Cheek to Cheek: Genetic Discoveries and You · PDF file Cheek to Cheek: Genetic Discoveries...

Click here to load reader

  • date post

    09-Jun-2020
  • Category

    Documents

  • view

    3
  • download

    0

Embed Size (px)

Transcript of Cheek to Cheek: Genetic Discoveries and You · PDF file Cheek to Cheek: Genetic Discoveries...

  • Cheek to Cheek:

    Genetic Discoveries

    and You

    Stephanie A. Santorico, Ph.D.

    Professor

    Department of Mathematical & Statistical Sciences

    Human Medical Genetics and Genomics Program

    Stephanie.Santorico@ucdenver.edu

  • 2

  • Data Revolution

    3

    ~ 4

    00

    ~ 1

    3

    ~ 1

    00 ,0

    00

    ~ 5

    00 ,0

    00

    ~ 2

    ,5 00

    0, 00

    0

    ~ 3

    ,2 00

    ,0 00

    ,0 00

  • =

    4

  • 3,200,000,000 6

  • 7

    3 meters

    per CELL

  • 8

    2.0 × 1013 meters or

    70 trips to the

    sun and back

  • IDENTICAL D

    I

    F

    F

    E

    R

    E

    N

    T

    Humans are 99.9% genetically identical

    9

  • 10

    “We are more alike, my friends, than we are unalike.”

    ― Maya Angelou

  • 11

  • 12

    Alleles = A and G

    GENE

    G

    G

    My genotype = GG at location

    20,000

  • 13

    AGCGGGACCAGCCTGGGGCAGGAGACACCCACTGACTCGCACACCGCCTAATTCAGCCCGCGAAACCGAGTCAGCCCTAATTCCCCCGGCCCTGCACCCAACCAGGAGGCCAGCTAGGGCCCGGCGCCCAGCTGCGCGAGTCAAAGGCACCTCGAA

    GCCTACACGTCCTCACGAGCCACGGGCTCCAGGGCAGCGCCGACCCGCACGTTGCGCCGAAACTAACCACGCGGCACGGTGCATCGCGCTTAATCGCCCCCCCCGCGCCTCCCAAACGGCGCATCGGCGTACAGAGGCGACTAGCGGTGGGTCAGC

    CGGGCCCCCGAACGCCACCCCTGAAACGGCAGCAGGTAAACGCAAAGCCAACGGTCCCCGGTCTCGGCATAACGCCACACGTCGTCTTCTTCAAAGGGCAAAACCTAGCAGACTATCAGTCACTCAGCGAATTGGCCCCTCGGCCTGGCGAGAGAAC

    GGGCACAGGAGGTGGCGATACTTACACAAACACCGACAACACACGAACGTACCGCGAACCCCGCAAGTAACCGACCGCATCAGAGCGCGGGTGGACCCACCACCTGCACAGCACAGCCCACAACTGCGCCGGGGTGTCCGGGAGAGCCCACCACGC

    CAACAACCAGCCCACGCAAGTGACAGCCTCGCGGGAGACCCCTGACACGACGGAGTATACGGCGAAGCCAAAGTCCCCGACCCAGCCCTCAAGCGCTTCACCACGCATCACGGCATGCCACTAAGCATAACACTCTTCTGCAGCTGACACACCAGGC

    GCAAGCTTCGACCCGCCAGCCACAGCGACATACCGTAGCGAACCTCCCGCCCAGCAACTACGTCAACCCCCACCACGCCGGATTGAAAGCCACACGAACCGTATACAACTTCACACATTATACAAAACAACAACCAGCAGCCATCACCCTCTGAGCCC

    CAGGCCCAGCGGGAAGATTTAACCAGCCCAATAAAGTACCATAGCAGCCCACCTAACCGCACAGAAATGCAACAATACATCCAGCACTGTTCAGAGTCACCTCCCTTAGCGAGTGTCACCAGAACAACGGAACCAACGAACGCAGGGCCACTTACCAC

    CGACAGGACCGGCAGGTCTAACAGGGTAACGTGACCTACCCACTCCTAATCCCGACAAACACACCACCTCACTAACATGGCGTCCGGAGGGGCACAACGAGCAAATAGACCCACCAAGGATACACAGGTACGACGAACAGGATTGATAACAGACCGC

    GTGATAAATATGACCAAGCAAGCAAACCAGGACCCGGATTCCGCCGCACTACCATCGGCCGGGGGTCTTTAGACGTAGCACAGGCACCGAAGAAACCGGCCCCCAGGGCCGACACCACCCCCACGACCCCATTGTGTTCCGCTGGGTGATAAACGTT

    AGCTTAGTGTCCGCATGCGCCATGGCTGGCAACACCCACGTCAGAGCAGAGTCGAAGTCCAGCCAACAACACGGAAACGATGACAAAAACATAACACCAGCATCCCCGTCCGGACCCCTCGCGACCCAAAGGCAGAAATACACCACGGCACCCCAAC

    CGGCGAAGCTCCTCCACCCCCCTTAACCCTATATCAGCCTAGAAAAGCACTGCTGGCAAAGTCAGCCTTAAACCCATCGATTCAGCCCAACATCCCCTCAGCAGACGTAGCGCCCAAGCAAGACGAAAAGCTCAGGCCTTGAGATGCCAATCCTGTAC

    AGAGCGACGCGCCTGCGCCGACCGCGCGCCGCGACAAGGCCCACGCCGACCTAACTATACCCAATIGACGGACDGAATAIGTGACGCCGGGACCCCAACACCCGCTGACCCCACAGACAAAACAAATAAGTAAGGACCACGCAACGCAGACCGGAGC

    TATGACTCAAAAATCAAAGACGGTACACCCTCCATCTTAGCCGCCCACAATCAACCAACCTCGCCACACGAATCGACCGCAAAGAAGTCCCCCACTCCCTGCCTCGTCCCAAACGGACACCCCCGGGCACCGAACCTCACATCGCCGATAGCAAACGG

    CACAGGGTTGCCACATCCGTTATCACTACGCTACCAACAACCAGAAAGGATGGCCGCGCGTAATACGCAAAATTCAATGTGCGTAGAGCATGGACTCCCCGCATACTGCCTAATACCAGCAAAGGGGACCGGCGACTTGCAGAGTCATGACCAGGTTA

    ACAGACGTCCGTGTATCCTCATCCACATCAGAAGTCTACTGCTACGGCGTTGCTACCGCAACCGCGAGTCTCGGAGATTGAAAGGTTTCAGACCCAAAGCCTACGTGGGCCGAAACGAACAACCGAGCACAATGTCAAGTACCCAGGGGCGAAATTTC

    CGGAGCCAAAGGCAGCAGTGTGGCGGAGCACGCGCACGTACATAACGAAACAACGCCTGACAATCACAGGCCAGGCCCACAGGAGTGACAGCATTAGCGAGCCACCGACAAGGATAATGGAAATTCCGAGGACGAAGTGGGAGGGCAACAACGCGC

    CAAGGCCTTGCAGCGCGCCGAGCTCTCAATAGTTCGCGCCTCGCCCGATCCACGGTAAAGATACGCAGGGCAGGTCGCGGCCCCATGCCGTCGCTAGTGAATGGATTAACGCAACTTAGCGCACACCCATTCGTCACCACCAGTCGCCCTACGGGCC

    GGCTCCTCTTCTGCAGGATCGCGCGACAGCCGACGAAAAGGAACACCTAAACCCAATCGGGCACAAGACCGACGAGTCGTACTCCCTAACCAACTACCGGCAGTTATCGGCTAAATTCCCTAACCACGCGTAGCAATGACGCCTGCGCCAACTGAAAC

    CGCCAGCGCCCGCGCATGTTGCTATGCACGACTCATCCGAACAAGAGGAACCATGCGAGAGGTACACACCACCGCCCCCGAAACCCCGAAGGCACGGCATTGGCAAGAGGAATTTAGGAGGATCGTGCTAGCCCCGCGTGAAGTTACAGACGACAGA

    CGCCAACGCAAAAACAGATCCGACATAACAGCAAAATGTAGGTCAACCAAAGTAGGATACGGCCGGACTTGGGCTAGGTTAACGCCAATGCAGCAAAGAAGAGGAAGACTACACGGCCATTACCAGCCGAGCCGACGCTAATGGCACAGCGAAACAG

    CGTGCCTTACGTTGCCTCTCGGCAAAGACGGAAACAACCGAATGAGAAAGTGAGGAAAACCACAATGGTTTATGAAGGCCACCTTCGAACAAAACGTTCCCGGGAGGCTAGAGAGTCGCATCGGTAAATGGGTTTCCACCAAAACGCAGAACAACTCA

    CAGGATGATAAGAAGATTGAATAGAGTCAAAGTTCCACGAGCCTCGAGCACATAATACGGGGCTAACCGTCACGCATGGGGGAGAACTCCGTTAAGATTTTTTCTTGACAGTGAAGAAAAGTAAAACAAAAAAATCACGACAGGGCGAGAGCAACGAA

    GGGGACCTCACAAGCAACTCTCCTGATGCCTATCTGACACCAGCCCGCCATACCAGCAATCATGTTAGAGGGCCTCCAACCGCCGGTCCGTCCCACACCGATGGGACCTCCCACGGGCGCAAGACCTCGCGACGTTCTCGCTGACGTACTGCGAAGA

    GATCCGTGCACATCGACCCGCCTGGCAAGCCGGCCCCGACGACATGCTAGCTTCACGCCGTGCAGCGCCGTCGCTCGGCCACACCAACTGACTGACCACCCCCCGACTACCCCGCTGTATCCTCTACTGCGCCGACAGTGGAACCGATGAAACTCAA

    ACAGGTCCCAATGAAAGTCAAGACTGCCCAAACCGTCCATCATAAGAGAAACTCAATACCCCCGACGACCCATCCAGCCCCATACCCACCCAAAGGGAAACCATGTCCTGCTCGCGGCGGACACTAAAGCGATCAGGACCCAGTCCATCCCGTTTGAG

    TCGATAAACACCCAGAACCGACAAACCTCACACACTCCAAGGACTGAAGAACTGAGAAATACCGACCCAGGAAGCCTTCGCGTTGTGCACTCCACTGCAATCAACAGCCTACATGGATTCGTACGGCACTGTCAAGCACATGCTCTCTGCGACTTCAG

    CAAATGCGAAGACGTAAATCTACAGGCACCTGGATTTCGCAGCAACAAGCCTAGAGGTGTCCGACAGCCTCATGGTATCAACCCCGACGTGTCCCCCAGGCTCGCATGGCAGTTCCGGATCCCAAGGACCAATAGTCCACACGCCACTAGTTCGAATG

    TTGCAGCAGCATCGGCAAAACCAACGAAAAACCACACCTCGGTGGTGTAAGCGCCGGACGGGTACCCCACACGACCCGGTCTTGTCCACATGGAAAGTACGAATGGAACTCGCATCTGACAGCCATAGACCGGTCCCAGCAACGCTACGGGGGCAAC

    GCACCCAGACCGAAATCTCTAACCTAAATCTCCAACAAAGAACATGCCAGTAAAAGGTGAACAACCGCCGTCATCAGCCTACAGCTATCGATATTGCCGTAGCGGGATCATCCCCAAACGCGGGCGGCATCAATGGGAAATGCCGGAAATCCACATAC

    CTGGACGCGCTCGGCGGCCTCGACCCCAGGACTCAAACACCCATACAGCTCGGTCCCCGCTCGGGACAGTAGTAAACGGAAACCGTGCACACTAGACCCGCCTCCAGAAGCTCGTCAAGCCTAGTAGGTAATACCAACGCACCTCAGAGATGAGGGC

    GGTAAGTGCCTTTCCGGCAAGAATCGCTAAACCCCGCACGCCGTGICCCGACGCCCCCGGCGGAAGGATGTGGCGGGCACTTGGGTACGTCCIADDAIGAGGAACGCCTGGTTTGACCGGGACTTATGCGACGCTCGGGGGAACCCCATTGCCTCGGT

    AGGTCGAAAGCGACTAGGGTCCCGATCGGGCTTGTCGTTGCGCTGTACCTGATCGCCAAACCCGAGCTACACCGGCCAGCCACCTATCACCTCCGCAGGCGTGACGCCCGGGCGAGCGCCCACGACCAGGGCCCGACGCAACATTGCGATGGCGCC

    GCGTGCGCGAATGTACCCGGGTTAAGGTCAAAGCCGTAGCCAAGTGGGCGGTCCGAGGGGCGGAAGAGIACACTAAAGCTGGGCCCGGACCGGCGACCAGCAGCGTGAGAGTCCCCCAATACTTCGTTGACGGTACATCAAGCCGCGCACCCCGAAG

    GCACCAGGAGTAAGCAGCATGACACCAGCAACGCTACCAGACCCACATGCAGCGTCGCCGTGGCGACTCTCTCCCATGTTCCCCCCAACACCAATAATAGGCAGCCAGGCCAAAAATGACTGATGCTATGACGCCCTCCGGCCCAAATGGAGAGAAA

    CCCCCCGGAGCAGCATCAGTGGGCCCGCCTCAAAGGACCAACCCCGAGGCCCCCTCTTTGCCACCGACAGCAGCGAGGCACCGAAACCTACTAGGCGTTCGTCCAAACGTAGGTAAAGACATCTGCGCACCAGTTTTGCACGACTAAAAGGAATTGT

    ACAGGGGCCATACCCCCAAACACCAATGACGGCTTCTTGCCTTACCCCGGGGGGTCCTGCGCACGCTTCGAGCCAATCCCCCACCGCTCAAGAACCTACCAACAACCCCCACGAGCGCCAAACACCCTACAAATACGAGACACACGCGAACGGTACC

    GGTCAGCCCCTTCGGACCAAATCCCCGACCTAAGCACTACCTCAACAAAGCAAAACCCCCAGGGCAACACCCACGTACAAAATATGAAAACGCGGTAAATCCGTCACAGCCCTAACTATTGTTAGGAGGGGTGTGGACGCACACTGCCCCGGGAGATA

    TAGGATGAGTCGCCTATCGAAGCATGCGCCACGCTCCCTCTGGGTCGGCAAAGCGGCTGGTCGTGGAATATGGCCCCGGGGTGCGGTGGTGTGAACCGCCCTCGAGCCAGCACGCTTCTAAACACCCCAGTGGATCGTCGGACAAAGACGCGAGTA

    GAGCACAAATCCGGCGCAGAAAGCGAAAGGGCCGGCCAACAAAAACACTAGAAACCCACCCGGACAGAAGTTGGGGCGGGAAAGGCAAATTCGGAACTCCCGTAGTACGTCAGTTCTCCGCGAGACTGCAATTCAGCAAACGCAGACTGGAGCACAA

    ACGACGTCATACCCTCGCGGGCTCGCACGGCCAGGGGTGGAACACCACCTGCAGGCCTGTACAGAGATCGGGCGGTCCGGTCICCCCCACCCCCCTCACGAGAACATTCAAACGGATACATGGGACTCGATGGCCCACAGAAACATACAGGACTGCG

    GCACTGCGCGCTACCCGCAGACAAACCCGCCCCAATAAAAAACCGGACATCGTTCCCTGGCTTGCGACTATAAGTCGCGACGACAAAACTCTTTGCATCGGGCTCGCAGACAGATCTGCGAACCGCTCGCCCGCAATAGACGGGAGATGTATCACGTC

    AGTAGCCCGCGTTGCGGACAACAACGAGACCCCGAACAAAAAGACGACACGAAACCCCAGGGGCACCGCAGAACTAGTATACCAACGTGACCCCCGCGACCAGAACCCAAGCCTCTCCTTGGGGCCTCAATTGTAATATACAGATGACCGACAACAG

    ACACCACAGTCGCCTCAGTTTCCCGGCGTAAAACAGCAGCCCTGATCCCTGCAGAACGCACGTGTCTAAACTAGCATCAGAGAACGCACCACAGCATGTGCCCTCAAATTGCCCAAGGGGCCCGAGTCCCTTCGTTGCGTTCACCGGCCACTCGGCCC

    GCTCACTCAAGACGACCCTGGACATCTACGAGAAAAAGCCAGGCCAATAAGCCGATAAAACCCACGTCAATAAAGGCGCGGAACCGTCGGGCACCACCGCCGGCCGACGAGCTCCCGACTTCAACCACGCAAACACCTAAGAACTAAACCAGCACAT

    A

  • 14

  • 15

  • 16

    GG GG AG AG AA AA AG AA AG AA

    Do individuals with a history of heart disease have

    genotypes that differ from those without heart disease?

  • ~35,000 individuals with coronary artery disease compared to

    ~260,000 individuals without coronary artery disease*

    17

    Number of alleles seen in individuals :

    Allele at rs4977574 Coronary Artery

    Disease

    Healthy

    Controls

    G 36,995 31,907

    A 256,744 267,224

    Frequency of G in CAD = 36,995

    (36,995+256,744) = 0.13 Frequency of G in Controls =

    31,907

    (31,907+267,224) = 0.11

    This difference in frequency is highly unlikely to occur by chance.

    * Motivated by van der Harst and Verweij, 2018: https://goo.gl/CS1vYr

  • = Probability of disease for your genotype

    Probability of disease for a reference group

    Relative Risk

  • My relative risk for

    my genotype at

    rs4977574 is ~1.5

  • For women of my age, ~5% have coronary artery disease

     my risk is ~7%

    Putting risk in context…

    20

    rs4977574