CHARACTERIZATION OF PESTALOTIOPSIS MICROSPORA … · Purification Kit, (Fermentas Life Sciences,...
Transcript of CHARACTERIZATION OF PESTALOTIOPSIS MICROSPORA … · Purification Kit, (Fermentas Life Sciences,...
![Page 1: CHARACTERIZATION OF PESTALOTIOPSIS MICROSPORA … · Purification Kit, (Fermentas Life Sciences, Malaysia)and used for sequencinq at First Base Laboratories Sdn. Bh, Selangor Malaysia.](https://reader033.fdocuments.net/reader033/viewer/2022041713/5e4920dcc3d9504b71059bc6/html5/thumbnails/1.jpg)
436
CHARACTERIZATION OF PESTALOTIOPSIS
MICROSPORA, CAUSAL AGENT OF LEAF BLIGHT ON RUBBER
(HEVEA BRASILIENSIS) IN CAMEROON
Aurelie I. C. Nyaka Ngobisa1,2*
, P. A. Owona Ndongo2,
Oumar Doungous2, Godswill Ntsomboh-Ntsefong
2,3, S. W Njonje
2, and
E. E. Ehabe2
1Research officer & Plant pathologist,Regional Chief of Centre - Research and
Innovation for the Littoral, Douala – Cameroon
*E-mail: [email protected](Corresponding Author) 2Institute of Agricultural Research for Development (IRAD), Cameroon
3Department of Plant Biology, Faculty of Science, University of Yaounde I, Cameroon
Abstract
Rubber tree (Hevea brasiliensis) is the only commercial source of natural rubber
in Cameroon. Its cultivation can be severely limited by diseases A leaf blight disease was
observed on rubber trees affecting 80% of plants in smallholder's fields in South West
Cameroon. Symptomatic leaf samples were collected from infected plants and pathogens
isolated from them on agar media. Single spore isolates from resulting colonies were
identified as Pestalotiopsis microspora based on cultural and morphological
characterisation. Culture media, incubation temperature and pH affected mycelial
growth of P. microspora. Its inoculation on detached leaflets also revealed the
pathogenic capacity of this fungus; re-isolation based on its symptoms confirmed Koch’s
postulates. Morphological identification was confirmed by molecular sequence analysis
of the Internal Transcribed Spacer (ITS) region 1 and 2 including 5.8S rDNA (ITS-5.8S-
ITS2). The effects of some fungicides were tested in vitro on P. microspora mycelial
growth. Banko plus fungicide (Chlorothalonil 550g/l + Carbendazim 100g/l), Penncoz
(Mancozeb 800g/kg) and Metalm 72 WP (Cuprous oxide 600g/kg + Metalaxyl 120g/kg)
tested at different concentrations (100%, 75%, 50% and 25%) revealed inhibitory
activity against P. microspora in vitro. Among these fungicides, a marked efficiency of
chlorothalonil 550g/l was observed, though the inhibition of mycelial growth was more
effective with Cuprous oxide 600g/kg + Metalaxyl 120g/kg at rates: 100%, 75% and
50% only. This study revealed that P. microspora is the causative agent of new leaf
blight on rubber in the South West Region of Cameroon. This is the first report of leaf
blight caused by P. microspora on rubber in Cameroon.
Keywords: Pestalotiopsis microspora, Internal transcribed spacer, pathogenicity,
rubber, leaf blight.
INTRODUCTION
The Pará rubber tree (Hevea brasiliensis), most commonly known
as rubber tree, is a perennial plant, widely grown for its rubber-containing
latex and for wood. It is widely cultivated in South East Asia and West
and Central Africa, including the South West region of Cameroon
![Page 2: CHARACTERIZATION OF PESTALOTIOPSIS MICROSPORA … · Purification Kit, (Fermentas Life Sciences, Malaysia)and used for sequencinq at First Base Laboratories Sdn. Bh, Selangor Malaysia.](https://reader033.fdocuments.net/reader033/viewer/2022041713/5e4920dcc3d9504b71059bc6/html5/thumbnails/2.jpg)
Characterization of pestalotiopsis microspora, causal agent of leaf blight on
437
(Owona Ndongo et al., 2010). Rubber tree contributes significantly to
the in come of thousands of smallholder farmers (Omorusi,
2012). Cameroon is ranked third in Africa and fourteenth in the world
among exporting countries of natural rubber in 2015 with 0.6% of the
total exports (Workman, 2016).
Rubber productivity is compromised by economically important
fungal diseases such as Corynespora leaf fall, Colletotricum leaf disease,
leaf spot diseases and red and white root diseases (Wastie, 1969; Senechal
and Gohet, 1986; Jayasinghe, 2011). Rubber is also the target for specific
parasitic plants belonging to the Loranthaceae family (Pinard, 1994).
Among them, leaf blight is becoming a serious canopy disease on rubber
trees in South West Cameroon. In the course of a disease survey
conducted in 2013, leaf blight was observed on some rubber trees in two
smallholder farms at Muyuka and Malende in the South West region of
Cameroon with disease incidence varying between 10 and 38%.
Rubber is a deciduous tree that loses its leaves in February-March,
in South west Cameroon Refoliation begins with the start of the rainy
season, which coincides with favourable conditions for the development
the pathogens. The young leaves attacked by the pathogen are injured.
They fall and are replaced by new leaves which in turn get infected and
fall off all along the epidemic duration. The disease begins with solitary
brown to greyish spots on the leaves, preferably in the leaf margins or
space between veins(>70%). These spots converge into one or several
necrotic patches. Minor symptoms appear showing yellowing of leaf
edges and thick brown spots (Fig.1). The first symptoms were noted in
early May, as small spots on the young leaf margin or leaf tips, usually
grey at the beginning, turning dark-brown at a later stage, with an oval or
irregular shape (0.1 to 0.5 cm) and a yellowish halo surrounding each
lesion. Between June and July, lesions expanded, merged and coalesced
to form leaf blight during the rainy season, causing necrosis of the entire
leaf tissue in severely infected plants. Leaf blight lesions which are
prominent on fully expended leaves resemble anthracnose
(Colletotrichum gloeosporiodes).
Despite its increasing significance, nothing is known about the
etiology of this emerging disease. The objective of the present study was
therefore, to identify the causal agent of leaf blight of rubber in
Cameroon, and thepossible chemical control method. To achieve this
objective, the pathogen was isolated from symptomatic tissues and
characterized morphologically and by DNA barcoding. Pathogenicity was
![Page 3: CHARACTERIZATION OF PESTALOTIOPSIS MICROSPORA … · Purification Kit, (Fermentas Life Sciences, Malaysia)and used for sequencinq at First Base Laboratories Sdn. Bh, Selangor Malaysia.](https://reader033.fdocuments.net/reader033/viewer/2022041713/5e4920dcc3d9504b71059bc6/html5/thumbnails/3.jpg)
Proceedings of International Rubber Conference 2017
438
confirmed by satisfyingKoch’s postulates, associating the pathogen to the
observed symptoms. In vitro antifungal activity of some fungicides
against the mycelial growth of the pathogen was tested.
MATERIALS AND METHODS
Pathogen Isolation
Isolates were obtained from diseased leaves of rubber trees showing
typical symptoms of blight in two different fields at Muyuka and Malende
in the South West Region of Cameroon. Leafsamples were collectedfrom
infected treesin the field, placed in bags and transported to IRAD rubber
research laboratory in Ekona where they were processed the following
day for fungal isolation. Pieces of leaf tissue, ~5 mm2, were cut from the
edges of blight lesions, surface-disinfected by immersion in 0.1% sodium
hypochlorite (NAOCl) for 1 min, rinsed three times with sterile distilled
water and inoculated onto potato dextrose agar (PDA) plates. The plates
were incubated at 25 °C, under continuous and constant fluorescent
light according to Sanjay (2004). The putative pathogens were isolated as
single hyphae emerging from the disinfected leaf tissue. Isolates were
further purified by sub culturing from single conidia or hyphal tips and
preserved at 25 °C.
Six-day-old cultures were scraped, sealed in Petri dishes and kept
under continuous light to induce sporulation. After twelve days, 10 ml of
sterile distilled water were added on each of the Petri dishes, and slowly
swirled for three to five minutes. Conidia length and width were assessed
from a sample of fungal conidial suspension in 3mL sterile distilled water
and pipetted onto a microscope slide. The length and width of 30 conidia
and conidiophores per isolate were examined under a light microscope
with a micrometer at 40X magnification (Nikon Model Eclipse E200).
Molecular Studies
DNA Barcoding
Mycelia plugs of a 10-day-old culture of one isolate per farm,
proven to be virulent were used for DNA extraction. They were grown at
26 °C, transferred into Erlenmeyer flasks containing 50 mL Difco PBD
(24g/litre). The flasks were shaken at 80 rpm at room temperature (28 ±
2 °C) for 5 days by using an orbital shaker. The mycelia were filtered
through a layer of cheesecloth and washed twice with distilled water.
![Page 4: CHARACTERIZATION OF PESTALOTIOPSIS MICROSPORA … · Purification Kit, (Fermentas Life Sciences, Malaysia)and used for sequencinq at First Base Laboratories Sdn. Bh, Selangor Malaysia.](https://reader033.fdocuments.net/reader033/viewer/2022041713/5e4920dcc3d9504b71059bc6/html5/thumbnails/4.jpg)
Characterization of pestalotiopsis microspora, causal agent of leaf blight on
439
Dried mycelia (250 mg) were mechanically grounded to a fine powder in
liquid nitrogen by using a pre-chilled mortar and pestle, then transferred
to 1.5 ml micro centrifuge tube. DNA extraction was performed using
CTAB modified method described by Dole and Doyle (1987). A volume
of 5mL pre-heated extraction buffer (2% w/v CTAB, 100mM Tris-HCl
pH 8.0, 20mM EDTA pH 8.0, 1.4 M NaCl)and incubated at 65 °C for 1 h
with occasional swirling, followed by adding an equal volume of phenol:
chloroform: isoamyl alcohol (25:24:1). The tube was inverted gently and
centrifuged at 10,000 rpm for 10 min. The aqueous (upper) phase was
transferred into a fresh, sterile 1.5ml micro centrifuge tube. DNA was
precipitated by adding 0.6 volumes of cold isopropanol, then slowly
swirling the tube and incubated at -20 °C
for 1h. After centrifuging at
10,000 rpm for 10 min at 4 °C, the supernatant was decanted and the
DNA was washed with 70% ethanol and air dried at room temperature.
DNA pellet was dissolved in 50 µl sterile distilled water and stored at -20
°C. The concentration of the resulting DNA was determined using an ND-
1000 spectrophotometer (NanoDrop 2000; Thermo Scientific, USA).
Integrity of the extracted DNA was checked by gel electrophoresis with 2
% agarose gel under 1x TAE buffer (40mM Tris, 20mM acetic acid and
1mM EDTA) at 70 V for 45 min at room temperature (Sambrook et al.,
1989). The molecular weight of the extracted genomic DNA was
estimated by comparison with a 1kb DNA Ladder (0.25-10 kb) marker
(Fermentas). The original DNA was then diluted in sterile distilled water
to a concentration of 1 µg/µL and used for further observations.
Polymerase Chain Reaction Amplification
The oligonucleotide primers
ITS1(5′TCCGTAGGTGAACCTGCGG3′) and ITS4
(5′TCCTCCGCTTATTGATATGC3′) (White et al., 1990) were used to
amplify and sequence the internal transcribed spacer regions (ITS1 and
ITS2) as well as the complete 5.8S gene. To amplify each gene region,
polymerase chain reaction (PCR) mixtures consisting of the following
components were used: 1 µL of each primer (10 mM); 0.5 µL dNTPs (10
mM); 2 µL of MgCl2 (25 mM); 2.5 µL of 10 mM reaction buffer
containing MgCl2 (25 mM, Fermentas, USA); 0.5 U of Taq polymerase
(Vivantis, Shah Alam, USA); 5 µL of DNA; and 12.5 µL of sterile
distilled water. The following amplification conditions were used: for ITS
region, initial denaturation at 94 °C for 3 min; 35 cycles of denaturation at
94 °C for 1 min, annealing at 60 °C for 1 min, and extension at 72 °C for
2 min; and a final extension at 72 °C for 10 min.
![Page 5: CHARACTERIZATION OF PESTALOTIOPSIS MICROSPORA … · Purification Kit, (Fermentas Life Sciences, Malaysia)and used for sequencinq at First Base Laboratories Sdn. Bh, Selangor Malaysia.](https://reader033.fdocuments.net/reader033/viewer/2022041713/5e4920dcc3d9504b71059bc6/html5/thumbnails/5.jpg)
Proceedings of International Rubber Conference 2017
440
DNA Sequencing and Analyses
PCR products were purified using Gene JETTM
Commercial PCR
Purification Kit, (Fermentas Life Sciences, Malaysia)and used for
sequencinq at First Base Laboratories Sdn. Bh, Selangor Malaysia. PCR
products (5 µL) form one representative isolate from each farm were run
on 2% agarose gels in a 1× TAE buffer solution (40 mM Tris, 20 mM
acetic acid, and 1 mM EDTA) at 80 V for 45 min at room temperature.
The gel was stained with ethidium bromide, and the bands were
visualized under UV light and photographed using a gel documentation
system (GeneSnap, ver 6.03, Syngene Laboratories). The size of the
amplified DNA fragment was determined using molecular weight
markers (GeneRuler 100 bp DNA Ladder and 1 kb DNA ladder marker
[Fermentas, USA]).
Sequences of isolates from this study and other species
of Pestalotiopsis retrieved from the GenBank were aligned using Clustal
W (Thompson et al., 1994) and manually adjusted as required.
Phylogenetic analysis was done using the maximum likelihood method, in
Jukes-Cantor model (Mega, version 5), with bootsrap of 1000 replicates
(Tamara et al., 2011). Pseudopestalotiopsis cocos was used as an
outgroup taxon. A sample was prepared and sent to the International
Collection of Microorganisms from Plants (ICMP) in New Zealand for
identification and conservation.
Pathogenicity Test
Following modified method by Ismail and Indran (1999), detached
leaflets of rubber (Hevea brasiliensis) clone GT1 at limp green stage were
floated on water in 15-cm-diameter Petri dishes. For inoculation, spore
suspensions of a morphologically identified representative isolate were
prepared from a 12-day-old culturegrown on PDA plate, and the
concentration was adjusted at 3 x 105
spores /ml using haemocytometer.
The leaflets were inoculated using micro-pipettes by placing droplets of
the spore suspension onto the abaxial side, and placed in humid condition
(20 °C), with 70% - 80% relative humidity under continuous fluorescent
light. Three replicates of leaves were used and control leaves were
inoculated with distilled water. Scoring of the intensity of necrotic lesion
size was carried out 20 days after application of treatments. The severity
of the infection was rated based on the size of the lesion. Scoring of the
intensity of necrotic lesions was done according to Manju et al. (1999)
following a five levels grading scale with 0 = leaves without lesion, 1 = 1-
![Page 6: CHARACTERIZATION OF PESTALOTIOPSIS MICROSPORA … · Purification Kit, (Fermentas Life Sciences, Malaysia)and used for sequencinq at First Base Laboratories Sdn. Bh, Selangor Malaysia.](https://reader033.fdocuments.net/reader033/viewer/2022041713/5e4920dcc3d9504b71059bc6/html5/thumbnails/6.jpg)
Characterization of pestalotiopsis microspora, causal agent of leaf blight on
441
25% lesion (light symptom), 2 = 25-50% lesion (moderate symptom), 3 =
50-75% lesion (severe symptom); 4 = 75-100% (very severe symptom).
Lesions were observed upon the appearance of the blight on the leaves
therefore confirming the Koch's postulate.
Fungicide Test
The fungal activity test consisted in measuring the mycelial growth
of P. microspora in the Petri dishes after every 24 hours until the
mycelium filled the dish. The PDA culture medium at pH 6 (Seutio et al.,
2016) was sterilized by autoclaving at 121 °C under a pressure of one bar
for 30 min. After allowing to cool, synthetic fungicides were incorporated
(Chlorothalonil 550 g/l + Carbendazim 100 g/l ,Mancozeb 800 g/kg and
Cuprous oxide 600g/kg+Metalaxyl 120g/kg) in different concentrations
(25, 50, 75 and 100%) and stirred with a magnetic stirrer. This was then
poured into Petri dishes (diameter 7 cm) under the hood in the presence of
a flame from a Bunsen burner.
The different concentrations were obtained by the following dilution
formula:
CiVi = CfVf ; the concentration was expressed as a percentage.
When the culture media were cooled and solidified, a 5 mm
diameter fragment from a 7-day old culture of P. microspora was
deposited in the center of each Petri dish in four replicates for each
concentration of fungicide. The incubation period after seeding was 6
days. The Petri dishes were incubated in an oven at 25 ° C. The control
was maintained under the same conditions without fungicides.
Statistical Analysis
The quantitative data obtained was subjected to an analysis of
variance (ANOVA) and the means were separated by the test of the least
significant difference of Student at 5%.
![Page 7: CHARACTERIZATION OF PESTALOTIOPSIS MICROSPORA … · Purification Kit, (Fermentas Life Sciences, Malaysia)and used for sequencinq at First Base Laboratories Sdn. Bh, Selangor Malaysia.](https://reader033.fdocuments.net/reader033/viewer/2022041713/5e4920dcc3d9504b71059bc6/html5/thumbnails/7.jpg)
Proceedings of International Rubber Conference 2017
442
RESULTS AND DISCUSSION
Isolation and Purification
The symptoms of leaf blight are shown in Fig. 1 as initially
observed on rubber plants in the field. In order to identify the causal agent
of this blight, isolates were obtained from leaf samples collected from the
field.
Figure 1. Leaf blight symptoms of Pestalotiopsis microspora initially observed on
rubber in the field in South West Cameroon
The fungus collected from the field and cultured on the Petri dish
formed zonate and branched white cottony colonies with black acervuli
containing dark pigmented spores. Macroscopic observation of the culture
showed a fluffy appearance with a flat, large and circular shape.
The colour was whit for the first 5 days, becoming creamy white
after 8 days (Fig 2a). The microscopic analysis presented conidia as
fusoid, ellipsoid straight to slightly curved (20- 30 x 6.5 – 8.5 µm) with
four septa (Fig. 2b). Two to four hyaline filamentous apical appendages
(mostly three, 15.5- 26.5 µm) were attached to each apical cell hyaline
sub-cylindrical, thin-walled, and one 3 – 7 µm long hyaline appendage
attached to each basal cell. The length varied from 20.15 µm to 30 µm
and the width from 5.8 µm to 9.88 µm. Cells with single apical
appendages ranged from 2.7 to 6.9 µm. These two isolates had been
initially identified as belonging to Pestalotiopsis genus by morphological
observation of conidia (Maharachchikumbura et al, 2014).
![Page 8: CHARACTERIZATION OF PESTALOTIOPSIS MICROSPORA … · Purification Kit, (Fermentas Life Sciences, Malaysia)and used for sequencinq at First Base Laboratories Sdn. Bh, Selangor Malaysia.](https://reader033.fdocuments.net/reader033/viewer/2022041713/5e4920dcc3d9504b71059bc6/html5/thumbnails/8.jpg)
Characterization of pestalotiopsis microspora, causal agent of leaf blight on
443
Figure 2. Culture and conidia morphology of Pestalotiopsis microspora isolated from
rubber leaf: a. one-week-old culture on PDA with white cottony mycelia and
abundant fruit bodies in the centre; b. conidia with septa observed under the
light microscope.
DNA Study of the Isolates
DNA extraction and PCR were successfully performed for the
selected gene regions of each representative isolate from each farm. PCR
amplification for ITS-5.8S rDNA region was determined to be
approximately 542 bp in size (Fig. 3). BLAST search against the NCBI
(www.blast.ncbi.nlm.nih.gov) nucleotide database with ITS sequences of
the culture isolates from rubber confirmed that the isolates collected
represented species in the Amphisphaeriaceae family and showed that
isolates from rubber were closely (100%) related to Pestalotiopsis
microspora. The highest ITS-rDNA-scoring matches were with P.
microspora (AY924279.1) from bark of Terminalia arjuna (Tejesvi et
al., 2005) and to P. Microspora (DQ001010) of leaf lesion of Psidium
guayava (Keith et al., 2006) for ITS-rDNA sequences and their query
coverage were very close (99%). One isolate among the similar isolates
(PEC1) of Amphisphaeriaceae received the accession number KP455649,
and International Collection of Microorganisms from Plants (ICMP) in
New Zealand as ICMP 20841. In the phylogenetic analysis, PEC1 was
clustered in a distinct clade with those of P. microspora isolates retrieved
from the GenBank with 100% bootstrap value (Fig. 4). The results
confirmed the identity of fungus as P. microspora. Although ITS region
sequencing for species identification was informative on P.
microspora (Wu et al., 2009; Jean and Cheon, 2014; Marilia et al.,
2014), sequencing only one region is often insufficient for species level
(Hu et al., 2007), hence, in perspective, it is necessary to use at least two
genes for phylogeny for the GenBank Accession No KP45564 of isolate
PEC1 for better appreciation.
![Page 9: CHARACTERIZATION OF PESTALOTIOPSIS MICROSPORA … · Purification Kit, (Fermentas Life Sciences, Malaysia)and used for sequencinq at First Base Laboratories Sdn. Bh, Selangor Malaysia.](https://reader033.fdocuments.net/reader033/viewer/2022041713/5e4920dcc3d9504b71059bc6/html5/thumbnails/9.jpg)
Proceedings of International Rubber Conference 2017
444
Figure 3. Gel electrophoresis showing amplification of ITs-5.8s rDNA fragments from
each representative isolate of Pestalotiopsis microspora from each farm, 1;
Muyuka and 2; Malende. Size of DNA ladder (M) used is 1kb (GeneRulerTM
,
Fermantas, Lithuania Malaysia). The amplification fragments were
approximately 542 bp
Figure 4. Phylogenetic tree constructed with the ITS-5.8S rDNA sequence of PEC1
isolate from this study (KP45549.1), and other species of Pestalotiopsis
microspora retrieved from GenBank. Pseudopestalotiopsis cocos was used as
the out group taxon. The bar indicates nucleotide substitutions per site.
Numbers of bootstrap support values ≥50% based on 1000 replicates
BPC88 Pestalotiopsis mangiferae (KM510410.1)
LK5 Pestalotiopsis virgatula (EU047945.1)
CLB5 Pestalotiopsis palmarum (GQ888738.1)
CGJ-4 Pestalotiopsis microspora (KT459350.1)
B-3 Pestalotiopsis microspora (KJ787111.1)
PEC 1 Pestalotiopsis microspora (KP455649.1)
UOM1 Pestalotiopsis clavispora isolate (JX091744.1)
xsd08078 Pestalotiopsis microspora strain (FJ478120.1)
CBS 272.29 Pseudopestalotiopsis cocos (KM199378.1)
![Page 10: CHARACTERIZATION OF PESTALOTIOPSIS MICROSPORA … · Purification Kit, (Fermentas Life Sciences, Malaysia)and used for sequencinq at First Base Laboratories Sdn. Bh, Selangor Malaysia.](https://reader033.fdocuments.net/reader033/viewer/2022041713/5e4920dcc3d9504b71059bc6/html5/thumbnails/10.jpg)
Characterization of pestalotiopsis microspora, causal agent of leaf blight on
445
Pathogenicity Test
Leaf blight symptoms were observed in all the inocolated leaves
(Fig. 5.), but not in control. The symptom of P. microspora was
manifested on the leaflets as brown circular spots becoming greyish, at
the areas where the inoculum was deposited before spreading gradually.
These spots converged into a necrotic range and causedyellowing of the
leaf.The pathogen was re-isolated and was found to be identical to the
original isolate. The result revealed that P.miscrospora was associated
with the disease.
Figure 5. Lesion development on rubber leaves inoculated with PECI isolate of P.
microspora. a: light symptom after 5 days of inoculation; b: Severe
symptom 10 days after inoculation; c:Very severe lesion 20 days after
inoculation
Fungicide Test
The fungicides Banko Plus (Chlorothalonil 550g/l + Carbendazim
100 g/l) and Penncoz (Mancozeb 800 g/kg) tested in vitro at different
concentrations (100%, 75%, 50% and 25%) effectively inhibited growth
of P. microspore. Inhibition of mycelial growth was effective with
OKMil (Cuprous oxide 600 g/kg + Metalaxyl 120 g/kg) at 100%, 75%
and 50% only.
ACKNOWLEDGEMENT
The authors would like to thank Dr Woin Noe, General Manager of
Institute of Agricultural Research of Cameroon, and Dr. Echu Kingsley,
Chief of S. W. Regional Research Centre, Ekona of IRAD Cameroon for
their support in this research.
![Page 11: CHARACTERIZATION OF PESTALOTIOPSIS MICROSPORA … · Purification Kit, (Fermentas Life Sciences, Malaysia)and used for sequencinq at First Base Laboratories Sdn. Bh, Selangor Malaysia.](https://reader033.fdocuments.net/reader033/viewer/2022041713/5e4920dcc3d9504b71059bc6/html5/thumbnails/11.jpg)
Proceedings of International Rubber Conference 2017
446
REFERENCES
Doyle, J. J.& Doyle, J.L. 1987. A rapid DNA isolation procedure from
small quantities of fresh leaf tissues, Phytochem Bull., 19 : 11-15.
Elmsly, T.A.& Dixon, J. 2008. Growth rate of Ripe Rot Fungi at
Different temperatures. New Zealand Avocado growe's
Association.Annual Research report, 8 : 77-84.
Hu, H.L., Jeewon, R., Zhou, D.Q., Zhou, T.X. & Hyde, K.D. 2007.
Phylogenetic diversity of endopytic Pestalotiopsis species in
Pinusarmandii and Ribes spp: evidence from rDNA an ß-tubulin
gene phylogenies.Fungal Diversity, 24 : 1-22.
Ismail, H.& Indran,J. 1999. Occurrence and identification of
physiological Race of Corynespora cassicola of Hevea.
Proceedings of IRRDB symposium, 1999, Hainan, China pp.263-
272.
Jayasinghe, C.K. 2011. White Root Disease. The most devastating root
disease of the rubber tree. First Edition 2011, IRRDB, p. 24,
Kuala Lumpur.
Jean, Y.H.& Cheon, W. 2014. First Report of Leaf Blight of Japanese
yew caused by Pestalotiopsismicrospora in Korea. PlantDisease,
98 (5) : 691.1
Keith, L.M., Valasquez, M.E., Zee, F.T. 2006. Identification and
characterisation of Pestalotiopsis spp causing scab disease on
guava Psidium in Hawai. PlantDisease, 90 : 16-23.
Manju, M, Vinod J., Idicula, S.P., Kuruvilla, J.C., Nazeer,M.A.& Benagi,
V.I. 2010. Susceptibility of Hevea brasiliensis clones to
Crynespora Leaf Fall disease.Mycology Plant Pathology, 40(40):
603-609.
Marilia, L., Marcieli, P.B., Marlove, F.B.M., Ricardo, H., Lia, R.S.R.,&
Alvaro F dos santos . 2014. Identification and characterisation of
pathogenic Pestalotiopsis species to pecan tree in Brazil. Presq.
Agropec.bras., brasilia, 49 (6) :440-448.
Pinard, F. 1994. Rapport de mission au Cameroun. CIRAD-CP,
programme Hévéa.
Sambrook, J., Fritsch, E.F. & Maniatis, T. 1989. Molecular cloning: a
laboratory manual, 2nd ed.Cold Sprind Harbor Laboratory Press.
![Page 12: CHARACTERIZATION OF PESTALOTIOPSIS MICROSPORA … · Purification Kit, (Fermentas Life Sciences, Malaysia)and used for sequencinq at First Base Laboratories Sdn. Bh, Selangor Malaysia.](https://reader033.fdocuments.net/reader033/viewer/2022041713/5e4920dcc3d9504b71059bc6/html5/thumbnails/12.jpg)
Characterization of pestalotiopsis microspora, causal agent of leaf blight on
447
Sanjay, R. 2004. Studies on Pestalotiopsis spp affecting tea
(Camelliasiensis (L) O Kuntze in southern India. PhD thesis,
Bharathiar University, Coimbatore.
Sarvottam, D.J., Rsanjay, U.I.B.&MandalA. K. A. 2009.Molecular
characterisation of Pestalotiopsis spp. associated with tea
(Camelliasinensis) in southern India using RAPD and ISSR
markers. Indina journal of biotechnology, 8 :3777-3783.
Senechal. Y.& Gohet, E. 1986. Rapport technique, HEVECAM 1986, p.
147, Cameroun.
Tamura, K., Dudley, J., Nei, M. & Kumar, S. 2007. MEGA4: Molecular
Evolutionary Genetics Analysis (MEGA) software version 4.0.
Molecular Biology and Evolution, 24:1596-1599.
Tamura, K.,Peterson, D., Peterson, N., Stecher, G., Nei, M. & Kumar, S.
2011. MEGAS: Molecular evolutionnary genetics analysis using
maximum likelihood evolutionary distance and maximum
parsimony methods. Mol bil Evol., 28:2731-2739.
Doi:10.1093/molbev/msr121
Tejesvi, M.V., Tamhankar, S.A., Kini, K.R., Prakash, H.S. Molecular
diversity of Pestalotiopsis spp: an endophyte of medicinal plants.
Thompson, J.D, Higgins, D. G. & Gibson, T.J. 1994. CLUSTAL W:
Improving the sensitivity of progressive multiple sequences
alignment through sequence weighting, position-specific gap
penalities and weight matrix choice. Nucl. Acids Res., 22:4673-
4680. doi:10.1093/nar/22.22.4673
Wastie, R. L. 1969. Planters Bulletin, 104,1969, p.199-205.
White, T.J., Bruns, T., Lee, S.& Taylor, J.1990. Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics. In:
PCR protocols: A Guide to methods and Applications, eds, by
M.A. Innis, D.H Gelfand, J.J. Sninsky & T.J. White, pp.315-322,
Academic Press Inc , New York , USA
Workman, D. 2016. Natural Rubber imports by Country. World's
top Exports.