Characteristics of the Genetic Material

• Any substance which form the heriatable material must fulfill some essential requirements and DNA was found to fulfill them all.

1- It is stable . 2- It is able to carry and transcribe information which are

required to control the processes which give the organism its specificity .( transcription )

3- It is capable of replicating exactly, so that the genetic determinants are transmitted down from cell to cell and from generation to generation unchanged .

4- It is able to mutate to give more variations .

Genome: entire complement of DNA molecules of each organism

Overall function of genome:

-Control the generation of molecules (mostly RNA & proteins) that will regulate the cell function and structure . - Transfer the genetic information from cell to cell ( cell division ) and from generation to generation

without change.

DNA Structure

• DNA is a nucleic acid.• The building blocks of DNA are nucleotides,

each composed of:– a 5-carbon sugar deoxyribose– a phosphate group (PO4)– a nitrogenous base• adenine, thymine, cytosine, guanine

Ribose and DeoxyriboseRibose in RNA

Deoxyribose in DNA

Pyrimidines

NH2

O

N

N NH

N

Guanine

N

N

Adenine

N

N

NH2

N O

NH2

N O

NH2

NCytosine

Purines

Uracil(RNA)CH3

N ON

O

NH

N ON

O

NH

Thymine(DNA)

Nucleosides and Nucleotides

Nucleosid is a base+sugar Nucleotide is nucleoside + phosphateNitrogen base is connected on C-1’ position of sugar

Phosphate commonly on C-5’ of sugar

DNA Structure

• Nucleotides are connected to each other to form a long chain

• phosphodiester bond: Covalent bond between adjacent nucleotides– formed between the phosphate group (attached

to 5’ carbon) of one nucleotide and the 3’ –OH of the of sugar of next nucleotide

– This bond is very strong, and for this reason DNA is remarkably stable.

– DNA can be boiled and even autoclaved without degrading

• The chain of nucleotides has a 5’ to 3’ orientation.

Double Helix of DNA• The clue to the structure of DNA came from two sourses:• the work of Erwin Chargaff and his colleagues in the late 1940s and

Rosalind Franklin and Maurice Wilkins work.• Base composition studies of Erwin Chargaff: 1. The base composition of DNA generally varies from one species to

another. 2. DNA specimens isolated from different tissues of the same species

have the same base composition. 3. The base composition of DNA in a given species does not change

with an organism’s age,nutritional state, or changing environment . 4. In all cellular DNAs, regardless of the species, the number of

adenosine residues is equal to the number of thymidine residues (that is, A T) ,and the number of guanosine residues is equal to cytosine.

• Chargaff’s Rule:• amount of adenine = amount of thymine• amount of cytosine = amount of guanine

Chargaff’s Rule

Double Helix of DNA

Rosalind Franklin and Maurice Wilkins 1950s– Franklin performed X-ray diffraction studies to identify the

3-D structure– discovered that DNA is helical– discovered that the molecule has a diameter of 2nm and

makes a complete turn of the helix every 3.4 nm

X-ray diffraction pattern of DNA. The spots forming across in the center denote a helical structure. The heavy bands at the left and right arise from the recurring bases.

The Watson - Crick Model Of DNA

• 1953 propose double helix model– Right-handed double helix– Chains antiparallel– Bases lie flat, perpendicular to long axis of chain– Bases pair by hydrogen bonds, A with T and C with G

• Two strands are complementary– 10 bases per turn (34 angstroms)

• Now known to be 10.4 or 34.6 degrees turn per bp)– Has a major and minor groove– Is 20 angstroms in diameter

complementary base pairing involve the formation of two hydrogen bonds between adinine and thymine, three hydrogen bonds between gauine and

cytosine.No other paire form in DNA

Schematic model

Space-filling model

The double helix consists of:• 2 sugar-phosphate

backbones• nitrogenous bases

toward the interior of the molecule• bases form

hydrogen bonds with complementary bases on the opposite sugar-phosphate backbone

General structural features

The DNA Double Helix

The double-bonded structure is stabilized by

1. Hydrogen bonding between complementary bases A bonded to T by two hydrogen bonds C bonded to G by three hydrogen bonds

2. Base stacking Within the DNA, the bases are oriented so that the

flattened regions are facing each other

General structural features

The DNA Double Helix

There are two asymmetrical grooves on the outside of the helix 1. Major groove

2. Minor groove

Certain proteins can bind within these grooves They can thus interact with a particular sequence of

bases

General structural features

The DNA Double Helix

Two strands are twisted together around a common axis

There are 10 bases per complete twist The two strands are antiparallel

One runs in the 5’ to 3’ direction and the other 3’ to 5’ The helix is right-handed

As it spirals away from you, the helix turns in a clockwise direction

Coding strand 5’→ 3’.Non-coding strand 3’ → 5’.-Stores genetic code as a linear sequence of bases.

≈ 20 Å in diameter

Human genome ≈ 3.3 x 109 bp

≈ 25,000 genes

DNA Double helix

DNA CharacterizationAbsorption Spectra

• Absorb light in ultraviolet range, most strongly in the 254-260 nm range

• Due to the purine and pyrimidine bases.• Useful for localization, characterization and

quantification of samples

DNA Characterization Denaturation of DNA

• Denaturation involves the breaking of hydrogen bonds– Disrupts the base stacking in the helix and lead to

increased absorbance at 260 nm(Hyperchomic effect)• By increasing temperature slowly and measuring

absorbance at 260 nm as melting profile can be generated– Temperature for midpoint of denaturation is called the Tm – Melting Temperature (Tm): Temperature at which 50% of

the dsDNA is denaturated to ssDNA.

Renaturation of DNA• When ssDNA is cooled graudly hydrogen bonds between bases

can reform and the DNA renatures.• During the renaturation, absorbance at 260nm is decreasing (Hypochromic effect).

TACTCGACATGCTAGCACATGAGCTGTACGATCGTG

Double stranded DNA

TACTCGACATGCTAGCACATGAGCTGTACGATCGTG

Double stranded DNA

Renaturation

TACTCGACATGCTAGCAC

ATGAGCTGTACGATCGTG

Denatured DNA

Denaturation

Single stranded DNA

• Denaturation Can be monitored by measuring absorption absorbance at 260nm.• When 2 strands are separated, absorbance may increase by 30-40%.

For dsDNA, A260=1.0 for 50 µg/mlFor ssDNA and RNA A260=1.0 for 38 µg/ml

Denaturation of DNA

DNA Denaturation

• Factors Affecting Tm

G-C content of sample – Increased G+C gives increased Tm

– 3 vs. 2 hydrogen bonds Presence of intercalating agents (anything that

disrupts H-bonds or base stacking) Salt concentration - Increased ionic strength also increases Tm

pH Length of the molecule

Determination of GC Content

OD260

0

1.0

65 70 75 80 85 90 95Temperature (oC)

Tm = 85 oCTm = 75 oC

Double strande

d DNA

Single stranded DNA

Relatively low GC

content

Relatively high GC content

Tm is the temperature at which half the DNA is melted