Ch. 12.2: Replication of DNA Section objective: Summarize DNA replication.
Ch. 5.3 DNA
28
Ch. 5.3: DNA & Genetics
Transcript of Ch. 5.3 DNA
Before the 1950s, we knew that: Inherited characteristics are determine by
genes.Genes are passed from one generation to the
next.Genes are part of a chromosome.Cells divide. Before they divide, they have to
copy their structures, organelles, & their genetic information.
1. What scientists contributed to our understanding of DNA?
1. What scientists contributed to our understanding of DNA?
But…
What did DNAlook like, and how did it replicate itself?
1. What is DNA?• An organism’s genetic
material, made up of nucleotides
• deoxyribonucleic acid• A gene is a segment of
DNA on a chromosome that provides directions for making proteins.
1. What scientists contributed to our understanding of DNA?
2. Rosalind Franklin (1920-1958)
• Made significant advances in X-ray diffraction techniques with DNA
• Her images showed that DNA had a spiral shape
1. What scientists contributed to our understanding of DNA?
2. Maurice Wilkins (1916-2004)• Worked with Rosalind
Franklin with X-ray diffraction studies of DNA
• Shared info. with Watson & Crick
1. What scientists contributed to our understanding of DNA?
Erwin Chargaff (1905-2002)• Investigated composition of
DNA• In 1950, he discovered base-
pairings of A-T & G-C
1. What scientists contributed to our understanding of DNA?
3. James Watson (1928) & Francis Crick (1916-2004)
• Worked together to determine DNA’s structure
• Determined DNA’s double helix shape
• Watson, Crick, & Wilkins were awarded the Nobel Prize in 1962 (Franklin passed away beforehand)
1. What scientists contributed to our understanding of DNA?
4. DNA is shaped like a double helix, which is like a twisted ladder.
2. What is the structure of DNA?
5. A nucleotide is a molecule made of: Nitrogen base,
• 6. There are 4 nitrogen bases: adenine (A), cytosine (C), thymine (T), and guanine (G)
• Nitrogen bases bond and form the rungs of the ladder.
Sugar-phosphate group• Sugar-phosphate groups form the sides of the
DNA ladder.
2. What is the structure of DNA?
7. Certain bases always bond together: A – T and C – G.
2. What is the structure of DNA?
8.
DNA – What does my code look like?Computer Code:
10010100111010001100101001110010111100101001001001001011100101000101010010010100101010010010100101001010100101001010010101010101001010100101010111111100
DNA Code:
ATTCGGGGCCTTAAGACATTAATTTCCCAAGAAGAGATAAACTAGAGAGACCCTTTAAAACACACAGAGATAGACAGAAAAACAATAGACAGATACAGATAGACATAAAAAATTTTTTGGGAAA…millions and millions of bases…
9. Replication is the process of copying a DNA molecule to make another DNA molecule.
2. What is the structure of DNA?
DNA replication – two identical strands of DNA
Original DNA strands
10. Mutation occurs when the sequence of nucleotides is changed in a gene.
Insertion – more added Deletion – some deleted Substitution – some swapped
mutationfrom Latin mutare, means “to change”
3. How do changes in the sequence of DNA affect traits?
• The 46 human chromosomes contain between 20,000 and 25,000 genes that are copied during replication.
• Mutations can be triggered by exposure to X-rays, ultraviolet light, radioactive materials, and some kinds of chemicals.
3. How do changes in the sequence of DNA affect traits?
The 3 types of mutations are substitution, insertion, and deletion.
3. How do changes in the sequence of DNA affect traits?
Which of the following describes the mutation that occurs when three base pairs are added?
a. b. c. d.
0 000
a. Insertionb. Substitutionc. Transgressiond. Deletion
45
Which of the following describes an error made during the copying of DNA?
a. b. c. d.
0 000
a. Transcriptionb. Replicationc. Translationd. Mutation
45
• The effects of a mutation depend on where in the DNA sequence the mutation happens and the type of mutation.
• Some mutations in human DNA cause genetic disorders.
• Some mutations can be beneficial for the organism, even helping it survive diseases.– If a person only has 1 sickle cell allele (not both),
they are more resistant to malaria.– If a person is born with Type AB blood, they can
accept donations from all other blood types.
3. How do changes in the sequence of DNA affect traits?
In DNA, which of the following is true?
A. B. C. D.
0 000
A. adenine bonds with guanineB. cytosine bonds with adenineC. thymine bonds with adenineD. none of the above
45
