969) J. Atheroscler. Res. 10, 113–1226. Vesselinovitch, D., and Wissler, R. W. (1968) J. Atheroscler. Res. 8, 497–5237. Paigen, B., Morrow, A., Brandon, C., Mitchell, D., and Holmes, P. (1985)

Atherosclerosis 57, 65–738. Paigen, B., Mitchell, D., Reue, K., Morrow, A., Lusis, A. J., and LeBoeuf, R. C.

(1987) Proc. Natl. Acad. Sci. U. S. A. 84, 3763–37679. LeBoeuf, R. C., Doolittle, M. H., Montcalm, A., Martin, D. C., Reue, K., and

Lusis, A. J. (1990) J. Lipid Res. 31, 91–10110. Liao, F., Andalibi, A., deBeer, F. C., Fogelman, A. M., and Lusis, A. J. (1993)

J. Clin. Investig. 91, 2572–257911. Nishina, P. M., Verstuyft, J., and Paigen, B. (1990) J. Lipid Res. 31, 859–86912. Nishina, P. M., Lowe, S., Verstuyft, J., Naggert, J. K., Kuypers, F. A., and

Paigen, B. (1993) J. Lipid Res. 34, 1413–142213. Hedrick, C. C., Castellani, L. W., Warden, C. H., Puppione, D. L., and Lusis,

A. J. (1993) J. Biol. Chem. 268, 20676–2068214. Carr, T. P., Andresen, C. J., and Rudel, L. L. (1993) Clin. Biochem. 26, 39–4215. Kersten, S., Mandard, S., Escher, P., Gonzalez, F. J., Tafuri, S., Desvergne, B.,

and Wahli, W. (2001) FASEB J. 15, 1971–197816. Cohen, R. D., Castellani, L. W., Qiao, J.-H., Van Lenten, B. J., Lusis, A. J., and

Reue, K. (1997) J. Clin. Investig. 99, 1906–191617. Canbay, A., Higuchi, H., Bronk, S. F., Taniai, M., Sebo, T. J., and Gores, G. J.

(2002) Gastroenterology 123, 1323–133018. Vergnes, L., Phan, J., Stolz, A., and Reue, K. (2003) J. Lipid Res. 44, 503–51119. Huebert, R. C., Splinter, P. L., Garcia, F., Marinelli, R. A., and LaRusso, N. F.

(2002) J. Biol. Chem. 277, 22710–2271720. Baroukh, N., Ostos, M. A., Vergnes, L., Recalde, D., Staels, B., Fruchart, J.,

Ochoa, A., Castro, G., and Zakin, M. M. (2001) FEBS Lett. 502, 16–2021. Neubauer, K., Saile, B., and Ramadori, G. (2001) Can. J. Gastroenterol. 15,

187–19322. Urizar, N. L., Dowhan, D. H., and Moore, D. D. (2000) J. Biol. Chem. 275,

39313–3931723. Kmiec, Z. (2001) Adv. Anat. Embryol. Cell Biol. 161, 1–15124. Friedman, S. L. (2000) J. Biol. Chem. 275, 2247–225025. Bailey, D. W. (1978) in Origins of Inbred Mice (Morse, H. C. T., ed) pp.

197–215, Academic Press, New York26. Mouzeyan, A., Choi, J.-H., Allayee, H., Wang, X., W., Sinsheimer, J., Phan, J.,

Castellani, L. W., Reue, K., Lusis, A. J., and Davis, R. C. (2000) J. Lipid Res.41, 573–582

27. Liao, F., Andalibi, A., Qiao, J. H., Allayee, H., Fogelman, A. M., and Lusis, A. J.(1994) J. Clin. Investig. 94, 877–884

28. Phan, J., Pesaran, T., Davis, R. C., and Reue, K. (2002) J. Biol. Chem. 277,469–477

29. Brady, L. M., Beno, D. W. A., and Davis, B. H. (1996) Biochem. J. 316, 765–76930. Higuchi, H., and Gores, G. J. (2003) Am. J. Physiol. 284, G734–G73831. Bissell, D. M. (1998) J. Gastroenterol. Hepatol. 33, 295–30232. Li, D., and Friedman, S. L. (1999) J. Gastroenterol. Hepatol. 14, 618–63333. Marra, F. (1999) J. Hepatol. 31, 1120–113034. Tsukamoto, H., and Lu, S. C. (2001) FASEB J. 15, 1335–134935. Knolle, P., Lohr, H., Treichel, U., Dienes, H. P., Lohse, A., and Gerken, G.

(1995) Z. Gastroenterol. (Verh.) 33, 613–620

Cholesterol and Cholate Induce Inflammatory Gene Expression42784

by guest on July 11, 2020http://w

ww

.jbc.org/D

ownloaded from

Laurent Vergnes, Jack Phan, Merav Strauss, Sherrie Tafuri and Karen Reueof Hepatic Inflammatory Gene Expression

Cholesterol and Cholate Components of an Atherogenic Diet Induce Distinct Stages

doi: 10.1074/jbc.M306022200 originally published online August 15, 20032003, 278:42774-42784.J. Biol. Chem. 

  10.1074/jbc.M306022200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

  http://www.jbc.org/content/suppl/2003/09/15/M306022200.DC1

  http://www.jbc.org/content/278/44/42774.full.html#ref-list-1

This article cites 34 references, 13 of which can be accessed free at

by guest on July 11, 2020http://w

ww

.jbc.org/D

ownloaded from