Characterization of a Streptococcus sp.-Veillonella sp ... · Streptococcus oralis (RPS bearing)...

JOURNAL OF BACTERIOLOGY, Dec. 2008, p. 8145–8154 Vol. 190, No. 240021-9193/08/$08.00�0 doi:10.1128/JB.00983-08Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Characterization of a Streptococcus sp.-Veillonella sp. CommunityMicromanipulated from Dental Plaque�

Natalia I. Chalmers,1,2 Robert J. Palmer, Jr.,2 John O. Cisar,2 and Paul E. Kolenbrander2*Department of Biomedical Sciences, University of Maryland Dental School, Baltimore, Maryland 21201,1 and National Institute of

Dental and Craniofacial Research, National Institutes of Health, Bethesda, Maryland 208922

Received 16 July 2008/Accepted 8 September 2008

Streptococci and veillonellae occur in mixed-species colonies during formation of early dental plaque. Onefactor hypothesized to be important in assembly of these initial communities is coaggregation (cell-cellrecognition by genetically distinct bacteria). Intrageneric coaggregation of streptococci occurs when a lectin-like adhesin on one streptococcal species recognizes a receptor polysaccharide (RPS) on the partner species.Veillonellae also coaggregate with streptococci. These genera interact metabolically; lactic acid produced bystreptococci is a carbon source for veillonellae. To transpose these interactions from undisturbed dental plaqueto an experimentally tractable in vitro biofilm model, a community consisting of RPS-bearing streptococcijuxtaposed with veillonellae was targeted by quantum dot-based immunofluorescence and then micromanipu-lated off the enamel surface and cultured. Besides the expected antibody-reactive cell types, a non-antibody-reactive streptococcus invisible during micromanipulation was obtained. The streptococci were identified asStreptococcus oralis (RPS bearing) and Streptococcus gordonii (adhesin bearing). The veillonellae could not becultivated; however, a veillonella 16S rRNA gene sequence was amplified from the original isolation mixture,and this sequence was identical to the sequence of the previously studied organism Veillonella sp. strainPK1910, an oral isolate in our culture collection. S. oralis coaggregated with S. gordonii by an RPS-dependentmechanism, and both streptococci coaggregated with PK1910, which was used as a surrogate during in vitrocommunity reconstruction. The streptococci and strain PK1910 formed interdigitated three-species clusterswhen grown as a biofilm using saliva as the nutritional source. PK1910 grew only when streptococci werepresent. This study confirms that RPS-mediated intrageneric coaggregation occurs in the earliest stages ofplaque formation by bringing bacteria together to create a functional community.

Dental plaque is a multispecies biofilm whose developmentis initiated by adherence of pioneer species to the salivaryproteins and glycoproteins adsorbed on tooth enamel. Al-though more than 700 phylotypes have been detected in thehuman oral cavity, fewer than 100 phylotypes are found in atypical individual (1). The biofilm is not formed by randomsimultaneous colonization by these species; selective, repro-ducible, sequential colonization occurs (12, 29). The initialcolonizers are a specific subset of the oral microflora, andActinomyces, Neisseria, Prevotella, Streptococcus, and Veil-lonella predominate (12, 29). Streptococci constitute 63% ofthe culturable bacteria after 4 h of plaque formation (29) andaccount for 66% of 16S rRNA gene sequences cloned from 4-hplaque samples (12). The vast majority of the streptococcalsequences belong to the Streptococcus oralis-Streptococcus mitiscluster (12). Secondary colonizers, such as fusobacteria andcapnocytophagae, coaggregate with pioneer species (18) andadd to the multispecies transitions in the repetitive develop-mental process.

Coaggregation, defined as cell-cell recognition and bindingbetween genetically distinct bacteria, is characteristic of oralbacteria and has been postulated to play a role in biofilmdevelopment (18, 20). Receptor polysaccharide (RPS) is a cell

surface molecule found on many strains of S. oralis and S. mitis(15). It mediates coaggregation by its role as the recognitionmolecule for lectinlike adhesins found on actinomyces, veil-lonellae, and other streptococci. Six RPS types have been iden-tified in oral streptococci (9). Each type is composed of adistinct hexa- or heptasaccharide repeating unit which con-tains one of two host-like disaccharide recognition motifs,GalNAc�1-3Gal (Gn type) or Gal�1-3GalNAc (G type). Thelectin-like adhesins on actinomyces (8) and on veillonellae (16)recognize the Gn and G types of RPS, whereas certain strep-tococci bear GalNAc-specific adhesins that recognize only theGn types (9). Intergeneric coaggregation of RPS-bearing strep-tococci and actinomyces (9) or veillonellae (17) is prevalentand is thought to contribute to the formation of pioneer mul-tispecies communities on enamel (30, 31). Importantly, wide-spread intrageneric coaggregation of streptococci has beenpostulated to be a major factor in initial multispecies commu-nity formation (19), and such coaggregation is consistent withthe hypothesis that streptococci are the dominant initial colo-nizers (12, 29).

Although the species diversity of initial plaque (12), as wellas that of mature plaque (1), has been described using molec-ular phylogenetics, this information does not reveal spatialrelationships between species within communities. A retriev-able enamel chip model (32) has been used to examine spatialrelationships in initial, undisturbed, human plaque communi-ties. In a fluorescence in situ hybridization (FISH) study usingthis model, streptococci were shown to be part of small com-munities that also contained nonstreptococcal cells (12). Im-

* Corresponding author. Mailing address: National Institutes ofHealth/NIDCR, Building 30, Room 310, 30 Convent Drive, MSC 4350,Bethesda, MD 20892-4350. Phone: (301) 496-1497. Fax: (301) 402-0396. E-mail: [email protected].

� Published ahead of print on 19 September 2008.

8145

on August 8, 2019 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

munofluorescence was used to reveal veillonellae juxtaposedwith RPS-bearing streptococci (30). A study using immunoflu-orescence and nucleic acid stains (31) identified RPS-bearingstreptococci juxtaposed with streptococci that lacked RPS andalso revealed type-2-fimbria-bearing actinomyces juxtaposedwith RPS-bearing streptococci. The latter juxtaposed pair, inwhich a cell bearing a specific coaggregation-mediating adhe-sin was juxtaposed with a cell bearing the complementary re-ceptor molecule, provided strong evidence for the hypothesisthat intergeneric coaggregation has a function in the assemblyof biofilms in nature (31). However, while there is much evi-dence demonstrating that coaggregation has a role in plaquedevelopment, definitive proof requires isolation and subse-quent culture of juxtaposed cells and reassembly of the cul-tured cells into physically and metabolically integrated com-munities in vitro.

Veillonellae and streptococci have been postulated to belinked metabolically through streptococcal fermentation ofsugars to lactic acid, which is a carbon source for the nonsac-charolytic veillonellae. In vivo studies using gnotobiotic ratsdemonstrated that veillonellae were unable to establishmonoinfections, yet when a strain of Veillonella was inoculatedinto rats already monoinfected with a strain of Streptococcusmutans that coaggregates with that Veillonella strain, the num-ber of veillonellae on the teeth of the coinfected animals was1,000-fold higher than the number when a noncoaggregatingVeillonella strain was used (25). Also in gnotobiotic rats, lowercaries and plaque scores were obtained for two-species biofilmsthan for monospecies colonization by streptococci (41), andveillonellae have been shown to reduce caries activity anddemineralization of the enamel surface by streptococci (26,27). More recently, spatial relationships between these specieshave been reported to influence gene regulation in vitro; dif-fusible-signal exchange between the coaggregating partnersVeillonella sp. strain PK1910 and Streptococcus gordonii V288resulted in upregulation of an amylase gene (amyB) promoterin the streptococcus strain (13). Further, it has been shown thatveillonellae are close to RPS-bearing streptococci in initialcommunities in vivo and that a rapid succession of veillonellaphylotypes occurs in the communities (30).

Because initial dental plaque communities are often com-posed of just a few cells of different species, a communitycontaining RPS-bearing streptococci juxtaposed with veillonel-lae might consist of only coaggregating species. Furthermore,the cells might be able to form mixed-species biofilms in an invitro model using saliva as the sole carbon source. Verificationof these hypotheses would conclusively demonstrate that co-aggregation has a role in establishment of initial dental plaquecommunities.

MATERIALS AND METHODS

Micromanipulation of an initial in vivo community. An 8-h-old plaque samplewas obtained by using the retrievable enamel chip model (31, 32). Briefly, smallchips of human enamel were carried in a mandibular stent in a volunteer’s mouthfor 8 h, after which they were removed and stained in a disinfected (70% ethanol)chamber. All staining solutions were filter sterilized. Quantum dot (QD)-labeledprimary antibodies were used at a concentration of 30 nM (6) to select commu-nities for manipulation. Anti-RPS, which reacts with a subset of RPS-bearingstreptococci that includes representatives of the G and Gn structural types (31),was conjugated to QD 655 (Invitrogen, Carlsbad, CA) for micromanipulation.Anti-R1 (30) reacted with almost all culturable veillonellae from the volunteer’s

mouth. This antibody was conjugated to QD 525 for micromanipulation. Forsome samples not destined for micromanipulation, 4�,6-diamidino-2-phenylin-dole dihydrochloride (DAPI) (Invitrogen) was applied at a concentration of 5�g/ml for detection of non-antibody-reactive cells. After staining, a chip wasattached to a microscope slide using dental wax, sterile water was applied as animmersion fluid, and the biofilm was examined with a 63x 0.9 NA water-immers-ible lens that was wiped with 70% ethanol and was mounted on a DM LB2upright microscope (Leica, Bannockburn, IL). A community that contained bothof the antibody-reactive cell types (i.e., at least one anti-RPS-reactive cell to-gether with at least one anti-R1-reactive cell) was identified, and dual Transfer-Man NK2 micromanipulators (Eppendorf, Westbury, NY) equipped with etha-nol flame-sterilized microneedles or microspades (tip diameter, 25 �m; Minitool,Los Gatos, CA) were used to transfer the community to anaerobic modifiedSchaedler’s medium (MSM) (4) in which lactic acid (21 ml of 60% lactic acidsyrup/liter) was substituted for glucose.

Identification of community members. After 48 h of anaerobic growth in MSMat 37°C with an H2-CO2-N2 (5:5:90) atmosphere (Bactron glovebox; SheldonManufacturing, Cornelius, OR), slight turbidity was observed. This enrichmentculture was concentrated fivefold, made 20% with respect to glycerol, and thenfrozen at �70°C in aliquots, which were regrown in fresh MSM broth for furtherwork. Members of the enrichment culture were then isolated by serial dilutiononto MSM agar plates, some of which contained vancomycin (7.5 �g/ml). Nogrowth was obtained on the veillonella-selective vancomycin-containing plates.However, anti-R1-reactive cells were always present in the enrichment culture,and PCR using forward primer A(C/T)CAACCTGCCCTTCAGA) and reverseprimer CGTCCCGATTAACAGAGCTT targeting the 16S rRNA gene ofveillonellae (34) also verified the presence of Veillonella sp. cells in theenrichment.

Colonies were picked from MSM plates without vancomycin and werescreened for RPS by dot immunoblotting (43). Membranes were spotted by handwith 0.7 �l of an overnight bacterial culture and incubated with a primaryantibody mixture that identified all RPS-bearing bacteria, and the RPS-bearingstrains revealed by using horseradish peroxidase-conjugated secondary anti-body. The RPS-positive isolates were then reblotted and screened usingsingle antibodies to characterize the specific structural type of RPS on eachisolate (43).

All isolates (RPS positive and RPS negative) were subjected to repetitiveextragenic palindromic PCR (REP-PCR) analysis to examine clonality (2). DNAwas extracted from 5 �l of overnight culture with GeneReleaser (BioVentures,Inc., Murfreesboro, TN), amplification was performed using the JumpStartReadyMix REDTaq PCR mixture (Sigma, St. Louis, MO), and the initial dena-turation at 95°C was for 2 min. The primer sequences were as follows: REP1R-Dt, IIINCGNCGNCATCNGCC; and REP2-Dt, NCGNCTTATCNGGCCTAC.The PCR products were separated by agarose gel electrophoresis. The phyloge-netic relationships of the clones with other streptococci were examined usingsuperoxide dismutase (sodA) gene sequences (14). The primer sequences were asfollows: forward primer, TRCAYCATGAYAARCACCAT; and reverse primer,ARRTARTAMGCRTGYTCCCARACRTC. MEGA version 4 (38) was used toconstruct a ClustalW alignment of the sodA sequences, and a tree was con-structed using a neighbor-joining algorithm (37).

Spatial relationship of RPS-bearing streptococci, other streptococci, and veil-lonellae in vivo. A protocol for simultaneous use of FISH and immunofluores-cence was developed and used for biofilms on chips. Samples were labeled withAlexa Fluor 546-conjugated anti-RPS at a concentration of 5 �g/ml for 20 min,washed with 1% phosphate-buffered saline (PBS)-bovine serum albumin (BSA),and then fixed at 4°C for 3 h with 4% paraformaldehyde in PBS. FISH was thencarried out as previously described (12) by using the genus-level veillonella FISHprobe VEI488 (CCGTGGCTTTCTATTCCG) designed with ARB software (21)or by using the genus-level streptococcal FISH probe STR405 (39). FISH probeswere synthesized and labeled by Operon Biotechnologies, Inc. (Huntsville, AL).The specificity of VEI488 was tested, and this probe was shown to hybridize toVeillonella clinical isolates R1 and R2 (30), Veillonella sp. strain PK1910, Veil-lonella parvula ATCC 10790, and Veillonella atypica ATCC 17744. The negativecontrols used for VEI488 were S. gordonii DL1, S. oralis 34, S. mitis ATCC 49456,S. mutans ATCC 700610, S. oralis ATCC 10557, Streptococcus sanguinis ATCC10556, S. gordonii ATCC 49818, Streptococcus salivarius ATCC 259750, Actino-myces naeslundii T14V, Fusobacterium nucleatum ATCC 10953, Prevotella inter-media ATCC 15032, and Porphyromonas gingivalis ATCC 53978. Probe VEI488was tested with all negative controls and was shown not to hybridize to any ofthem.

Reconstruction of the community in vitro. (i) Growth of biofilms on polysty-rene pegs. Biofilms were grown in 25% human saliva on transferable solid-phasepolystyrene pegs (Nunc 445497; Nunc-Immuno TSP) (5, 24) mounted in U96

8146 CHALMERS ET AL. J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

MicroWell plates (Nunc 163320) (24). Overnight cultures of the two Streptococ-cus isolates were grown in brain heart infusion broth (Difco, Detroit, MI).Veillonella sp. strain PK1910 was chosen as a surrogate for the uncultivatedVeillonella sp. in the community because its 16S rRNA gene sequence is identicalto that retrieved from the community. Overnight cultures of Veillonella sp. strainPK1910 were grown in MSM broth. Microtiter plate wells were filled with 200 �lof 25% human saliva, and the pegs were then inserted and incubated for 30 minat room temperature to obtain a conditioning film. Twenty microliters of anovernight culture was added to each of the wells to obtain an optical density at600 nm of approximately 0.1. The plates were placed in a humidity chamber andincubated anaerobically at 37°C for 24 or 48 h. The pegs that were incubated for48 h were transferred to fresh reduced 25% saliva after 24 h. In preliminaryexperiments, total biomass was quantified by crystal violet staining; the transfer-able solid-phase unit was removed, air dried for 30 min at room temperature,stained with 200 �l of 0.2% (wt/vol) crystal violet (Sigma), washed twice withdeionized water, and then dried. The stain was eluted in 70% ethanol–5% aceticacid, and the absorbance at 540 nm of the elution wash solution was determinedusing a Victor3 plate reader (PerkinElmer, Inc., Waltham, MA).

(ii) Real-time Q-PCR quantification of species in biofilms. DNA was extractedfrom biofilms by a modified alkaline lysis protocol (14). Biofilm-covered pegswere immersed in 40 �l of sterile ultrapure water plus 160 �l of 0.05 M sodiumhydroxide and incubated at 60°C for 45 to 60 min, after which 18.4 �l of 1 MTris-HCl (pH 7.0) was added to neutralize the pH. The resulting extract was usedas the template DNA for the quantitative PCR (Q-PCR) analyses (14). Bacterialgenomic DNA used to obtain standard curves was extracted from overnightcultures of the clinical isolate of S. gordonii and Veillonella sp. strain PK1910 witha DNA extraction kit (Qiagen) used according to the manufacturer’s instruc-tions. Genomic DNA was stored at �20°C.

Species-specific primers used for quantification were designed with AlleleID6(PREMIER Biosoft International, Palo Alto, CA). The primers specific forstreptococci were forward primer CGACGATACATAGCCGACCTGAG andreverse primer TCCATTGCCGAAGATTCCCTACTG, and the annealing tem-perature was 60°C. The primers specific for veillonellae were forward primerCCGTGATGGGATGGAAACTGC and reverse primer CCTTCGCCACTGGTGTTCTTC, and the annealing temperature was 60°C. Streptococci and veil-lonellae in the biofilms were quantified by performing real-time Q-PCR with theSYBR green dye to detect the 16S rRNA gene amplicons. Each reaction mixture(final volume, 20 �l) contained 3 �l template, 10 �l FAST Power SYBR greenPCR Master Mix (Applied Biosystems, Foster City, CA), 375 nM forwardprimer, and 375 nM reverse primer. The Q-PCR was performed with anMX3005P thermocycler (Stratagene, La Jolla, CA) using the thermocycling con-ditions recommended for FAST Power SYBR green PCR Master Mix (95°C for20 s and 40 cycles of 3 s at 95°C and 30 s at 60°C). Dissociation curves weregenerated by incubating reaction products at 95°C for 1 min and at 56°C for 30 sand then incrementally increasing the temperature to 95°C. Fluorescence datawere collected at the end of the 60°C primer annealing step for 40 amplificationcycles and throughout the dissociation curve analysis. Analysis of the meltingcurves with both primer sets revealed a single sharp peak. DNA concentrations(ng/ml) were calculated based on standard curves obtained by using 10-fold serialdilutions of bacterial DNA isolated with a DNA extraction kit (Qiagen) andquantified using the PicoGreen fluorescence assay (Invitrogen). To convertnanograms of DNA to numbers of cells, the following weights and genome sizeswere used: 2.05 fg/genome and 2 Mb for streptococci (42) and 3.08 fg/genomeand 3 Mb for veillonellae (23). The data presented below were obtained for threeindependent biofilms.

(iii) Labeling of peg biofilms and microscopy. Anti-RPS conjugated to AlexaFluor 546 was used to identify S. oralis, anti-DL1 (31) conjugated to Alexa Fluor488 was used to identify S. gordonii (which lacks RPS), and anti-1910 (30)conjugated to Alexa Fluor 633 was used to identify Veillonella sp. strain PK1910.Antibodies (5 �g/ml) were applied for 20 min to peg biofilms immersed inPBS-BSA. The biofilms were then washed twice with 1% PBS-BSA after transferto new microtiter plates. The pegs were then cut out and attached with dentalwax to a microscope slide. Confocal microscopy was performed with a TCS SP2confocal microscope (Leica Microsystems, Exton, Pa.) using a 63x 0.9NA LWDwater-immersible lens.

Nucleotide sequence accession numbers. The sodA sequences of the two Strep-tococcus isolates have been deposited in the GenBank database under accessionnumbers EU488871 and EU488872. The 343-bp sequence obtained with Veil-lonella-specific 16S rRNA gene primers has been deposited in the GenBankdatabase under accession number EU488873.

RESULTS

Micromanipulation of an initial community from undis-turbed plaque. The initial communities used for micromanip-ulation were selected based on the presence of cells reactivewith anti-RPS juxtaposed with cells reactive with anti-R1. Fig-ure 1A shows what was seen during targeting and manipulationof the community (small numbers of juxtaposed cells with atleast one cell reactive with each antibody). DAPI staining (Fig.1B) showed that non-antibody-reactive cells can also occur insuch communities; however, nucleic acid-binding stains werenot used during manipulation to minimize photodamage. Fourcommunities from three independent biofilms were microma-nipulated. Three micromanipulated communities were trans-ferred to reduced MSM broth and incubated anaerobically.After 48 h the medium became slightly turbid. For each out-growth the presence of anti-RPS-reactive and anti-R1-reactivecells was determined by using primary immunofluorescence.One outgrowth containing both cell types was studied further.Serial dilutions of the outgrowth were plated onto MSM withand without vancomycin and incubated anaerobically for 48 h.Growth occurred only on MSM without vancomycin, and 160single colonies were retrieved for further study. The fourthmicromanipulated community was plated directly onto MSMagar, and no growth was visible after 72 h of anaerobic incu-bation.

Characterization of streptococci. The 160 isolates werescreened by using a cocktail of anti-RPS antibodies that rec-ognizes all types of RPS (43), after which the isolates wereseparated into two groups: an RPS-positive group (41 isolates)

FIG. 1. Confocal micrographs of 8-h dental plaque. (A) QD-basedprimary immunofluorescence revealing RPS-bearing streptococci re-active with QD655-conjugated anti-RPS (red) juxtaposed with veil-lonellae reactive with QD525-conjugated anti-R1 (green). A commu-nity representative of the cells selected for micromanipulation iscircled. (B) Same field of view as that in panel A but with DAPI-stained cells (blue) also shown. The general nucleic acid stain DAPIrevealed non-antibody-reactive cells, one of which was located in therepresentative community. DAPI was not used with micromanipulatedsamples. Bar, 10 �m.

VOL. 190, 2008 COAGGREGATION IN MICROMANIPULATED COMMUNITY 8147


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

and an RPS-negative group (119 isolates). Subsequently, the41 RPS-positive isolates were tested with individual antibodiesagainst each of the four recognized serotypes (9, 43) All 41isolates reacted with antibody specific for RPS serotype 1.These isolates also coaggregated with S. gordonii DL1, indicat-ing the presence of Gn-type RPS. Based on morphology andantibody reactivity, all 41 RPS-positive isolates were presumedto be streptococci. 16S rRNA gene sequence analysis of 10randomly selected RPS-bearing isolates, as well as 10 randomlyselected RPS-negative isolates, showed that these isolates werestreptococci. However, 16S rRNA gene sequences do not dis-tinguish oral streptococci at the species level; therefore, othermethods described below were used.

REP-PCR was used to assess the genotypic heterogeneity inall 160 isolates. REP-PCR provides a highly reproduciblemultiband PCR product fingerprint for each genotype (2). All41 RPS-bearing streptococcal isolates produced identicalREP-PCR fingerprints, and all 119 RPS-negative streptococcalisolates produced a single fingerprint distinct from that of theRPS-bearing isolates (Fig. 2). These data indicate that themicromanipulated community consisted of only two strepto-coccal genotypes.

Phylogenetic identification of streptococci at the specieslevel was accomplished by comparing the sequences of the su-peroxide dismutase (sodA) genes (14) of the isolates with thesequences of the superoxide dismutase genes of other nonhe-molytic streptococci (Fig. 3). Based on sequencing results, theRPS-bearing Streptococcus spp. clustered with S. oralis, and theRPS-negative Streptococcus spp. clustered with S. gordonii (14).

Oral streptococci participate in numerous types of interge-neric coaggregation, but they also exhibit extensive intrage-neric coaggregation (19). The micromanipulated S. gordoniiwas compared with the reference strain S. gordonii DL1 tostudy its ability to coaggregate in vitro with a reference set ofstreptococcal strains bearing RPS type 1Gn, 2Gn, 4Gn, 2G, or

3G. S. gordonii DL1 has GalNAc-specific adhesins on its sur-face (9). The coaggregation of S. gordonii DL1 with the refer-ence set of RPS-bearing streptococci was indistinguishablefrom the coaggregation of the micromanipulated S. gordoniistrain with these RPS-bearing streptococci (data not shown),indicating that the coaggregation was Gn specific. An RPS-negative mutant of the reference strain S. oralis 34 (bearing1Gn RPS) did not coaggregate with either S. gordonii strain,further supporting the hypothesis that Gn-specific adhesinswere present on the micromanipulated S. gordonii strain. Col-lectively, these data documented that the micromanipulated S.oralis strain bears a 1Gn-type RPS, that the micromanipulatedS. gordonii strain bears a Gn-specific adhesin, and that intrage-neric coaggregation is fundamental within initial communitieson enamel.

Characterization of uncultured Veillonella sp. Veillonellaeare typically isolated from clinical samples using selective agarbased on vancomycin resistance (35, 36). After growth ap-peared in the original outgrowth inoculated with the microma-nipulated community, serial dilutions were plated onto MSMagar with vancomycin (7.5 �g/ml), but no colonies were evidentafter 48 to 72 h of anaerobic incubation. When vancomycin wasomitted, the colonies were predominantly streptococcal colo-nies, but there were some mixed colonies in which anti-R1-reactive cells were observed. Attempts to culture veillonellaefrom these colonies were unsuccessful. The procedures used toenrich for Veillonella cells included (i) growth on media con-taining preferred carbon sources other than lactate (e.g., pyru-vate), (ii) plating on agar prepared with spent medium fromthe streptococcal clinical isolates grown in MSM, and (iii)magnetic capture using anti-R1-conjugated Dynabeads (In-vitrogen). No colonies were recovered when these procedureswere used.

However, anti-R1-reactive cells were always detected by pri-mary immunofluorescence in the original outgrowth of themicromanipulation-inoculated mixed culture (Fig. 4). Theanti-R1-reactive cells were occasionally quite numerous and

FIG. 2. REP-PCR patterns of four randomly selected RPS-bearingStreptococcus isolates (lanes 2 to 5) and four randomly selected RPS-negative Streptococcus isolates (lanes 6 to 9). Lanes 1 and 10 contained1-kb molecular size markers.

FIG. 3. Phylogenetic tree based on streptococcal sodA sequences.The neighbor-joining method was used to construct the tree. Filleddiamonds indicate the two clinical isolates. Scale bar � 5% differencein nucleotide sequence. The type strains S. oralis ATCC 35037 and S.gordonii ATCC 10558 are included for reference.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

occurred together with other spherical cells presumed to bestreptococci. Molecular techniques were also used to confirmthe presence of Veillonella cells in the original mixed culture.Veillonella-specific 16S rRNA gene primers (34) amplified a343-bp sequence that is identical to the sequences of otheruncultured veillonellae, including sequences from the samevolunteer (12). The sequence also clustered with the sequencesof other anti-R1-reactive cells that are most closely related toV. parvula (30). The same study revealed that Veillonella sp.strain PK1910, a strain in our culture collection which wasidentified using nonmolecular approaches and which clusterstogether with V. parvula strains, is also very closely related tothe uncultured Veillonella sp. from the captured community.Therefore, PK1910 was selected as a surrogate veillonellastrain for in vitro studies with the micromanipulated S. oralisand S. gordonii isolates.

Spatial relationship between phylotypes of the microma-nipulated community members in vivo. The micromanipulatedcommunity consisted of three members: an uncultured Veil-

lonella sp. and two Streptococcus spp. (RPS-bearing S. oralisand RPS-negative S. gordonii). To study the spatial arrange-ment of these organisms in the community in vivo, immuno-fluorescence was combined with FISH. The FISH probeVEI488 (which recognizes all Veillonella cells) was used simul-taneously with anti-RPS immunofluorescence. VEI488-reac-tive cells were distributed rather evenly over the enamel sur-face (Fig. 5A), as were the anti-RPS-reactive clusters of cells(Fig. 5B). The VEI488-reactive cells were almost exclusivelyclose to anti-RPS-labeled cells, indicating that the distributionof veillonellae and streptococci in vivo is not random (Fig. 5C).These findings support those of a previous study in which thesecommunities were identified by fluorescent antibody labelingof veillonellae and RPS-bearing streptococci (30) and ex-tend the observations to include all veillonellae reactive withthe VEI488 FISH probe, regardless of their antigenic reac-tivity.

The FISH probe STR405 recognizes all Streptococcus cells(39) and was used together with anti-RPS immunofluorescenceto investigate the prevalence of streptococcal communitiescomposed of RPS-bearing cells (immunoreactive and STR405reactive) and RPS-negative cells (only STR405 reactive) in anundisturbed dental plaque biofilm stained with acridine orange(Fig. 6A). A subset of the Streptococcus cells identified byFISH (Fig. 6B) was also anti-RPS reactive (Fig. 6C). Manyanti-RPS-reactive cells were close to RPS-negative strepto-cocci (Fig. 6C) and nonstreptococcal cells (Fig. 6C). Areaanalysis of multiple images of biofilms labeled with anti-RPSand STR405 using the DAIME software (11) revealed that theRPS-bearing streptococci accounted for 38% � 8% of the totalstreptococcal population.

Reconstruction of three-species biofilms in vitro. The juxta-position in vivo of the RPS-positive organism S. oralis, theadhesin-bearing organism S. gordonii, and the uncultured Veil-lonella sp. indicates that there was coaggregation-mediatedcolonization. Veillonella sp. strain PK1910 was chosen as asurrogate for the uncultured Veillonella sp. in the microma-nipulated community because it coaggregated with the micro-manipulated S. oralis and S. gordonii isolates, as well as withthe reference strain S. oralis 34, but not with the RPS-negativemutant of the latter strain. Therefore, reconstruction of athree-species biofilm community in vitro was attempted. Bio-

FIG. 4. Transmitted light micrograph (inset) of a wet mount ofmicromanipulated cells after outgrowth in an MSM broth culture andimmunofluorescence microscopy (large image) of the same field ofview showing cells labeled with anti-R1 antibody. The arrows indicateanti-R1-reactive cells in the two images. Note the non-antibody-reac-tive cells (presumed to be streptococci) in the transmitted light micro-graph. Bars, 20 �m.

FIG. 5. Confocal micrographs of immunofluorescence- and FISH-treated 8-h plaque on enamel showing (A) Veillonella cells reactive with theVEI488 FISH probe for veillonellae 16S rRNA (green), (B) RPS-bearing streptococci reactive with anti-S. oralis 34 RPS (red), and (C) an overlayof panels A and B showing juxtaposition of veillonellae and RPS-bearing streptococci. All images are maximum projection images. Bar, 40 �m.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

film formation by the streptococcal clinical isolates andPK1910 using saliva as the sole nutritional source was studiedwith a static model in which bacteria adhered to a saliva-conditioned polystyrene peg suspended in a microtiter well.Veillonellae can use the metabolic products of streptococci;therefore, coculture of veillonellae with streptococci could en-hance the growth of veillonellae in a multispecies biofilm. Theinitial results obtained using crystal violet staining of biofilmsformed on the polystyrene pegs indicated that each strepto-coccal isolate could form a monospecies biofilm, but PK1910could not do this (data not shown). However, culture ofPK1910 together with either streptococcal isolate resulted inaccumulation of a large amount of biomass. Three-speciescultures showed biomass accumulation similar to that seenwith two-species streptococcus cultures. Although these resultssupported the hypothesis that metabolic interaction existed inthe multispecies biofilms, they did not quantify species biomassor reveal the spatial relationship between the organisms.

To quantify veillonellae and streptococci in the biofilms,Q-PCR with species-specific primers was used to amplify partof the 16S rRNA gene. No cross amplification with Streptococ-cus- and Veillonella-specific primers occurred. In monospeciesbiofilms, S. oralis and S. gordonii formed biofilms by 24 h, andthe number of cells was greater at 48 h (Fig. 7). In two-speciesstreptococcal biofilms, the cumulative number of cells of thetwo streptococci was not higher than the numbers of cells whenthe organisms were grown as monocultures. In monoculture,PK1910 formed a minimal biofilm. However, in two-speciesbiofilms with each streptococcus, the number of veillonellacells at the initial 24-h time point was higher than that inmonoculture, and the number of cells increased significantlyover the following 24 h. The same was true for the three-species biofilms. These data show that each streptococcal com-munity member can grow on its own using saliva as the solenutrient source, whereas PK1910 cannot grow unless a strep-tococcal partner is present. Further, these data indicate that allmembers of the three-species community can grow together onsaliva.

Architecture of three-species biofilms in vitro. Each specieswas labeled using primary immunofluorescence, and the bio-films were examined using laser scanning confocal microscopy(Fig. 8). At the initial 24-h time point, all three cell types werefound to be members of multispecies coaggregates, and theywere not randomly distributed as single-species colonies overthe peg surface, an impressive finding given that the system was

FIG. 6. Confocal micrographs of immunofluorescence- and FISH-treated 8-h plaque on enamel showing the distribution of RPS-bearingstreptococci among other streptococci and nonstreptococcal bacteria.(A) All cells stained with the general nucleic acid stain acridine orange(green). (B) Streptococcus cells reactive with the 16S rRNA for strep-tococci appear blue-green through combination of acridine orange(green; shows all cells) with the streptococcal 16S rRNA probe (blue).(C) Streptococcus cells reactive with Alexa Fluor 546-conjugated anti-RPS. RPS-bearing Streptococcus cells are red with a white center. Thebright white pixels in the center of large colonies result from colocal-ization of red, green, and blue. All images are maximum projectionimages. The arrowheads indicate RPS-negative streptococci (blue-green) that are close to RPS-bearing streptococci (red with whitecenters). Bar, 8 �m.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

not a flowing model system. After an additional 24 h of growth,the sizes of the cell clusters had increased, and the majority ofthe clusters contained three species. The images (Fig. 8) re-vealed the intimate three-species interdigitation and empha-sized the importance of coaggregation to the development ofthese communities.

DISCUSSION

A multispecies oral biofilm community was obtained from aretrievable human enamel surface by using a novel approachthat preserves interspecies interactions. The community con-sisted of two streptococci (S. oralis and S. gordonii) and anuncultivated Veillonella sp. The streptococci exhibited coaggre-gation; the S. oralis strain had a GalNAc-containing RPS andbound to the S. gordonii strain, which had a GalNAc-specificadhesin. These findings define an important role for intrage-neric coaggregation in the development of plaque communitiesin vivo. The streptococci also coaggregated in vitro with Veil-lonella sp. strain PK1910, a strain indistinguishable on the basisof the 16S rRNA gene sequence from the uncultivated Veil-lonella sp. of the captured community. Reconstruction of thecommunity in vitro, using saliva as the sole carbon source andPK1910 as a surrogate for the micromanipulated Veillonellasp., demonstrated that the three organisms interacted throughcoaggregation to form biofilms composed of discrete interdig-itated multispecies colonies whose structure was similar to thatof the original community captured from the tooth surface.Furthermore, PK1910 could not grow without interaction with

at least one of the streptococci, thereby demonstrating themetabolic dependence of veillonellae on other bacteria forgrowth in saliva. These results support the concept that thisthree-species community was a fundamental building block ofthe initial oral biofilms.

One methodological advance required for micromanipula-tion of the community from the enamel surface was identifi-cation of target bacteria based on criteria other than cell shape.Previously, micromanipulation of oral bacteria was based onan unusual and easily identifiable morphology: the “corn cob”consortium (28). This consortium was shown to consist of along rod, eventually named Corynebacterium matruchotii (10),surrounded by a tufted streptococcus that was eventually clas-sified as Streptococcus cristatus (40). The occasional isolation ofa Veillonella-like bacterium was noteworthy. Subsequent toisolation, antisera against these bacteria were produced, andthe juxtaposition of antibody-reactive bacteria within corncobswas confirmed by secondary immunofluorescence. However,the Veillonella-like bacterium was rarely seen and appearedonly at the tip of the otherwise densely populated corncobs.The Veillonella-like bacterium was likely dependent on theother bacteria for growth. The corncobs were obtained fromdisrupted plaque samples that had none of the original biofilmarchitecture. In these micromanipulations, the sample wasspread across a thin agar coating on a microscopy coverglass,which formed the upper part of a glass chamber with the agarsurface facing downward. Phase-contrast light microscopy withan upright microscope was used to view the sample through the

FIG. 7. Q-PCR quantification of S. oralis, S. gordonii, and Veillonella sp. strain PK1910 in one-, two- and three-species biofilms at 24 and 48 h.For the two- and three-species biofilms, the number of streptococcal cells (S. oralis RPS-bearing isolate and S. gordonii RPS-negative isolate) isindicated by light gray bars, and the number of PK1910 cells is indicated by dark gray bars. The number of streptococcal cells increased between24 and 48 h in the one-, two- and three-species biofilms. PK1910 did not form a single-species biofilm, but its biomass increased significantly intwo- and three-species biofilms.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

coverglass-agar sandwich, and the consortium was manipulatedoff using an angled needle inserted into the chamber from theside. In the present study, intact dental plaque biofilms on theopaque substratum of human tooth enamel were examined. Anupright microscope with a water immersion objective was usedto view a sample without a coverglass, and the manipulatorsapproached through the water droplet between the lens andthe sample. The candidate community, RPS-bearing strepto-cocci juxtaposed with veillonellae, was composed entirely ofcoccoid organisms; therefore, primary immunofluorescencewas required to distinguish the target organisms from the many

other coccoid bacteria in the biofilm. The use of primary im-munofluorescence to target cells required antibodies conju-gated with photostable QD fluorophors (6). Several minuteswere needed to locate, select, and capture the targeted com-munity. Therefore, as envisioned in a previous study (6), pho-tostable QD luminescence was essential for this. QDs havenarrow, symmetric emission spectra, as well as broad continu-ous excitation (3, 7). Thus, white light epifluorescence at asingle wavelength was used to simultaneously excite QD655–anti-RPS conjugates together with QD525–anti-R1 conjugatesfor location and manipulation of the community. Micromanip-

FIG. 8. Representative confocal micrographs of 24-h (A and C) and 48-h (B and D) in vitro biofilms showing the intimate interaction betweenthe RPS-bearing streptococcal isolate (S. oralis, labeled red by Alexa Fluor 546-conjugated anti-RPS), the RPS-negative streptococcal isolate (S.gordonii, labeled green by Alexa Fluor 488-conjugated anti-DL1), and the surrogate organism Veillonella sp. strain PK1910 (labeled blue by AlexaFluor 633-conjugated anti-1910). (A and B) Distribution and juxtaposition of the three species on a peg surface after 24 h (A) and 48 h (B) ofbiofilm growth on saliva as the sole nutritional source. Significant growth of all species occurred at 48 h. (C and D) Three-dimensional volumerenderings of the communities indicated by the squares in panels A and B, showing the interdigitation and spatial relationships of the three species.The arrowheads indicate interdigitation of the three species. Bars, 40 �m.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

ulation of QD-labeled cells from opaque substrata could proveapplicable to capture of communities from a broad spectrum ofnaturally occurring biofilms.

Only veillonellae and RPS-bearing streptococci were visibleduring the manipulation. However, although not seen, otherbacteria were likely to be part of the community because di-versity within even very small biofilm communities (three tofive cells) has been demonstrated (30, 31). One cell type nottargeted in this study but which might be expected was actino-myces because it was shown to be associated with RPS-bearingstreptococci in initial communities (31). Another expected celltype was adhesin-bearing streptococci; oral streptococci areknown to coaggregate with one another (19), and a Gn-specificadhesin-bearing S. gordonii not visible during manipulationwas indeed captured together with the immunofluorescence-targeted RPS-bearing organism S. oralis. That only two strep-tococcal genotypes were obtained in the absence of a variety ofother species illustrates the robustness of targeting a smallnumber of cell types when diverse yet small oral communitiesare isolated.

Only about 50% of oral phylotypes are estimated to havebeen cultured (33). Veillonella spp. can be difficult to isolatefrom clinical specimens because other bacteria overgrow themunless the other bacteria are inhibited by an antibiotic ordetergent (22, 36). However, in the presence of vancomycin,nothing grew from the micromanipulated sample known tocontain cells reactive with veillonella-specific antibodies, aswell as a veillonella 16S rRNA gene sequence. Furthermore,no veillonellae were obtained by other isolation methods, in-cluding using lactate or pyruvate as a nutritional source, im-munobinding of cells to anti-R1-coated magnetic beads, orgrowth in spent streptococcal culture media. However, onMSM agar in the absence of antibiotics, anti-R1-reactive cellswere found in colonies of streptococci. As demonstrated in thein vitro experiments, the surrogate strain PK1910 was depen-dent on association with at least one of the clinical streptococcifor growth in saliva. Overall, the data suggest that streptococ-cal growth in saliva alone is sufficient to support the growth ofveillonellae and that a metabolic product produced by strep-tococci during their growth on saliva may be essential for thesurvival of the uncultured Veillonella sp. in the micromanipu-lated community.

This report demonstrates that metabolic dependence is fa-cilitated by coaggregation of the participants; in the in vitroreconstruction, both streptococci coaggregated with PK1910,and the streptococci interacted by RPS-mediated coaggrega-tion. The capture of a coaggregating pair of cells from a nat-urally occurring community containing a very small number ofcells provides proof that coaggregation does occur in vivo andis the first step in establishment of a multispecies community.In particular, intrageneric coaggregation of streptococci andintergeneric coaggregation of streptococci and veillonellae areimportant factors in the initial formation of spatially distinctand metabolically cooperative communities during primarycolonization of the tooth surface.

ACKNOWLEDGMENTS

We thank Nicholas Jakubovics (Newcastle University) for his assis-tance with the Q-PCR.

This research was supported in part by the Intramural ResearchProgram of the National Institute of Dental and Craniofacial Re-search, National Institutes of Health.

REFERENCES

1. Aas, J. A., B. J. Paster, L. N. Stokes, I. Olsen, and F. E. Dewhirst. 2005.Defining the normal bacterial flora of the oral cavity. J. Clin. Microbiol.43:5721–5732.

2. Alam, S., S. R. Brailsford, R. A. Whiley, and D. Beighton. 1999. PCR-basedmethods for genotyping viridans group streptococci. J. Clin. Microbiol. 37:2772–2776.

3. Bruchez, M., Jr., M. Moronne, P. Gin, S. Weiss, and A. P. Alivisatos. 1998.Semiconductor nanocrystals as fluorescent biological labels. Science 281:2013–2016.

4. Celesk, R. A., and J. London. 1980. Attachment of oral Cytophaga species tohydroxyapatite-containing surfaces. Infect. Immun. 29:768–777.

5. Ceri, H., M. E. Olson, C. Stremick, R. R. Read, D. Morck, and A. Buret.1999. The Calgary biofilm device: new technology for rapid determination ofantibiotic susceptibilities of bacterial biofilms. J. Clin. Microbiol. 37:1771–1776.

6. Chalmers, N. I., R. J. Palmer, Jr., L. Du-Thumm, R. Sullivan, W. Shi, andP. E. Kolenbrander. 2007. Use of quantum dot luminescent probes toachieve single-cell resolution of human oral bacteria in biofilms. Appl. En-viron. Microbiol. 73:630–636.

7. Chan, W. C., and S. Nie. 1998. Quantum dot bioconjugates for ultrasensitivenonisotopic detection. Science 281:2016–2018.

8. Cisar, J. O., A. L. Sandberg, C. Abeygunawardana, G. P. Reddy, and C. A.Bush. 1995. Lectin recognition of host-like saccharide motifs in streptococcalcell wall polysaccharides. Glycobiology 5:655–662.

9. Cisar, J. O., A. L. Sandberg, G. P. Reddy, C. Abeygunawardana, and C. A.Bush. 1997. Structural and antigenic types of cell wall polysaccharides fromviridans group streptococci with receptors for oral actinomyces and strepto-coccal lectins. Infect. Immun. 65:5035–5041.

10. Collins, M. D. 1982. Reclassification of Bacterionema matruchotti (Gilmour,Howell and Bibby) in the genus Corynebacterium, as Corynebacterium matru-chotii comb. nov. Zentbl. Bakteriol. Mikrobiol. Hyg. Abt. 1 Orig. Reihe C3:364–367.

11. Daims, H., S. Lucker, and M. Wagner. 2006. daime, a novel image analysisprogram for microbial ecology and biofilm research. Environ. Microbiol.8:200–213.

12. Diaz, P. I., N. I. Chalmers, A. H. Rickard, C. Kong, C. L. Milburn, R. J.Palmer, Jr., and P. E. Kolenbrander. 2006. Molecular characterization ofsubject-specific oral microflora during initial colonization of enamel. Appl.Environ. Microbiol. 72:2837–2848.

13. Egland, P. G., R. J. Palmer, Jr., and P. E. Kolenbrander. 2004. Interspeciescommunication in Streptococcus gordonii-Veillonella atypica biofilms: signal-ing in flow conditions requires juxtaposition. Proc. Natl. Acad. Sci. USA101:16917–16922.

14. Hoshino, T., T. Fujiwara, and M. Kilian. 2005. Use of phylogenetic andphenotypic analyses to identify nonhemolytic streptococci isolated from bac-teremic patients. J. Clin. Microbiol. 43:6073–6085.

15. Hsu, S. D., J. O. Cisar, A. L. Sandberg, and M. Kilian. 1994. Adhesiveproperties of viridans streptococcal species. Microb. Ecol. Health Dis. 7:125–137.

16. Hughes, C. V., R. N. Andersen, and P. E. Kolenbrander. 1992. Character-ization of Veillonella atypica PK1910 adhesin-mediated coaggregation withoral Streptococcus spp. Infect. Immun. 60:1178–1186.

17. Hughes, C. V., P. E. Kolenbrander, R. N. Andersen, and L. V. Moore. 1988.Coaggregation properties of human oral Veillonella spp.: relationship tocolonization site and oral ecology. Appl. Environ. Microbiol. 54:1957–1963.

18. Kolenbrander, P. E., R. N. Andersen, D. S. Blehert, P. G. Egland, J. S.Foster, and R. J. Palmer, Jr. 2002. Communication among oral bacteria.Microbiol. Mol. Biol. Rev. 66:486–505.

19. Kolenbrander, P. E., R. N. Andersen, and L. V. H. Moore. 1990. Intragenericcoaggregation among strains of human oral bacteria: potential role in pri-mary colonization of the tooth surface. Appl. Environ. Microbiol. 56:3890–3894.

20. Kolenbrander, P. E., and J. London. 1993. Adhere today, here tomorrow:oral bacterial adherence. J. Bacteriol. 175:3247–3252.

21. Ludwig, W., O. Strunk, R. Westram, L. Richter, H. Meier, Yadhukumar, A.Buchner, T. Lai, S. Steppi, G. Jobb, W. Forster, I. Brettske, S. Gerber, A. W.Ginhart, O. Gross, S. Grumann, S. Hermann, R. Jost, A. Konig, T. Liss, R.Lussmann, M. May, B. Nonhoff, B. Reichel, R. Strehlow, A. Stamatakis, N.Stuckmann, A. Vilbig, M. Lenke, T. Ludwig, A. Bode, and K. H. Schleifer.2004. ARB: a software environment for sequence data. Nucleic Acids Res.32:1363–1371.

22. MacFarlane, T. W. 1977. A semiselective medium for the isolation of Veil-lonella species from the mouth. J. Clin. Pathol. 30:191–192.

23. Malinen, E., T. Rinttila, K. Kajander, J. Matto, A. Kassinen, L. Krogius, M.Saarela, R. Korpela, and A. Palva. 2005. Analysis of the fecal microbiota ofirritable bowel syndrome patients and healthy controls with real-time PCR.Am. J. Gastroenterol. 100:373–382.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

24. Mampel, J., T. Spirig, S. S. Weber, J. A. Haagensen, S. Molin, and H. Hilbi.2006. Planktonic replication is essential for biofilm formation by Legionellapneumophila in a complex medium under static and dynamic flow conditions.Appl. Environ. Microbiol. 72:2885–2895.

25. McBride, B. C., and J. S. van der Hoeven. 1981. Role of interbacterialadherence in colonization of the oral cavities of gnotobiotic rats infectedwith Streptococcus mutans and Veillonella alcalescens. Infect. Immun. 33:467–472.

26. Mikx, F. H., and J. S. van der Hoeven. 1975. Symbiosis of Streptococcusmutans and Veillonella alcalescens in mixed continuous cultures. Arch. OralBiol. 20:407–410.

27. Mikx, F. H., J. S. van der Hoeven, K. G. Konig, A. J. Plasschaert, and B.Guggenheim. 1972. Establishment of defined microbial ecosystems in germ-free rats. I. The effect of the interactions of Streptococcus mutans or Strep-tococcus sanguis with Veillonella alcalescens on plaque formation and cariesactivity. Caries Res. 6:211–223.

28. Mouton, C., H. Reynolds, and R. J. Genco. 1977. Combined micromanipu-lation, culture and immunofluorescent techniques for isolation of the coccalorganisms comprising the “corn cob” configuration of human dental plaque.J. Biol. Buccale 5:321–332.

29. Nyvad, B., and M. Kilian. 1987. Microbiology of the early colonization ofhuman enamel and root surfaces in vivo. Scand. J. Dent. Res. 95:369–380.

30. Palmer, R. J., Jr., P. I. Diaz, and P. E. Kolenbrander. 2006. Rapid successionwithin the Veillonella population of a developing human oral biofilm in situ.J. Bacteriol. 188:4117–4124.

31. Palmer, R. J., Jr., S. M. Gordon, J. O. Cisar, and P. E. Kolenbrander. 2003.Coaggregation-mediated interactions of streptococci and actinomyces de-tected in initial human dental plaque. J. Bacteriol. 185:3400–3409.

32. Palmer, R. J., Jr., R. Wu, S. Gordon, C. G. Bloomquist, W. F. Liljemark, M.Kilian, and P. E. Kolenbrander. 2001. Retrieval of biofilms from the oralcavity. Methods Enzymol. 337:393–403.

33. Paster, B. J., S. K. Boches, J. L. Galvin, R. E. Ericson, C. N. Lau, V. A.

Levanos, A. Sahasrabudhe, and F. E. Dewhirst. 2001. Bacterial diversity inhuman subgingival plaque. J. Bacteriol. 183:3770–3783.

34. Rinttila, T., A. Kassinen, E. Malinen, L. Krogius, and A. Palva. 2004.Development of an extensive set of 16S rDNA-targeted primers for quanti-fication of pathogenic and indigenous bacteria in faecal samples by real-timePCR. J. Appl. Microbiol. 97:1166–1177.

35. Rogosa, M. 1956. A selective medium for the isolation and enumeration ofthe veillonella from the oral cavity. J. Bacteriol. 72:533–536.

36. Rogosa, M., R. J. Fitzgerald, M. E. Mackintosh, and A. J. Beaman. 1958.Improved medium for selective isolation of Veillonella. J. Bacteriol. 76:455–456.

37. Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new methodfor reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406–425.

38. Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: MolecularEvolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol.Evol. 24:1596–1599.

39. Thurnheer, T., R. Gmur, E. Giertsen, and B. Guggenheim. 2001. Automatedfluorescent in situ hybridization for the specific detection and quantificationof oral streptococci in dental plaque. J. Microbiol. Methods 44:39–47.

40. Truper, H. G., and L. de’Clari. 1997. Taxonomic note: necessary correctionof specific epithets formed as substantives (nouns) in “apposition.” Int. J.Syst. Bacteriol. 47:908.

41. van der Hoeven, J. S., A. I. Toorop, and R. H. Mikx. 1978. Symbioticrelationship of Veillonella alcalescens and Streptococcus mutans in dentalplaque in gnotobiotic rats. Caries Res. 12:142–147.

42. Vickerman, M. M., S. Iobst, A. M. Jesionowski, and S. R. Gill. 2007.Genome-wide transcriptional changes in Streptococcus gordonii in responseto competence signaling peptide. J. Bacteriol. 189:7799–7807.

43. Yoshida, Y., S. Ganguly, C. A. Bush, and J. O. Cisar. 2005. Carbohydrateengineering of the recognition motifs in streptococcal coaggregation recep-tor polysaccharides. Mol. Microbiol. 58:244–256.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Characterization of a Streptococcus sp.-Veillonella sp ... · Streptococcus oralis (RPS bearing)...

Documents

Transcript of Characterization of a Streptococcus sp.-Veillonella sp ... · Streptococcus oralis (RPS bearing)...