Chapter 4: DNA and the Production of Proteins Part 1 - DNA National 5 Biology Unit 1: Cell Biology...

Chapter 4: DNA and the Production of Proteins

Part 1 - DNA

National 5 Biology

Unit 1: Cell Biology

04/19/23 1Mrs Smith - National 5 Biology

Learning IntentionsNational 5 Biology


By the end of today’s lesson you should aim to:a.Understand the structure of DNA:

• Specifically that the double-stranded helix held by complementary base pairs, and that DNA carries the genetic information for making proteins.

• You should be able to describe that the four bases Adenine, Cytosine, Guanine and Thymine (A, C, G and T) make up the genetic code.

• And that A is always paired with T and C is always paired with G. • The base sequence determines amino acid sequence in protein.

b)Know through research the relationship between chromosomes, genes, DNA and protein to illustrate that genes are located on chromosomes. c)Be able to demonstrate DNA structure by construction of 2D or 3D DNA models (these must show base pairing!d)Carry out numeracy activities to Carry out numeracy activities to determine base pair numbers.

Watson & Crick proposed the double helix or spiral staircase structure of the DNA molecule in 1953.

In 1962 they were awarded the Nobel Prize for their work.

How are characteristics passed on?

What is DNA?

STARTER TASK: 10 minutes

In all living things, characteristics are passed on in the __________ that offspring ______ from their parents. Chromosomes are made of ____.

Passing on characteristics

chromosomesinherit

DNA

Chromosomes are long strands of genetic information (DNA molecules) located in the _________ of cells.nuclei

Where are chromosomes found?

19/04/23 Mrs Smith 7

one chromosome from mother

Every individual has two genes for each characteristic, one from mum and one from dad

• The chromosomes carry thousands of genes along their length.

• Each gene codes for a different physical characteristic.

• Different forms of genes are called alleles.• These alleles are in competition with each

other.• Some alleles are dominant and some are

recessive.• When a dominant allele pairs up with a

recessive allele, the dominant allele ‘wins’ and causes the final effect.

19/04/23 Mrs Smith 8

Each gene codes for a different physical

characteristic. How is this achieved?

Each gene codes for one ________!protein

Slight differences in the genes (giving different ______) code

for slightly different _______. This causes the differences in

characteristics called _________ between members

of the same species.

alleles

proteinsvariations

How do you think the four bases are paired?

There are ____ types of bases, and they are usually identified by their initials.

The double helix ‘ladder’ of a DNA molecule is held together by ‘rungs’ made from pairs of chemicals called ______. These strands are held together by weak bonds between the bases

adenine

cytosine

guanine

thymine

A

C

G

T

The Structure of DNADEOXYRIBONUCLEIC ACID

bases

four

A molecule of DNA consists of two strands twisted together into a double helix

http://news.bbc.co.uk/hi/english/static/in_depth/sci_tech/2000/human_genome/stage_3.stm

Base pairs hold the 2 strands of the DNA helix together.The rules for base pairing are…

There are millions of base pairs in a DNA molecule, and they always follow these rules.

‘A’ always pairs with ‘T’

It is the order of these bases along a DNA molecule that forms the ________ _____ – it’s that simple!

TA

Adenine Thymine

C G

Cytosine Guanine

‘C’ always pairs with ‘G’

genetic code

Sequence of DNA Bases

• The DNA of one member of a species differs from that of another member by order in which the bases order in their chromosomes.

• It is this sequence of bases along the DNA strand that is unique to an organism.

• The sequence contains the genetic instructions that control the organisms inherited characteristics.

Genetic code

• All region of DNA on a chromosome is called a gene and normally it is hundreds or even thousands of bases long.

• The information present in the DNA takes the form of a molecular language called the Genetic Code.

• Amino acids are the building blocks of proteins.• Each group of three bases along a DNA strand

represents a ‘Codeword’ for one of 20 types of amino acids that make up protein.

Task: Organism to base pair worksheet

• Cut out the names and definitions.

• Arrange the names i order of size.

• The largest at the top down to the smallest.

• Then match the definitions to the names.

Higher/ Extension work!

DNA is composed of 4 nucleotide bases A,T,C &,G arranged in pairs.

The backbone of DNA is based on a repeated pattern of a sugar group and a phosphate group. The full name of DNA, deoxyribonucleic acid, gives you the name of the sugar present - deoxyribose.

phosphate group

deoxyribose sugar

nucleotide base

C G

TA

Adenine Thymine

Cytosine Guanine

Remember adenine always pairs with thymine and vice versa. Guanine always pairs with cytosine and vice versa.

There are weak hydrogen bonds between the base pairs which hold the two strands together.The two strands are twisted to form a “double helix”.

DNA molecules are composed of hundreds of thousands of base pairs (A-T or G-C). The molecule is double stranded and has a ladder like structure - the base pairs forming the rungs and the strands the uprights.

20 minutes Using the materials provided make a model of part of a DNA molecule. You will have to use it as an aid to explain the structure of DNA.

TASK : Model DNA – In Groups

http://www.wikihow.com/Make-a-Model-of-DNA-Using-Common-Materialshttp://www.youtube.com/watch?v=iNztJjHKw98

TASK: DNA ORAGAMI – with template and You tube

http://www.youtube.com/watch?v=0jOapfqVZlo

TASK -Edible: Model DNAYOU NEED...• Sweets .e.g, cocktail sticks• Patience and Expertise

http://www.youtube.com/watch?v=QnpLMaWjhhc

Virtual build a DNA moleculehttp://learn.genetics.utah.edu/content/molecules/builddna/

http://www.youtube.com/watch?v=wdhL-T6tQco

Mr W’s DNA RAP

http://www.youtube.com/watch?v=wdhL-T6tQco

Cartoon

Numeracy activity (ps): Question1

• If there a section of DNA contains 24,000 bases and 20% are cytosine, how many adenine bases should there be?

A.2400B.4800C.7200D.14400


• If a DNA double helix contained 100 base pairs and there were 40 cytosines, how many adenines would there be?


• 20% of the bases in a DNA molecule are G. What % of the bases are A?

A.20%B.30%C.40%

Numeracy activity (ps): Question 4

• A piece of DNA contains 500 bases in total, 150 of these are adenine. What percentage of the DNA is adenine?


A fragment of DNA was found to have 120 guanine bases and 60 adenine bases. What is the total number of sugar molecules in this fragment?A.60B.90C.180D.360


A DNA molecule consists of 4000 nucleotides of which 20% contain the base adenine.How many of the nucleotides in this DNA molecule will contain guanine?A.800B.1000C.1200D.1600


How many adenine molecules are present in a DNA molecule of 4000 bases, if 20% of the base molecules are cytosine?A.400B.600C.800D.1200

Chapter 4: DNA and the Production

of ProteinsPart 2 – Protein

Synthesis

National 5 Biology

Unit 1: Cell Biology


Learning Intentions

National 5 Biology


By the end of today’s lesson you should be able to:

1.Describe that Messenger RNA (mRNA) is a molecule which carries a complementary copy of the code from the DNA, in the nucleus, to a ribosome, where the protein is assembled from amino acids.

2.Have performed research on leading biologists of this area, e.g. Watson and Crick, Rosalind Franklin, Maurice Wilkins, Chargaff.

Homework: Research task History of DNA Discovery

04/19/23 Mrs Smith - National 5 Biology 38

Watch this for homework:You can also look at pg 31 Torrance

http://www.youtube.com/watch?v=j3jRH2fXieY

What is it?

Proteins are needed for:

• Growth (including making new cells)• Repair of damaged tissue• Building structures

–Muscle–Bone–Skin–Hair–Enzymes–Antibodies–Hormones

Our bodies are made from hundreds of thousands of different kinds of _______.

Small differences in the proteins that our bodies are made of account for _______ ___________ between us.

______ code for the proteins, so small differences in our genes cause the differences between our proteins, and so the differences between us.

Each gene codes for one protein.

How the Genetic Code Works

protein

physical differences

Genes

Making proteins

• Proteins are long molecules made up of amino acids.

• There are 20 different types of amino acid from which to make proteins.

• Different combinations of amino acids make different proteins.

amino acid

protein molecule

protein molecule 1

What happens if the amino acids are in a different order?

For Example

protein molecule 2

amino acids

How does the cell know what order the amino acids should be in?

Genes, we can investigate this in organisms by locating genes on the chromosome.

By comparing 2 organisms with different traits for the same characteristic (e.g. eye colour) we can learn about the positioning and importance of genes on a chromosome.

The diagram shows two identical flies with the exception of eye colour. When chromosomes are compared their genes are identical. EXCEPT for one band present in red eyed fly but absent in white eyed fly.

How do Genes make proteins?

• Each amino acid is coded for by its own special sequence of three bases called a triplet.

triplet

amino acid

How do genes make proteins?

• The order of triplets in a gene determines the sequence of amino acids.

• The amino acids join together to form a protein molecule.

Once we have a chain of amino acids…

• … then the protein is folded to take on its final shape (the amino acid sequence has determined this shape).

• And it is this shape that allows each protein to perform its particular function.

Is that all there is to it?

NO!

It’s actually more complicated than that.

THINK!Where is DNA found?What structures make proteins?Where are they found?Watch the video on making proteins and see if you can find the solution…

http://www.youtube.com/watch?v=zwibgNGe4aY

The genetic code for proteins

The story of protein synthesis

BUT… DNA stays in the nucleus and proteins are built in the cell’s ___________.

Genes don’t make proteins – they just contain the _____________ on how to make them.

instructions

cytoplasm

So how does the coded information on the DNA get out into the cytoplasm?

DNA mRNA Protein

• DNA is kept in the nucleus to keep it safe.• A specific sequence of this DNA is a gene to make

a protein.• This sequence is copied, so it can be taken out of

the nucleus.• This copy is called messenger RNA (mRNA).• The mRNA takes the copied instructions out of

the nucleus and into the cytoplasm. • In the cytoplasm, the mRNA is ‘read’ by a

ribosome which uses the code to make the protein from amino acids.

DNA mRNA Protein

Complete the diagram using the following words:

Gene mRNA

Chain of amino acids

Ribosome

CellMembra

ne

NucleusDNA

DNA mRNA Protein

mRNA is a molecule different from DNA - can you suggest how?

• mRNA has only one strand not two like DNA

• In mRNA thymine is replaced by U (uracil)

A short section of mRNA

U

Not really National 5 work but in order to play genetic code games you

need to know this.

DNA inside the nucleus coding for a

protein.

DNA opens so that mRNA may be copied from it .

mRNA is made using DNA template. This

is called transcription.

mRNA peels off the DNA template.

mRNA goes out into the cytoplasm through a

nuclear pore.

A real mRNA molecule would be much longer than this - the length of

a whole gene.

mRNA travels to a ribosome.

mRNA moves into the ribosome so that the code it carries may be “read”.

Out in the cytoplasm special carrier molecules pick up amino acids.

Bases on the carrier molecules lock on to corresponding bases on mRNA.

This brings the amino acids into line with each other and they bond together.

The carrier molecules go off into the cytoplasm to collect more amino acids.

More carrier molecules continue to “read” the mRNA code adding amino acids and building the chain that will eventually become a protein.

TASK:To recreate the process by which a cell produces a

protein.

• Each group of desks represents a ribosome.

• The teacher’s desk is the nucleus. It contains the DNA sequence from which you are going to make your protein.DNA:ATCGGCATTCGCACGATCCGCAGCATT

INSTRUCTIONS

• One member of the group collect:Amino acidsSellotapeWhite board

• One member of the group should nominate themselves to be mRNA. You should come to the nucleus, “unzip” the DNA and transcribe the sequence.

• Sort the bases on the mRNA molecule into codons.

• Use the protein decoder to work out which codon makes which amino acid.

• Put your amino acids together in the correct sequence.

• Have your protein checked by the teacher.

Codon on mRNA Amino acid

GCG Pink

UAA White

UAG Blue

UCG Red

CCG Green

UGC Yellow

When the mRNA strand reaches the ribosome the amino acids must be joined in the order coded for by the mRNA strand.

Did you manage? - The Answers

DNA:ATCGGCATTCGCACGATCCGCAGCATT

mRNA:UAG CCG UAA GCG UGC UAG GCG UCG UAA

Amino acids: blue-green-white-pink-yellow-blue-pink-red-white

Activity: Codon Bingo

Activity: DNA and Proteins Bingo

cytosinesequence gene

double helixbase

thyminemessenger RNA

amino acid

twenty

adenine

ribosome

three

guanine

protein

shape

DNA

chromosome

Question time

• How many DNA bases code for each amino acid?

• Explain how different genes code for specific proteins.

• Humans have about 20,000 genes. The two members of each pair of chromosomes have the same genes on them. So, on average, about how many genes do you think there are on each of your chromosomes?

• When you eat proteins from meat, eggs or soya beans your body uses them to make the proteins in your cells and tissues. How do you think this happens?

What happens if…

Sometimes there are errors in the genetic code called mutations.

What do you think would happen if there was an error in the genetic code for the enzyme PAH, which breaks down phenylalanine from food into useful products for the body?

Phenylketonuria• If the code is wrong, the

protein is either not made or is faulty.

• In this case, the protein made has the wrong shape so can’t carry out its job to break down phenylalanine.

• Instead the concentration of phenylalanine builds up in the body to toxic levels.

A DNA Story

Your cast:

DNA is a recipe book

The nucleus is a library

The gene is a recipe for apple pie

mRNA = copy of the recipe

The ribosome is a kitchen

The protein made is an apple pie

Your Instructions:

• Write a story, or draw a comic about how DNA is copied and turned into protein.

• It will feature a specific cast of characters and explain how all of the parts work together.

Now collect the cut and use it to tell your neighbour the story of protein synthesis.

Do not cut around every base as this will be too

fiddly and takes ages. Just cut up to very near the

bases as shown so that you can match them up with

corresponding bases.

ALTERNATIVE STORY ACTIVITY

Articulate!

Ribosome

Cytosine

Messenger RNA

Chromosome

Adenine

Amino Acid

Double helix

Thymine

Protein

Guanine

Task TYK

• Complete questions 1 – 3. Torrance p33


Task TYK – How did you do??


Homework: DNA and protein production

04/19/23 Mrs Smith - National 5 Biology 93

Chapter 4: DNA and the Production of Proteins Part 1 - DNA National 5 Biology Unit 1: Cell Biology...

Documents

Transcript of Chapter 4: DNA and the Production of Proteins Part 1 - DNA National 5 Biology Unit 1: Cell Biology...