3052 Research Article

IntroductionSkeletal muscle degeneration can occur as a result of disease orinjury; however, this tissue has an extensive ability to regenerate.Adult regenerative myogenesis is dependent on progenitor cellscalled satellite cells. Satellite cells are normally quiescent, butproliferate in response to injury, and their progeny myoblastsdifferentiate into fusion-competent myocytes, which fuse with oneanother or with existing myofibers to restore normal tissuearchitecture. In vitro studies demonstrate that migration is a keyprocess during myogenesis. Migration is crucial to achieve cell–cell adhesion, which is necessary for differentiation (Kang et al.,2004), as well as formation and growth of myotubes in vitro (Baeet al., 2008; Jansen and Pavlath, 2006; Mylona et al., 2006;O’Connor et al., 2007). Identification of molecules that regulatecell migration might reveal potential molecular targets forimproving muscle regeneration and the efficiency of cell-transplantation therapies (Galvez et al., 2006; Hill et al., 2006;Palumbo et al., 2004).

A number of extracellular molecules are known to regulatemuscle cell migration in vitro. Secreted factors such as hepatocytegrowth factor, fibroblast growth factor, platelet-derived growthfactor and IL-4 have key roles during myogenesis (Bischoff, 1997;Corti et al., 2001; Lee et al., 1999; Robertson et al., 1993; Horsleyet al., 2003; Lafreniere et al., 2006). In addition, extracellularmatrix (ECM) proteins and ECM-associated molecules, such aslaminin, fibronectin, CD44, decorin and N-cadherin, as well asmatrix metalloproteinases, are crucial for regulating cell migrationduring myogenesis (Echtermeyer et al., 1996; Lluri and Jaworski,2005; Lluri et al., 2008; Mylona et al., 2006; Ocalan et al., 1988;Olguin et al., 2003; Yao et al., 1996). Overall, a complex interplay

among many types of proteins is required for proper migration ofmuscle cells.

Chemokines are secreted proteins, approximately 8–10 kDa insize, with 20–70% homology in amino acid sequences, that shareboth leukocyte chemoattractant and cytokine-like behavior(Baggiolini et al., 1995; Luster, 1998). Chemokines are importantfor the migration of muscle precursor cells during embryonicmyogenesis (Vasyutina et al., 2005; Yusuf et al., 2006) and formacrophage infiltration into damaged muscle tissue (McLennan,1996; Robertson et al., 1993). Furthermore, chemokines and theirreceptors are expressed by diseased or regenerating muscle tissue(Hirata et al., 2003; Porter et al., 2003; Sachidanandan et al.,2002; Warren et al., 2005; Warren et al., 2004; Civatte et al.,2005; Demoule et al., 2009). Finally, chemokines are known toregulate migration of several cell types postnatally, such asimmune cells, sperm and metastasizing cancer cells (Kim, 2004;Kim, 2005; Stebler et al., 2004; Bleul et al., 1996; Isobe et al.,2002; Miyazaki et al., 2006; Vandercappellen et al., 2008;Muciaccia et al., 2005a; Muciaccia et al., 2005b). However, nostudies have comprehensively examined the expression of thesemolecules specifically by muscle cells at different phases ofmyogenesis.

Our studies indicate that a large number of chemokines andchemokine receptors are expressed by primary mouse muscle cellsin vitro, especially during times of extensive cell–cell fusion.Furthermore, muscle cells exhibited different migratory behaviorthroughout myogenesis in vitro. One receptor–ligand pair, CXCR4–SDF-1 (CXCL12), regulated the migration of both proliferatingand terminally differentiated muscle cells, and was necessary forproper fusion of muscle cells.

Chemokine expression and control of muscle cellmigration during myogenesisChristine A. Griffin1,2, Luciano H. Apponi2, Kimberly K. Long2 and Grace K. Pavlath2,*1Graduate Program in Biochemistry, Cell and Developmental Biology, Emory University, Atlanta, GA 30322, USA2Department of Pharmacology, Emory University, Atlanta, GA 30322, USA*Author for correspondence (gpavlat@emory.edu)

Accepted 1 June 2010Journal of Cell Science 123, 3052-3060 © 2010. Published by The Company of Biologists Ltddoi:10.1242/jcs.066241

SummaryAdult regenerative myogenesis is vital for restoring normal tissue structure after muscle injury. Muscle regeneration is dependent onprogenitor satellite cells, which proliferate in response to injury, and their progeny differentiate and undergo cell–cell fusion to formregenerating myofibers. Myogenic progenitor cells must be precisely regulated and positioned for proper cell fusion to occur.Chemokines are secreted proteins that share both leukocyte chemoattractant and cytokine-like behavior and affect the physiology ofa number of cell types. We investigated the steady-state mRNA levels of 84 chemokines, chemokine receptors and signaling molecules,to obtain a comprehensive view of chemokine expression by muscle cells during myogenesis in vitro. A large number of chemokinesand chemokine receptors were expressed by primary mouse muscle cells, especially during times of extensive cell–cell fusion.Furthermore, muscle cells exhibited different migratory behavior throughout myogenesis in vitro. One receptor–ligand pair, CXCR4–SDF-1 (CXCL12), regulated migration of both proliferating and terminally differentiated muscle cells, and was necessary for properfusion of muscle cells. Given the large number of chemokines and chemokine receptors directly expressed by muscle cells, theseproteins might have a greater role in myogenesis than previously appreciated.

Key words: Fusion, Myoblast, Myocyte, CXCR4, SDF-1, Regeneration

Jour

nal o

f Cel

l Sci

ence

ResultsMany chemokines and their receptors are expressedduring myogenesisTo determine which chemokine receptors and ligands are expressedby muscle cells at different time points during myogenesis, purecultures of primary mouse muscle cells were used because theyfollow a predictable time-course of myogenesis. Upon removal ofserum, myoblasts differentiate into myocytes that fuse to formnascent myotubes, which are small and contain few nuclei.Subsequently, myocytes fuse with nascent myotubes creatingmature myotubes, which are large and contain many nuclei (Fig.1A). In our culture conditions, by 16 hours in differentiationmedium (DM), the majority of cells were terminally differentiatedmyocytes as indicated by the high percentage of embryonic myosin-heavy-chain-positive (eMyHC+) cells (Fig. 1B). After 24 hours inDM, ~40% of myocytes were fused with each other to form nascentmyotubes. By 48 hours, ~70% of myocytes were fused, creatingmature myotubes (Fig. 1C). A real-time RT-PCR array was used to

3053Chemokines and myogenesis

investigate the mRNA steady-state levels of 84 chemokines,chemokine receptors and signaling molecules, to obtain acomprehensive view of chemokine expression during myogenesis.Approximately 80 of these mRNAs were detected duringmyogenesis, indicating that many chemokine receptors and ligandsare expressed directly by muscle cells in vitro. The steady-statelevels of these mRNAs varied drastically; a small subset of geneshad extremely high steady-state levels, ~10,000- to 1-million-foldhigher than other genes (supplementary material Table S1).Furthermore, no genes were constitutively expressed at a stablelevel throughout myogenesis; instead the mRNA levels of all genesincreased after differentiation. Very few mRNAs were present after6 or 48 hours in DM; rather, most mRNA steady-state levels werehighest between 16 and 36 hours in DM (Table 1; Fig. 1D,E),which were time points of extensive differentiation and fusion ofmyocytes.

Many chemokine receptors and ligands known to be expressedby skeletal muscle cells or tissue were shown in this assay to beexpressed directly by muscle cells (Bischoff, 1997; Chazaud etal., 2003; Chong et al., 2007; Civatte et al., 2005; De Rossi et al.,2000; Hirata et al., 2003; Odemis et al., 2007; Peterson andPizza, 2009; Porter et al., 2003; Ratajczak et al., 2003;Sachidanandan et al., 2002; Summan et al., 2003; Warren et al.,2005; Warren et al., 2004). For example, IL4, an important pro-myogenic factor expressed during myogenesis in vitro and invivo (Horsley et al., 2003; Lafreniere et al., 2006), was identifiedby this chemokine array (Table 1). However, a few chemokinereceptors and ligands not previously known to be expressed byskeletal muscle cells or tissue were also identified, includingangiotensin receptor-like 1 (AGTRL1, Aplnr, apelin receptor),bone morphogenic protein 10 (BMP10), CXCL13, and its receptorCXCR5 (Burkitt’s lymphoma receptor 1, BLR1). The largenumber of chemokine receptor–ligand pairs expressed directlyby muscle cells suggests a complex spatial and temporal controlof migration during myogenesis.

Fig. 1. Chemokines and their receptors are expressed during in vitromyogenesis. (A)During myotube formation, the majority of myoblasts (red)terminally differentiate into myocytes (green) which migrate, adhere and fusewith one another to form small nascent myotubes with few nuclei (blue).Subsequently, nascent myotubes fuse with myocytes to form large maturemyotubes with many nuclei (blue). (B)Primary mouse muscle cells wereimmunostained for eMyHC at different times in DM and the percentage ofnuclei within eMyHC+ cells (differentiation index) was determined. By 16hours in DM, most nuclei were in eMyHC+ cells. (C)The fusion index, orpercentage of nuclei in myotubes, increased with time, and by 48 hours themajority of nuclei were within myotubes. (D)A real-time RT-PCR array wasused to analyze the time-course of expression in vitro for 84 genes pertainingto chemokines. Positive results were obtained for 80 genes. Three patterns ofexpression were observed with mRNA steady state levels peaking at 16, 24 or36 hours in DM, times of extensive differentiation and fusion. The number ofgenes with peak expression levels at each time point is shown. (E)Time courseof expression for three representative genes peaking at 16 (CCR3), 24(CXCR4) or 36 hours (IL13) in DM. Data are means ± s.e.m., n3.

Table 1. Chemokines and chemokine receptors expressedduring in vitro myogenesisa

Not 16 hours 24 hours 36 hours expressed

Bmp10 Agtrl1 Ccr8 Gdf5 Blr1 Cxcr6Ccbp2 Bdnf Ccrl1 Gpr2 Bmp6 InhaCcl12 Bmp15 Ccrl2 Gpr81 Ccr2 LifCcl17 Ccl1 Cmklr1 Il16 Cmkor1 Mmp2Ccl2 Ccl11 Cmtm2a Il18 Cmtm4Ccr1 Ccl19 Cmtm5 Il1a Cxcl12Ccr3 Ccl20 Cxcl1 Il4 Hif1aCcr9 Ccl4 Cxcl13 Il8ra Il13Cmtm3 Ccl5 Cxcl15 Il8rb InhbbCmtm6 Ccl6 Cxcl2 Ltb4r2 Myd88Csf1 Ccl7 Cxcl4 Rgs3 Nfkb1Csf2 Ccl8 Cxcl5 Slit2 Tlr4Cx3cl1 Ccl9 Cxcl7 TnfCx3cr1 Ccr1l1 Cxcl9 Tnfrsf1aCxcl10 Ccr4 Cxcr3 Tnfsf14Cxcl11 Ccr5 Cxcr4 Trem1

Ccr6 Ecgf1 Xcl1Ccr7

aReal-time RT-PCR was used to analyze the mRNA levels of 84 genespertaining to chemokines in primary mouse muscle cells at 6, 16, 24, 36 and48 hours in DM. Genes are shown at the peak expression time point (hours inDM) with n3.

Jour

nal o

f Cel

l Sci

ence

The migratory behavior of muscle cells changes duringmyogenesisTo conduct an in-depth analysis of the migratory behavior ofmuscle cells during myogenesis, time-lapse microscopy wasperformed for 3 hours at different time points (Fig. 2A). Myocytesdisplayed distinct differences in migration compared withmyoblasts. At 0 hours, myoblasts migrated far from their point oforigin, whereas over the course of myogenesis, myocytes stayedprogressively closer to their point of origin (Fig. 2A). Theproportion of slow-moving cells also increased during myogenesis(Fig. 2B), causing a concomitant decrease in mean velocity from56 m/hour at 0 hours to 22 m/hour at 48 hours in DM. Thediminished velocity of myocytes at 48 hours was not due to a lossin cell motility or viability because the addition of fresh serum-freeDM increased cell migration (data not shown). The enhancementof cell migration by fresh DM might be due to elimination ofinhibitory factors secreted by cells into the medium duringmyogenesis. Thus, muscle cells are migratory throughoutmyogenesis; as most investigations have focused on myoblastmigration, the majority of receptor–ligand pairs that regulatemyocyte migration are unknown.

Myoblasts and myocytes migrate to distinct factorsTo determine whether myocytes migrate in response to canonicalmyoblast chemoattractants, cell migration was analyzed in Boydenchambers using hepatocyte growth factor (HGF) and platelet-derived growth factor (PDGF), potent myoblast chemoattractants(Bischoff, 1997; Corti et al., 2001). We enriched for myocytes byculturing cells in DM for 24 hours at low density to preventmyotube formation yielding 96% of nuclei in eMyHC+ cells, andonly 7% of nuclei in myotubes. Both HGF and PDGF greatlyenhancing the migration of myoblasts; however, neither factorstimulated myocyte migration (Fig. 3), suggesting that intrinsicdifferences exist between the two cell types, such as differentialexpression of chemoattractant receptors. However, myocytesexhibited a 65-fold increase in migration to conditioned media(CM), which contains the factors secreted by muscle cells duringdifferentiation and fusion, compared with control medium (Fig. 3).Migration to CM suggests that migratory factors, such aschemokines, are secreted during myogenesis and control migration

3054 Journal of Cell Science 123 (18)

during the process of cell fusion to form myotubes. Together, thesedata suggest that factors which regulate myoblast migration mightnot regulate myocyte migration during myogenesis in vitro.

Myocytes exist during muscle regenerationWe next quantified the percentage of myocytes during adultregenerative myogenesis in vivo. Regenerative myogenesis is anasynchronous process that requires both spatial and temporalcoordination. Upon injury, satellite cells proliferate and thenterminally differentiate to become fusion-competent myocytes,which express differentiation-specific proteins such as myogenin,p21 and eMyHC and then fuse with each other and with myofibersto restore normal tissue architecture. Mononucleated cells wereisolated from injured mouse muscles and analyzed by flowcytometry (Fig. 4A). Muscle cells were defined as 7-integrin-positive cells, which were also negative for endothelial andhematopoietic lineage markers (CD31 and CD45) (Blanco-Bose etal., 2001; Kafadar et al., 2009). As muscle cells are quiescentbefore injury (Schultz et al., 1978) and in days immediatelyfollowing injury, the majority of mononucleated cells in muscletissue are immune cells (Allbrook, 1981; McLennan, 1996; Tidball,2005); day 3 was the earliest time point analyzed. At later timepoints, myogenic cells are fusing into newly regenerating myofibers(Allbrook, 1981), therefore day 7 was the latest time point assayed.The relative percentage of mononucleated muscle cells did notchange during these time points of regeneration (Fig. 4B). Todetermine whether differentiated 7-integrin+ CD31– CD45– musclecells exist during regeneration, cells were also immunostained forp21, which marks terminally differentiated cells (Andres and Walsh,1996). The peak percentage of terminally differentiated p21+

myogenic cells was observed at day 5 after injury (Fig. 4C,D).We used several markers to determine the progression of muscle

cells through the continuum of differentiation. As muscle cellsprogress through differentiation, first myogenin is expressed, thenp21 and finally MyHC (Andres and Walsh, 1996). Therefore, cellsat later stages of differentiation are myogenin+ p21+ eMyHC+ andthese cells are not likely to accumulate because they should befusing to form newly regenerated myofibers. To determine thepercentage of muscle cells at early and late stages of differentiation,myogenic cells were isolated from gastrocnemius muscles at day5 after injury by FACS, and immunostained for myogenin andeMyHC in vitro (Fig. 4E). Approximately 60% of myogenic cellswere myogenin+ and 18% were eMyHC+ (Fig. 4F). Therefore,regenerating muscle tissue at day 5 is a mixture of myogenic cells

Fig. 2. Changes in migratory behavior with muscle cell differentiation.(A)Migratory paths of mononucleated primary mouse muscle cells at 0, 6, 16,24, 36 and 48 hours in DM. Tracks were taken from 3 hours of time-lapsemicroscopy with pictures every 5 minutes. Representative graphs are shownfrom one of three independent isolates with 20 cells each. (B)Frequencydistribution of cell velocity at different times in myogenesis. A total of 60 cellswere analyzed. Data are n3.

Fig. 3. Myocytes do not migrate to canonical myoblast migratory factors.Primary mouse myoblasts (Mb) and myocytes (Mc, 24 hours in DM) wereallowed to migrate in Boyden chambers to control medium (C) or mediumcontaining 100 ng/ml HGF or PDGF for 5 hours. Myocyte migration toconditioned medium (CM) from cultures in DM for 24 hours was also tested.Data are mean ± s.e.m., n3–5 (*P<0.05 compared with control; **P<0.05compared with myoblasts).

Jour

nal o

f Cel

l Sci

ence

at various stages of differentiation. As the expression of chemokinereceptor–ligand pairs increased after differentiation of muscle cellsin vitro, these factors are likely to be involved in the regulation ofdifferentiating myogenic cells in vivo.

CXCR4 and SDF-1 are expressed during myogenesis invitro and in vivoWe examined the role of the most highly expressed chemokinereceptor CXCR4 and its ligand, CXCL12 or SDF-1, in moredetail. The receptor CXCR4 and ligand SDF-1 were of specificinterest because several studies have shown expression of theseproteins by muscle cells or tissue, but conflicting reports existregarding their role during myogenesis (Bae et al., 2008; Chong etal., 2007; Melchionna et al., 2010; Odemis et al., 2007; Odemis etal., 2005; Ratajczak et al., 2003; Vasyutina et al., 2005; Yusufet al., 2006). To confirm expression of CXCR4 at the protein level,flow cytometry was used to determine the percentage of CXCR4+

cells in pure cultures of primary mouse myoblasts and myocytes;~30% of myoblasts were CXCR4+ compared with ~60% ofmyocytes (Fig. 5A,B). Furthermore, myocytes contained ~two-fold more CXCR4 per cell (Fig. 5C,D), yet myocytes were only18% larger than myoblasts (Fig. 5E), suggesting that myocyteshave a higher density of CXCR4 at the plasma membrane. Theincreased level of CXCR4 protein in myocytes correlated to theincreased mRNA levels of CXCR4 at 24 hours in DM (Fig. 1E).To determine whether CXCR4 and SDF1 are expressed duringadult regenerative myogenesis, the percentage of CXCR4+ 7-

3055Chemokines and myogenesis

integrin+ CD31– CD45– myogenic cells was determined at day 3and day 5 after injury (Fig. 5F,G). From day 3 to day 5, thepercentage of myogenic CXCR4+ cells increased from ~45% to77% (Fig. 5H). In addition, the amount of CXCR4 per muscle cellwas increased ~2.5-fold at day 5 compared with day 3 (Fig. 5I),with no change in cell size (data not shown). The percentage ofmyogenic cells that express CXCR4 in regenerating muscle at day3 is lower than the 80% CXCR4+ cells observed in freshly isolatedquiescent Pax7+ satellite cells on myofibers from uninjured muscle(Cerletti et al., 2008). This discrepancy might be due in part to themarker used for positive selection of myogenic cells in our studies,but is also probably due to modulation of CXCR4-expressing cellsby the regenerative process because we observe a 1.7-fold increasein the percentage of CXCR4+ myogenic cells from day 3 to day 7.

To validate expression of SDF1- at the protein level, ELISAassays were performed using control DM and 24 hours CM;significant levels of SDF1- were detected in CM (Fig. 5J). Thelevels of SDF1- in crushed muscle extract, which contains releasedsoluble protein by control and regenerating muscles, were alsodetermined (Bischoff, 1986; Chen and Quinn, 1992). Muscles atday 3 after injury contained significantly higher levels of SDF1-,compared with uninjured muscles or muscles at day 5 after injury(Fig. 5K). Therefore, SDF1- might be released under certainconditions after injury. Together, these data demonstrate thatCXCR4 and SDF-1 proteins are expressed by primary mousemuscle cells during myogenesis in vitro. As CXCR4 was expressedby mononucleated muscle cells during adult regenerative

Fig. 4. Myocytes exist during muscleregeneration. (A)Mononucleated cells wereisolated from gastrocnemius muscles at days 3, 5and 7 after injury and immunostained withantibodies against CD31 (APC), CD45 (APC) and7 integrin (PE): CD31+ CD45+, to identifyendothelial and immune cells and 7-integrin+

CD31– CD45– for myogenic cells. Myogenic cellsconstituted ~8% of the total mononucleated cellsat day 3. Isotype controls were used to determineproper gating (left panel). (B)The percentage ofmyogenic cells remained stable during muscleregeneration. (C)Mononucleated cells wereisolated from gastrocnemius muscles at indicateddays after injury and immunostained withantibodies against CD31 (APC), CD45 (APC), 7integrin (PE) and p21 (FITC) to identifyterminally differentiated muscle cells. Myogenic7-integrin+ CD31– CD45– cells were analyzed forp21. Isotype control was used to determine propergating (left panel). (D)The percentage of p21+

myogenic cells was highest at day 5 after injury.(E)Mononucleated 7-integrin+ CD31– CD45–

myogenic cells isolated from gastrocnemiusmuscles 5 days after injury were plated in vitroand immunostained for differentiation markers,myogenin (top left) and eMyHC (top right) orappropriate IgG controls (bottom). Scale bar:10m. (F)The percentage of myogenin+ andeMyHC+ cells in E; ~60% of cells weremyogenin+ a marker for earlier stages ofdifferentiation, and ~20% were eMyHC+, amarker for later stages of differentiation. Data arefrom a pool of ten mice.

Jour

nal o

f Cel

l Sci

ence

myogenesis, and SDF-1 was isolated from muscle tissue, thisreceptor–ligand pair might regulate myogenesis.

The CXCR4–SDF-1 axis is important for proper musclecell fusionTo examine the role of the CXCR4–SDF-1 axis in myogenesis, weused primary mouse muscle cells in vitro, because direct effects onmuscle cells can be analyzed in the absence of other cell types. Todetermine whether the CXCR4–SDF-1 axis regulates migrationduring myogenesis, myoblasts and myocytes were allowed to migrateto several concentrations of SDF-1 in Boyden chambers (Fig. 6A).Interestingly, while both cell types were attracted to SDF-1,myoblasts required a 20-fold higher concentration than myocytes toachieve a similar level of migration. This difference is likely due notonly to the greater percentage of CXCR4+ cells in the myocytepopulation, but also to the increased CXCR4 per myocyte. Thus,SDF-1 affects migration of both myoblasts and myocytes, althoughmyocytes exhibit a greater sensitivity to SDF-1.

To determine whether CXCR4-dependent processes are necessaryfor myogenesis, a pharmacological inhibitor of CXCR4, AMD3100

3056 Journal of Cell Science 123 (18)

(De Clercq, 2005), was added to cells at the start of differentiation.Nascent myotubes in cultures treated with AMD appeared smallerthan vehicle-treated cells at 24 hours in DM (Fig. 6B). However,neither the number of cells per field nor the number of nuclei indifferentiated cells was affected (data not shown). Rather, additionof AMD decreased the fusion index, or the total number of nucleiin myotubes, by ~30% compared with the control (Fig. 6C). Wealso examined myogenesis in vitro in cells containing siRNA toknock down CXCR4. CXCR4 protein levels were decreased by~45% by Cxcr4 siRNA (Fig. 6D). After 24 or 48 hours in DM, cellswere immunostained for eMyHC; at both time points, Cxcr4 siRNAcultures contained smaller myotubes compared with the control(Fig. 6E). This defect in myotube formation was not due to adecrease in the total number of nuclei (Fig. 6F), nor to an affect ondifferentiation, as measured by the percentage of nuclei found ineMyHC+ cells (Fig. 6G). Rather, Cxcr4 siRNA myocytes exhibiteda clear defect in cell fusion (Fig. 6H), because the fusion index wasdecreased 36% and 24%, at 24 and 48 hours, respectively, in Cxcr4siRNA cultures (Fig. 6H). Together, these data support the hypothesisthat the CXCR4–SDF-1 axis is necessary for proper myogenesis

Fig. 5. CXCR4 and SDF-1 are expressed during myogenesis invitro and in vivo. (A)Primary mouse myoblasts and myocytes wereimmunostained with antibodies against CXCR4 (APC) in vitro.(B)The percentage of CXCR4+ cells was quantified; a significantlyhigher percentage of myocytes were CXCR4+. (C)Representativehistogram; the level of CXCR4 per cell was also increased betweenmyoblasts and myocytes. (D)Mean fluorescence intensity of CXCR4per cell; myocytes contained almost twice as much CXCR4 per cell.(E)Myocytes were 18% larger than myoblasts. (F)Mononucleatedcells were isolated from gastrocnemius muscles at days 3 and 5 afterinjury and immunostained with antibodies against CD31 (FITC),CD45 (FITC), 7 integrin (PE) and CXCR4 (APC). Cells wereanalyzed with the following criteria: CD31+ CD45+, to identifyendothelial and immune cells and 7-integrin+ CD31– CD45– formyogenic cells. Day 5 is shown. (G)Myogenic 7-integrin+ CD31–

CD45– cells were analyzed for CXCR4 and a representative histogramis shown. (H)The percentage of CXCR4+ myogenic cells; a higherpercentage of myogenic cells were CXCR4+ at day 5. (I)The meanfluorescence intensity of CXCR4 per cell was also increased betweenday 3 and 5; myocytes contained almost twice as much CXCR4 percell. (J)The level of SDF-1 secreted by primary mouse muscle cellsin vitro during myogenesis (24 hours CM) was determined by ELISA.(K)The level of SDF-1 in crushed muscle extract determined byELISA. The level of SDF-1 was increased at day 3. In all flowcytometry experiments: propidium iodide (PI) was used to removedead cells from analysis; representative flow plots are shown andisotype controls were used to determine proper gating. Data are means± s.e.m., n3 (*P<0.05 compared with Mb, control or 0 days asappropriate).

Jour

nal o

f Cel

l Sci

ence

in vitro. The predominant role for CXCR4–SDF-1 duringmyogenesis might be to regulate the migration of muscle cells,which affects downstream fusion events.

DiscussionAdult regenerative myogenesis is vital for restoring normalmyofiber structure after muscle injury. Myogenic progenitor cellsmust be precisely regulated and positioned in order for proper cellfusion to occur. Using a cell culture model of myogenesis, wedemonstrated that a large number of chemokines and chemokinereceptors were upregulated during myogenesis when terminallydifferentiated myocytes were fusing. Differences in migratorybehavior were noted between myoblasts and myocytes. Theseresults suggest that regulation of cell migration during myogenesisis complex.

Several chemokines and chemokine receptors we identified werenot previously known to be expressed by skeletal muscle cells ortissue (Civatte et al., 2005; De Rossi et al., 2000; Demoule et al.,2009; Hirata et al., 2003; Peterson and Pizza, 2009; Porter et al.,2003; Sachidanandan et al., 2002; Warren et al., 2005; Warren etal., 2004), however, these molecules have known roles in othermuscle types. For example, AGTRL1 has protective effects inischemic heart disease (O’Donnell et al., 2007) and BMP10regulates hypertropic growth in heart muscle (Chen et al., 2006).Neither of these proteins has identified functions in skeletal musclebut might regulate skeletal muscle growth or repair given their rolein smooth and cardiac muscle. Another gene that we found to be

3057Chemokines and myogenesis

expressed during myogenesis, BLR1 (CXCR5), regulates migrationof B-cells into ischemia-damaged intestinal tissue throughexpression of CXCL13 by the damaged areas (Chen et al., 2009),but lacks an identified role during injury repair in skeletal muscle.These results suggest new avenues of research into chemokine-mediated regulation of adult regenerative myogenesis.

A key question is why so many chemokines and chemokinereceptors are expressed directly by muscle cells during myogenesisin vitro. As muscle cells are heterogenous (Asakura et al., 2002;Motohashi et al., 2008; Relaix et al., 2005; Tanaka et al., 2009),subpopulations of muscle cells might express a single receptor orligand. Alternatively, several of these molecules might be expressedby each muscle cell, as occurs in the immune system (Civatte etal., 2005; Porter et al., 2003; Warren et al., 2004). If severalreceptors are expressed by a single cell, specific chemokinereceptors might be used in a spatial-temporal manner. Alternatively,a redundant system might exist, allowing the substitution of onereceptor–ligand pair for another. Such a system would allowdisruption of a single receptor–ligand pair without serious detrimentto myogenesis. Interestingly, our results demonstrate that myocytesdid not migrate in response to canonical myoblast migration factors.Instead, myocytes migrated to factors secreted by fusing musclecells. Thus, regulation of cell migration during different phases ofmyogenesis is differentially controlled.

The multitude of chemokines and chemokine receptors expressedduring myogenesis in vitro might regulate similar or distinctprocesses. Chemokines regulate cell number at several levels,

Fig. 6. CXCR4 and SDF-1 regulate migration ofmyoblasts and myocytes, and are necessary formyogenesis. (A)Boyden chamber experiments wereperformed with primary mouse myoblasts (Mb) andmyocytes (Mc) with varying concentrations of SDF-1.Myoblasts exhibited peak migration to 200 ng/ml, whereasmyocytes migrated to 10–50 ng/ml. (B)AMD3100 orvehicle (V) was added to cultures with differentiationmedia (DM). Cultures were fixed and immunostained forembryonic myosin heavy chain (eMyHC) at 24 hours inDM. Scale bar: 50m. (C)Fusion index calculated as thenumber of nuclei in myotubes divided by the total numberof nuclei. Addition of AMD decreased fusion at 24 hoursin DM. (D)CXCR4 protein levels were decreased byCxcr4 siRNA by ~45%. Tubulin was used a loadingcontrol. (E)Cells treated with control or Cxcr4 siRNAwere placed in differentiation media (DM), fixed andimmunostained for embryonic myosin heavy chain(eMyHC) at 48 hours in DM. (F)The total number ofnuclei in each field was calculated. No difference betweencontrol and Cxcr4 siRNA cultures was observed at 24hours, indicating that cell survival during differentiationwas not affected by Cxcr4 siRNA. (G)Differentiationindex calculated as the number of nuclei in eMyHC+ cellsdivided by the total number of nuclei. No difference wasobserved, suggesting that terminal differentiation was notaffected by Cxcr4 siRNA. (H)Fusion index calculated asthe number of nuclei in myotubes divided by the totalnumber of nuclei. Cxcr4 siRNA decreased fusion at both24 and 48 hours in DM. Data are means ± s.e.m., n3(*P<0.05 compared with control or Mb, **P<0.05compared with Mb at same concentration).

Jour

nal o

f Cel

l Sci

ence

including survival and proliferation (Miyazaki et al., 2006; Schoberand Zernecke, 2007); thus, chemokines expressed early duringmyogenesis, might regulate myoblast proliferation or survival.Also, because muscle cells must interact directly with one anotherfor terminal differentiation to occur (Krauss et al., 2005),chemokines might also regulate migration of myoblasts. Our datasuggest that multiple chemokine receptor–ligand pairs regulatelater stages of myogenesis, such as migration and fusion, as thesemolecules are not expressed at high levels until the majority ofcells are terminally differentiated myocytes. Curiously, theexpression levels of these molecules were highest during periodsof myogenesis in which the myocytes were progressively movingslower, as measured by time-lapse microscopy. Chemokines notonly regulate cell velocity, but also directional migration of cells(Kim, 2004). Perhaps chemokines at these later stages ofmyogenesis are key for positioning myocytes in the correct spatialpatterns necessary for cell fusion to occur with other myocytes andwith nascent myotubes, rather than acting to enhance cell velocity.Chemokines expressed by muscle cells in vivo might not onlyhave a direct effect on myogenesis, but may also act in a paracrinemanner. Chemokines regulate the recruitment of immune cells todamaged tissues (Bleul et al., 1996; Loetscher et al., 1996; Weberet al., 1995), including injured muscle (Robertson et al., 1993);immune cells such as macrophages are crucial for muscleregeneration (Arnold et al., 2007). Therefore, chemokines mightregulate myogenesis through several distinct processes.

The investigation of a single receptor–ligand pair, CXCR4 andSDF-1, indicated that some chemokines identified in this study doregulate migration during myogenesis in vitro. We show that CXCR4is expressed by both primary mouse myoblasts and myocytes, andits ligand SDF-1 can increase migration of both cell types, albeitat different concentrations. However, despite inhibition of CXCR4by two different methods, primary muscle cells differentiate similarlyto untreated cells, but are unable to undergo fusion as efficiently.Together, these results suggest that CXCR4 is necessary for migrationof muscle cells to one another, which is required for normal fusion.Our studies expand on previous CXCR4 studies in the field. Themajority of in vitro CXCR4 studies use the immortalized C2C12mouse muscle cell line (Melchionna et al., 2010; Odemis et al.,2007; Ratajczak et al., 2003). Similarly to our results, the CXCR4–SDF-1 axis enhances migration of C2C12 myoblasts (Odemis etal., 2007; Ratajczak et al., 2003). However, in contrast to our studies,investigations on C2C12 cells suggest that loss of CXCR4 leads toan inhibition of differentiation as measured by decreased expressionof differentiation-specific muscle proteins, such as myogenin and/ormyosin heavy chain (Melchionna et al., 2010; Odemis et al., 2007).In one study, an almost complete abrogation of muscle celldifferentiation was observed with loss of CXCR4, despite the factthat only 15% of C2C12 cells express CXCR4 (Odemis et al., 2007).Differences between primary muscle cells and established cell linescould contribute to some of the differences between our studies andthose with C2C12 cells. Interestingly, loss of CD164, a sialomucinthat interacts with CXCR4, on the cell surface where it probablyfunctions as a component of a CXCR4 receptor complex (Bae et al.,2008; Forde et al., 2007), also affected migration and myotubeformation, but not differentiation of C2C12 cells, similarly to ourexperiments (Bae et al., 2008). The CXCR4–SDF-1 axis is knownto have a role in embryonic muscle development. Most studies thatanalyze CXCR4 function during embryonic myogenesis in mice,zebrafish and chick suggest that perturbation of CXCR4 signalingalters limb-muscle development mainly as a result of deficiencies in

3058 Journal of Cell Science 123 (18)

migration of myogenic precursor cells from the somites to the limbbuds (Chong et al., 2007; Vasyutina et al., 2005; Yusuf et al., 2006).Since terminal differentiation and fusion occur downstream ofmigration, defects in these later processes could not be analyzedduring embryonic development independently of migration defects.However, one study of embryonic muscle development in Cxcr4-null mice did not observe defects in migration of muscle precursorcells to the limb buds but defects in muscle mass were noted; nomechanism was determined for this loss of muscle mass (Odemis etal., 2005). No studies of the CXCR4–SDF-1 axis have beenperformed in adult regenerative myogenesis.

CXCR4 is of specific interest to cell-therapy approaches forvarious muscular disorders. A subset of muscle satellite cells thatare CXCR4+ can be engrafted into injured muscle tissue with ahigh efficiency (Cerletti et al., 2008). As CXCR4 regulatesmigration of muscle cells both in vitro and in vivo, the increasedengraftment might be due to an increased migratory ability ofthese cells. Furthermore, treatment with SDF-1 enhancesmigration of myogenic precursors, yielding a positive effect onengraftment of cells into damaged muscle (Galvez et al., 2006).These data suggest that CXCR4–SDF-1-dependent migrationenhances the engraftment of cells into damaged muscle. The largenumber of chemokine receptors and ligands expressed by musclecells during myogenesis in vitro suggests further avenues ofresearch to be explored during adult regenerative myogenesis.Further studies of chemokines in vivo might lead to manipulationof these molecules and allow for an increased efficiency of cell-transplantation therapies for various muscle disorders.

Materials and MethodsAnimals and muscle injuriesAdult mice between 8 and 12 weeks of age were used and handled in accordancewith the institutional guidelines of Emory University. To induce regeneration,gastrocnemius muscles of male C57BL/6 mice were injected with BaCl2 (O’Connoret al., 2007) and collected as described (Abbott et al., 1998).

Primary muscle cell culture, differentiation and fusion assaysPrimary myoblasts were derived from the hindlimb muscles of Balb/C mice(Bondesen et al., 2004; Mitchell and Pavlath, 2001) and cultures were >99%myogenic as assessed by MyoD immunostaining (Jansen and Pavlath, 2006). For allexperiments 3–5 independent isolates were analyzed. To induce differentiation,primary myoblasts were seeded at a density of 2�105 cells/well on dishes coatedwith entactin, collagen IV and laminin (E-C-L; Upstate Biotechnology) and switchedto differentiation media [DM: DME, 1% insulin-transferrin-selenium-A supplement(Invitrogen)], 100 U/ml penicillin G and 100 g/ml streptomycin). At indicated timepoints, cells were immunostained with an eMyHC antibody (F1.652; DevelopmentalStudies Hybridoma Bank) and analyzed as described (Horsley et al., 2001). AMD3100(Sigma) was dissolved in PBS and used at 10 M in DM. At least 500 nuclei percondition were analyzed for each assay.

Transfection of primary myoblastsStealth RNAi (Invitrogen) was used to knockdown Cxcr4 expression in primarymyoblasts. Myoblasts were plated in growth medium (GM; F10, 20% fetal bovineserum, 100 U/ml penicillin G and 100 g/ml streptomycin) at a density of 8�105

cells per collagen-coated 100 mm plates and after 6 hours, duplexed siRNAs at afinal concentration of 27 nM each were used to transfect cells using Lipofectamine2000 (Invitrogen) in GM according to the manufacturer’s instructions. Cells weretransfected with either scrambled control or a mixture of three Cxcr4 siRNAs(Invitrogen, ACGAGGUAGAGAAGCAGAUGAAUAUGGCAAUGGAUUGGU -GAUCCUGGUCA; ACAGGUACAUCUGUGACCGCCUUUA; CAGUCAUC -CUCAUCCUAGCUUUCUU). After 6 hours of incubation, medium containingtransfection complexes was replaced by fresh GM. Twenty-four hours after the startof transfection, cells were trypsinized, plated on six-well dishes and differentiatedfor 24 hours and 48 hours as described for differentiation and fusion assays above.CXCR4 knockdown was assessed by immunoblotting using anti-CXCR4 (Abcam)after 24 hours of transfection. Results represent data from three independent isolates.

Flow cytometryTo analyze CXCR4 expression in vitro by flow cytometry, primary myoblasts wereimmunostained with anti-CXCR4-APC antibody (1:100; BD Pharmigen) and

Jour

nal o

f Cel

l Sci

ence

3059Chemokines and myogenesis

analyzed on a FACSCalibur (Becton-Dickinson). For analysis of CXCR4 expressionduring regeneration, mononucleated cells were dissociated from gastrocnemiusmuscles of mice at the indicated times after BaCl2 injection (n4 for each time point)and immunostained with antibodies to CD31-FITC (1:100; eBiosciences), CD45-FITC (1:100; BD Biosciences), 7-integrin-PE (1:200; a gift from Fabio Rossi,University of British Columbia, Vancouver, Canada) and CXCR4-APC (1:100; BDPharmigen). CD31– CD45– cells were analyzed for 7-integrin-PE and CXCR4expression. For analysis of p21 expression during regeneration, mononucleated cellswere dissociated from gastrocnemius muscles of mice at the indicated times afterBaCl2 injection (n10 for each time point), fixed with cold 70% ethanol overnightat –20°C and immunostained with antibodies to CD31-APC (1:100; eBiosciences),CD45-APC (1:100; BD Biosciences), 7-integrin-PE and p21 (1:100; LifespanBiosciences). To detect p21, cells were incubated with biotin-conjugated donkeyanti-goat (1:100; Jackson ImmunoResearch) for 20 minutes, then FITC-conjugatedstrepavidin (1:100; Jackson ImmunoResearch Lab., Inc.) for 20 minutes. CD31–

CD45– cells were analyzed for 7-integrin and p21 expression (n10 for each timepoint). For each sample, 10,000 cells were analyzed, and propidium iodide was usedto remove dead cells. Isotype controls were used to determine gating. All dataanalysis was performed using FlowJo v. 6.2.1 (TreeStar).

ImmunostainingMyogenin and eMyHC immunostaining was performed using a VectaStain kit(Vector labs). 7-integrin+ CD31– CD45– muscle cells isolated from gastrocnemiusmuscles by FACS were plated then fixed in 4% PFA for 10 minutes. Cells weretreated with 3% H2O2, biotin-strepavidin blocking kits (Vector), mouse IgG (M.O.M.kit, Vector) and then blocking buffer containing 4% BSA in PBS for 1 hour. Cellswere then incubated overnight at 4°C with anti-myogenin (hybridoma supernatant,diluted 1:10 in blocking buffer, F5D; Developmental Studies Hybridoma Bank),anti-eMyHC (hybridoma supernatant, neat, F1.652; Developmental StudiesHybridoma Bank) or appropriate IgG (diluted 1:100 in blocking buffer, Genetex).Following successive washes in PBS with 0.1% BSA, cells were incubated withdonkey anti-mouse IgG (Jackson ImmunoResearch) diluted 1:200 in PBS with 4%BSA for 1 hour. Following repeated washes in 0.1% BSA in PBS, the cells wereincubated in HRP-conjugated streptavidin (VectorLabs) for 30 minutes followed byvisualization with diaminobenzidene (DAB). All immunostaining was performed atroom temperature unless stated otherwise. Hybridoma cells were obtained from theDevelopmental Studies Hybridoma Bank developed under the auspices of the NICHDand maintained by the Department of Biological Sciences, University of Iowa, IowaCity, IA, USA.

Real-time RT-PCRTotal RNA was isolated using TRIzol reagent (Life Technologies). All RNA wasDNase treated (Invitrogen) and a portion of DNase-treated RNA was reversetranscribed. Real-time PCR was performed, and results were analyzed by using theiCycler iQ Real-Time Detection System and software (Bio-Rad). cDNA (1 l fromeach sample) was amplified by using gene-specific primers in a 96-wellSABiosciences chemokine array (Chemokines & Receptors PCR Array, Mouse,PAMM-022) and iQ SYBRgreen Supermix (Bio-Rad) in a 25 l reaction. Sampleswere incubated at 95°C for 4 minutes, followed by 40 cycles (30 seconds each) ofdenaturation, annealing, and extension at 95°C, 55°C and 72°C, respectively.SYBRgreen fluorescence was measured at the end of the extension step of eachcycle. All reactions were run in triplicate, and PCR product size was verified by meltcurve analysis. All samples were normalized using Hypoxanthine guaninephosphoribosyl transferase 1 (HPRT).

Cell-migration assaysMigration of muscle cells was quantified using time-lapse microscopy as described(Jansen and Pavlath, 2006). Briefly, cells were seeded at 2�105 cells per 35 mmdish, and switched to DM for the indicated times before imaging. Images wererecorded (QImaging Camera and OpenLab 3.1.4 software) every 5 minutes for 3hours. Cell velocities were calculated in m/hour using ImageJ software by trackingthe paths of mononucleated cells. Approximately 20 mononucleated cells weretracked for each experiment.

Boyden chamber assays were performed as described (Mylona et al., 2006).Primary myoblasts were seeded on 150-mm plates at low density (9�105 cells/plate)and switched to DM for 24 hours to generate myocytes in the absence of myotubeformation. Cells (7.5�104 cells in 200 l DM) were loaded in the upper wells of theBoyden chamber and incubated at 37°C for 5 hours. Migrated cells were fixed,stained and counted. HGF and PDGF were used at 100 ng/ml in DMEM with 1%BSA, SDF1 at 10-200 ng/ml in DM (Sigma). To prepare conditioned medium(CM), myoblasts were incubated in DM for 24 hours; the medium, which had been‘conditioned’ with secreted factors, was then collected, filtered (0.45 m), flashfrozen, and stored at –80°C until use.

SDF-1 ELISA assaySDF-1 was detected using the ELISA Kit for Mouse SDF-1 kit (RayBiotech).Conditioned medium was isolated as above. Crushed muscle extract (CME) wascreated as described (Chen and Quinn, 1992) using gastrocnemius muscles fromC57BL/6 mice (n10). Briefly, the muscles were dissected, pressed 7–10 times with

forceps, pooled, and incubated in TBS (Tris-buffered saline; 20 mM Tris-HCl, pH7.6, 137 mM NaCl; 1 ml TBS was used for the muscles of each mouse) for 90minutes at 4°C on a rotator. The extract was centrifuged at 176,000 g for 30 minutesfollowed by filtration through a 0.2 m filter and stored at –80°C. Proteinconcentration was determined using the Bradford assay (Bio-Rad) and equal amountsof protein were used.

StatisticsTo determine significance between two groups, comparisons were made usingStudent’s t-tests. Analyses of multiple groups were performed using a one-way ortwo-way analysis of variance with Bonferroni’s post test as appropriate. Statisticalanalyses were performed using GraphPad Prism 4.0 (GraphPad). For all statisticaltests, a confidence interval of P<0.05 was accepted for statistical significance.

We thank Matthew Randolph for help with control experiments.G.K.P. was supported by grants AR-047314, AR-051372, and AR-052730 from the National Institutes of Health and the MuscularDystrophy Association. C.A.G. was supported by National Institutesof Health training grant T32-GM08367. L.H.A. and K.K.L. weresupported by MDA Development grants. Deposited in PMC for releaseafter 12 months.

Supplementary material available online athttp://jcs.biologists.org/cgi/content/full/123/18/3052/DC1

ReferencesAbbott, K. L., Friday, B. B., Thaloor, D., Murphy, T. J. and Pavlath, G. K. (1998).

Activation and cellular localization of the cyclosporine A-sensitive transcription factorNF-AT in skeletal muscle cells. Mol. Biol. Cell 9, 2905-2916.

Allbrook, D. (1981). Skeletal muscle regeneration. Muscle Nerve 4, 234-245.Andres, V. and Walsh, K. (1996). Myogenin expression, cell cycle withdrawal, and

phenotypic differentiation are temporally separable events that precede cell fusion uponmyogenesis. J. Cell Biol. 132, 657-666.

Arnold, L., Henry, A., Poron, F., Baba-Amer, Y., van Rooijen, N., Plonquet, A., Gherardi,R. K. and Chazaud, B. (2007). Inflammatory monocytes recruited after skeletal muscleinjury switch into antiinflammatory macrophages to support myogenesis. J. Exp. Med.204, 1057-1069.

Asakura, A., Seale, P., Girgis-Gabardo, A. and Rudnicki, M. A. (2002). Myogenicspecification of side population cells in skeletal muscle. J. Cell Biol. 159, 123-134.

Bae, G. U., Gaio, U., Yang, Y. J., Lee, H. J., Kang, J. S. and Krauss, R. S. (2008).Regulation of myoblast motility and fusion by the CXCR4-associated sialomucin, CD164.J. Biol. Chem. 283, 8301-8309.

Baggiolini, M., Loetscher, P. and Moser, B. (1995). Interleukin-8 and the chemokinefamily. Int. J. Immunopharmacol. 17, 103-108.

Bischoff, R. (1986). A satellite cell mitogen from crushed adult muscle. Dev. Biol. 115,140-147.

Bischoff, R. (1997). Chemotaxis of skeletal muscle satellite cells. Dev. Dyn. 208, 505-515.Blanco-Bose, W. E., Yao, C. C., Kramer, R. H. and Blau, H. M. (2001). Purification of

mouse primary myoblasts based on alpha 7 integrin expression. Exp. Cell Res. 265, 212-220.

Bleul, C. C., Fuhlbrigge, R. C., Casasnovas, J. M., Aiuti, A. and Springer, T. A. (1996).A highly efficacious lymphocyte chemoattractant, stromal cell-derived factor 1 (SDF-1).J. Exp. Med. 184, 1101-1109.

Bondesen, B. A., Mills, S. T., Kegley, K. M. and Pavlath, G. K. (2004). The COX-2pathway is essential during early stages of skeletal muscle regeneration. Am. J. Physiol.Cell Physiol. 287, C475-C483.

Cerletti, M., Jurga, S., Witczak, C. A., Hirshman, M. F., Shadrach, J. L., Goodyear, L.J. and Wagers, A. J. (2008). Highly efficient, functional engraftment of skeletal musclestem cells in dystrophic muscles. Cell 134, 37-47.

Chazaud, B., Sonnet, C., Lafuste, P., Bassez, G., Rimaniol, A. C., Poron, F., Authier, F.J., Dreyfus, P. A. and Gherardi, R. K. (2003). Satellite cells attract monocytes and usemacrophages as a support to escape apoptosis and enhance muscle growth. J. Cell Biol.163, 1133-1143.

Chen, G. and Quinn, L. S. (1992). Partial characterization of skeletal myoblast mitogensin mouse crushed muscle extract. J. Cell Physiol. 153, 563-574.

Chen, H., Yong, W., Ren, S., Shen, W., He, Y., Cox, K. A., Zhu, W., Li, W., Soonpaa, M.,Payne, R. M. et al. (2006). Overexpression of bone morphogenetic protein 10 inmyocardium disrupts cardiac postnatal hypertrophic growth. J. Biol. Chem. 281, 27481-27491.

Chen, J., Crispin, J. C., Tedder, T. F., Dalle Lucca, J. and Tsokos, G. C. (2009). B cellscontribute to ischemia/reperfusion-mediated tissue injury. J. Autoimmun. 32, 195-200.

Chong, S. W., Nguyet, L. M., Jiang, Y. J. and Korzh, V. (2007). The chemokine Sdf-1 andits receptor Cxcr4 are required for formation of muscle in zebrafish. BMC Dev. Biol. 7,54.

Civatte, M., Bartoli, C., Schleinitz, N., Chetaille, B., Pellissier, J. F. and Figarella-Branger, D. (2005). Expression of the beta chemokines CCL3, CCL4, CCL5 and theirreceptors in idiopathic inflammatory myopathies. Neuropathol. Appl. Neurobiol. 31, 70-79.

Jour

nal o

f Cel

l Sci

ence

3060 Journal of Cell Science 123 (18)

Corti, S., Salani, S., Del Bo, R., Sironi, M., Strazzer, S., D’Angelo, M. G., Comi, G. P.,Bresolin, N. and Scarlato, G. (2001). Chemotactic factors enhance myogenic cellmigration across an endothelial monolayer. Exp. Cell Res. 268, 36-44.

De Clercq, E. (2005). Potential clinical applications of the CXCR4 antagonist bicyclamAMD3100. Mini Rev. Med. Chem. 5, 805-824.

De Rossi, M., Bernasconi, P., Baggi, F., de Waal Malefyt, R. and Mantegazza, R. (2000).Cytokines and chemokines are both expressed by human myoblasts: possible relevancefor the immune pathogenesis of muscle inflammation. Int. Immunol. 12, 1329-1335.

Demoule, A., Divangahi, M., Yahiaoui, L., Danialou, G., Gvozdic, D. and Petrof, B. J.(2009). Chemokine receptor and ligand upregulation in the diaphragm during endotoxemiaand Pseudomonas lung infection. Mediators Inflamm. 2009, 860565.

Echtermeyer, F., Schober, S., Poschl, E., von der Mark, H. and von der Mark, K. (1996).Specific induction of cell motility on laminin by alpha 7 integrin. J. Biol. Chem. 271,2071-2075.

Forde, S., Tye, B. J., Newey, S. E., Roubelakis, M., Smythe, J., McGuckin, C. P.,Pettengell, R. and Watt, S. M. (2007). Endolyn (CD164) modulates the CXCL12-mediated migration of umbilical cord blood CD133+ cells. Blood 109, 1825-1833.

Galvez, B. G., Sampaolesi, M., Brunelli, S., Covarello, D., Gavina, M., Rossi, B.,Constantin, G., Torrente, Y. and Cossu, G. (2006). Complete repair of dystrophicskeletal muscle by mesoangioblasts with enhanced migration ability. J. Cell Biol. 174,231-243.

Hill, E., Boontheekul, T. and Mooney, D. J. (2006). Designing scaffolds to enhancetransplanted myoblast survival and migration. Tissue Eng. 12, 1295-1304.

Hirata, A., Masuda, S., Tamura, T., Kai, K., Ojima, K., Fukase, A., Motoyoshi, K.,Kamakura, K., Miyagoe-Suzuki, Y. and Takeda, S. (2003). Expression profiling ofcytokines and related genes in regenerating skeletal muscle after cardiotoxin injection: arole for osteopontin. Am. J. Pathol. 163, 203-215.

Horsley, V., Friday, B. B., Matteson, S., Kegley, K. M., Gephart, J. and Pavlath, G. K.(2001). Regulation of the growth of multinucleated muscle cells by an NFATC2-dependentpathway. J. Cell Biol. 153, 329-338.

Horsley, V., Jansen, K. M., Mills, S. T. and Pavlath, G. K. (2003). IL-4 acts as a myoblastrecruitment factor during mammalian muscle growth. Cell 113, 483-494.

Isobe, T., Minoura, H., Tanaka, K., Shibahara, T., Hayashi, N. and Toyoda, N. (2002).The effect of RANTES on human sperm chemotaxis. Hum. Reprod. 17, 1441-1446.

Jansen, K. M. and Pavlath, G. K. (2006). Mannose receptor regulates myoblast motilityand muscle growth. J. Cell Biol. 174, 403-413.

Kafadar, K. A., Yi, L., Ahmad, Y., So, L., Rossi, F. and Pavlath, G. K. (2009). Sca-1expression is required for efficient remodeling of the extracellular matrix during skeletalmuscle regeneration. Dev. Biol. 326, 47-59.

Kang, J. S., Yi, M. J., Zhang, W., Feinleib, J. L., Cole, F. and Krauss, R. S. (2004).Netrins and neogenin promote myotube formation. J. Cell Biol. 167, 493-504.

Kim, C. H. (2004). Chemokine-chemokine receptor network in immune cell trafficking.Curr. Drug Targets Immune Endocr. Metabol. Disord. 4, 343-361.

Kim, C. H. (2005). The greater chemotactic network for lymphocyte trafficking: chemokinesand beyond. Curr. Opin. Hematol. 12, 298-304.

Krauss, R. S., Cole, F., Gaio, U., Takaesu, G., Zhang, W. and Kang, J. S. (2005). Closeencounters: regulation of vertebrate skeletal myogenesis by cell-cell contact. J. Cell Sci.118, 2355-2362.

Lafreniere, J. F., Mills, P., Bouchentouf, M. and Tremblay, J. P. (2006). Interleukin-4improves the migration of human myogenic precursor cells in vitro and in vivo. Exp. CellRes. 312, 1127-1141.

Lee, K. K., Wong, C. C., Webb, S. E., Tang, M. K., Leung, A. K., Kwok, P. F., Cai, D.Q. and Chan, K. M. (1999). Hepatocyte growth factor stimulates chemotactic responsein mouse embryonic limb myogenic cells in vitro. J. Exp. Zool. 283, 170-180.

Lluri, G. and Jaworski, D. M. (2005). Regulation of TIMP-2, MT1-MMP, and MMP-2expression during C2C12 differentiation. Muscle Nerve 32, 492-499.

Lluri, G., Langlois, G. D., Soloway, P. D. and Jaworski, D. M. (2008). Tissue inhibitor ofmetalloproteinase-2 (TIMP-2) regulates myogenesis and beta1 integrin expression invitro. Exp. Cell Res. 314, 11-24.

Loetscher, M., Gerber, B., Loetscher, P., Jones, S. A., Piali, L., Clark-Lewis, I., Baggiolini,M. and Moser, B. (1996). Chemokine receptor specific for IP10 and mig: structure,function, and expression in activated T-lymphocytes. J. Exp. Med. 184, 963-969.

Luster, A. D. (1998). Chemokines-chemotactic cytokines that mediate inflammation. N.Engl. J. Med. 338, 436-445.

McLennan, I. S. (1996). Degenerating and regenerating skeletal muscles contain severalsubpopulations of macrophages with distinct spatial and temporal distributions. J. Anat.188, 17-28.

Melchionna, R., Di Carlo, A., De Mori, R., Cappuzzello, C., Barberi, L., Musaro, A.,Cencioni, C., Fujii, N., Tamamura, H., Crescenzi, M. et al. (2010). Induction ofmyogenic differentiation by SDF-1 via CXCR4 and CXCR7 receptors. Muscle Nerve 41,828-835.

Mitchell, P. O. and Pavlath, G. K. (2001). A muscle precursor cell-dependent pathwaycontributes to muscle growth after atrophy. Am. J. Physiol. Cell Physiol. 281, C1706-C1715.

Miyazaki, H., Patel, V., Wang, H., Edmunds, R. K., Gutkind, J. S. and Yeudall, W. A.(2006). Down-regulation of CXCL5 inhibits squamous carcinogenesis. Cancer Res. 66,4279-4284.

Motohashi, N., Uezumi, A., Yada, E., Fukada, S., Fukushima, K., Imaizumi, K., Miyagoe-Suzuki, Y. and Takeda, S. (2008). Muscle CD31(–) CD45(–) side population cellspromote muscle regeneration by stimulating proliferation and migration of myoblasts.Am. J. Pathol. 173, 781-791.

Muciaccia, B., Padula, F., Gandini, L., Lenzi, A. and Stefanini, M. (2005a). HIV-1chemokine co-receptor CCR5 is expressed on the surface of human spermatozoa. Aids 19,1424-1426.

Muciaccia, B., Padula, F., Vicini, E., Gandini, L., Lenzi, A. and Stefanini, M. (2005b).Beta-chemokine receptors 5 and 3 are expressed on the head region of humanspermatozoon. FASEB J. 19, 2048-2050.

Mylona, E., Jones, K. A., Mills, S. T. and Pavlath, G. K. (2006). CD44 regulates myoblastmigration and differentiation. J. Cell Physiol. 209, 314-321.

O’Connor, R. S., Mills, S. T., Jones, K. A., Ho, S. N. and Pavlath, G. K. (2007). Acombinatorial role for NFAT5 in both myoblast migration and differentiation duringskeletal muscle myogenesis. J. Cell Sci. 120, 149-159.

O’Donnell, L. A., Agrawal, A., Sabnekar, P., Dichter, M. A., Lynch, D. R. and Kolson,D. L. (2007). Apelin, an endogenous neuronal peptide, protects hippocampal neuronsagainst excitotoxic injury. J. Neurochem. 102, 1905-1917.

Ocalan, M., Goodman, S. L., Kuhl, U., Hauschka, S. D. and von der Mark, K. (1988).Laminin alters cell shape and stimulates motility and proliferation of murine skeletalmyoblasts. Dev. Biol. 125, 158-167.

Odemis, V., Lamp, E., Pezeshki, G., Moepps, B., Schilling, K., Gierschik, P., Littman,D. R. and Engele, J. (2005). Mice deficient in the chemokine receptor CXCR4 exhibitimpaired limb innervation and myogenesis. Mol. Cell. Neurosci. 30, 494-505.

Odemis, V., Boosmann, K., Dieterlen, M. T. and Engele, J. (2007). The chemokine SDF1controls multiple steps of myogenesis through atypical PKC{zeta}. J. Cell Sci. 120, 4050-4059.

Olguin, H. C., Santander, C. and Brandan, E. (2003). Inhibition of myoblast migrationvia decorin expression is critical for normal skeletal muscle differentiation. Dev. Biol. 259,209-224.

Palumbo, R., Sampaolesi, M., De Marchis, F., Tonlorenzi, R., Colombetti, S., Mondino,A., Cossu, G. and Bianchi, M. E. (2004). Extracellular HMGB1, a signal of tissuedamage, induces mesoangioblast migration and proliferation. J. Cell Biol. 164, 441-449.

Peterson, J. M. and Pizza, F. X. (2009). Cytokines derived from cultured skeletal musclecells after mechanical strain promote neutrophil chemotaxis in vitro. J. Appl. Physiol. 106,130-137.

Porter, J. D., Guo, W., Merriam, A. P., Khanna, S., Cheng, G., Zhou, X., Andrade, F.H., Richmonds, C. and Kaminski, H. J. (2003). Persistent over-expression of specificCC class chemokines correlates with macrophage and T-cell recruitment in mdx skeletalmuscle. Neuromuscul. Disord. 13, 223-235.

Ratajczak, M. Z., Majka, M., Kucia, M., Drukala, J., Pietrzkowski, Z., Peiper, S. andJanowska-Wieczorek, A. (2003). Expression of functional CXCR4 by muscle satellitecells and secretion of SDF-1 by muscle-derived fibroblasts is associated with the presenceof both muscle progenitors in bone marrow and hematopoietic stem/progenitor cells inmuscles. Stem Cells 21, 363-371.

Relaix, F., Rocancourt, D., Mansouri, A. and Buckingham, M. (2005). A Pax3/Pax7-dependent population of skeletal muscle progenitor cells. Nature 435, 948-953.

Robertson, T. A., Maley, M. A., Grounds, M. D. and Papadimitriou, J. M. (1993). Therole of macrophages in skeletal muscle regeneration with particular reference to chemotaxis.Exp. Cell Res. 207, 321-331.

Sachidanandan, C., Sambasivan, R. and Dhawan, J. (2002). Tristetraprolin and LPS-inducible CXC chemokine are rapidly induced in presumptive satellite cells in responseto skeletal muscle injury. J. Cell Sci. 115, 2701-2712.

Schober, A. and Zernecke, A. (2007). Chemokines in vascular remodeling. Thromb.Haemost. 97, 730-737.

Schultz, E., Gibson, M. C. and Champion, T. (1978). Satellite cells are mitoticallyquiescent in mature mouse muscle: an EM and radioautographic study. J. Exp. Zool. 206,451-456.

Stebler, J., Spieler, D., Slanchev, K., Molyneaux, K. A., Richter, U., Cojocaru, V.,Tarabykin, V., Wylie, C., Kessel, M. and Raz, E. (2004). Primordial germ cell migrationin the chick and mouse embryo: the role of the chemokine SDF-1/CXCL12. Dev. Biol.272, 351-361.

Summan, M., McKinstry, M., Warren, G. L., Hulderman, T., Mishra, D., Brumbaugh,K., Luster, M. I. and Simeonova, P. P. (2003). Inflammatory mediators and skeletalmuscle injury: a DNA microarray analysis. J. Interferon. Cytokine Res. 23, 237-245.

Tanaka, K. K., Hall, J. K., Troy, A. A., Cornelison, D. D., Majka, S. M. and Olwin, B.B. (2009). Syndecan-4-expressing muscle progenitor cells in the SP engraft as satellitecells during muscle regeneration. Cell Stem Cell 4, 217-225.

Tidball, J. G. (2005). Inflammatory processes in muscle injury and repair. Am. J. Physiol.Regul. Integr. Comp. Physiol. 288, R345-R353.

Vandercappellen, J., Van Damme, J. and Struyf, S. (2008). The role of CXC chemokinesand their receptors in cancer. Cancer Lett. 267, 226-244.

Vasyutina, E., Stebler, J., Brand-Saberi, B., Schulz, S., Raz, E. and Birchmeier, C.(2005). CXCR4 and Gab1 cooperate to control the development of migrating muscleprogenitor cells. Genes Dev. 19, 2187-2198.

Warren, G. L., O’Farrell, L., Summan, M., Hulderman, T., Mishra, D., Luster, M. I.,Kuziel, W. A. and Simeonova, P. P. (2004). Role of CC chemokines in skeletal musclefunctional restoration after injury. Am J. Physiol. Cell Physiol. 286, C1031-C1036.

Warren, G. L., Hulderman, T., Mishra, D., Gao, X., Millecchia, L., O’Farrell, L.,Kuziel, W. A. and Simeonova, P. P. (2005). Chemokine receptor CCR2 involvement inskeletal muscle regeneration. FASEB J. 19, 413-415.

Weber, M., Uguccioni, M., Ochensberger, B., Baggiolini, M., Clark-Lewis, I. andDahinden, C. A. (1995). Monocyte chemotactic protein MCP-2 activates human basophiland eosinophil leukocytes similar to MCP-3. J. Immunol. 154, 4166-4172.

Yao, C. C., Ziober, B. L., Sutherland, A. E., Mendrick, D. L. and Kramer, R. H.(1996). Laminins promote the locomotion of skeletal myoblasts via the alpha 7 integrinreceptor. J. Cell Sci. 109, 3139-3150.

Yusuf, F., Rehimi, R., Morosan-Puopolo, G., Dai, F., Zhang, X. and Brand-Saberi, B.(2006). Inhibitors of CXCR4 affect the migration and fate of CXCR4+ progenitors inthe developing limb of chick embryos. Dev. Dyn. 235, 3007-3015.

Jour

nal o

f Cel

l Sci

ence