Cellular, Elemental,and MolecularBuilding Blocksof Living Systems

Learning Objectives

The goals for the student are:

■ Know the names of the three basic cell types, their relationships, and theircharacteristics.

■ Know the modern basis for classifying cells into different general types.■ Know the difference between genotype and phenotype.■ Know how information is encoded by deoxyribonucleic acid (DNA) and what

some “safety factors” are that protect against mutation.■ Be able to rank-order the elemental and molecular abundance for a typical cell

to enable cell-level calculations.■ Know the difference between a virus and a prion.

1.1 | Purpose of This Chapter

About the time the American War between the States was being fought, LouisPasteur, Robert Koch (http://www.nobel.se/medicine/laureates/1905/koch-bio.html),Jean Jacques Theophile Schloesing, and others demonstrated that small, unicellularorganisms exist. Moreover, their work showed that these cells are agents of infection,alcohol production in wine, and global nitrogen cycling.

Roughly a century later, Western Pennsylvania native Herbert Boyer (see http://www.accessexcellence.com/AB/BC/Herbert_Boyer.html) and his colleague, StanleyCohen, inserted the genetic material from a toad into a common intestinal bac-terium. The result was that the bacteria’s synthetic machinery produced a moleculefound in a vastly different species. The intriguing prospect that bacteria could beused as factories for producing complex biological molecules with therapeutic value,

19

C H A P T E R

11C H A P T E R

20 Chapter 1 Cellular, Elemental, and Molecular Building Blocks of Living Systems

such as insulin, led Boyer and Robert Swanson to form the company Genentech.Much has happened in a short time, and information on molecular biology contin-ues to expand at a bewildering pace.

Whether a bioengineer is involved with designing an artificial heart or devel-oping a production process for cell-derived insulin, some knowledge of modernmolecular and cell biology is needed to interact with other experts in order to renderthe best possible design. Moreover, such knowledge is needed to fully appreciate theultimate positive (and potential negative) impacts of the product or system on apatient’s health. Indeed, ample examples exist that illustrate that adverse conse-quences can result when biological factors such as immune system reactions are notconsidered or rapidly responded to when new scientific information becomes avail-able. The rapid breakdown of a jaw joint implant and the resulting immune systemactivation provides one notable historical example (http://www.fda.gov/bbs/topics/NEWS/NEW00249.html).

In an effort to review your prior studies and to provide a basis for understandingthe topics in this text, this chapter will provide an overview of the basic vocabularyand philosophies of biological science. The focus will be at the cellular level becausecells are the building blocks of living systems. Additional details will appear in subse-quent chapters to allow for applications. In general, mastering the vocabulary andconcepts of biological science will empower you to interpret and utilize scientific find-ings in engineering efforts. First, origins and divergence are covered. Thereafter, theelemental and molecular components of cells will be described. This chapter concludeswith a summary of physiology, viruses, and prions in order to provide a complete viewof the diversity within the world of replicating biological systems. Follow-up studiesof biochemistry and cell physiology will empower you further.

1.2 | Origins and Divergence of Basic Cell Types

Biological science has traditionally provided useful ways to classify living systems.These classifications provide a way to group similar cells and organisms. Throughclassification, a vocabulary is also provided so different people can discuss issues ina coherent manner. This is akin to naming clouds as nimbus or cumulus. Such terms,while arbitrary, allow one to succinctly describe and discuss local weather withsomeone else at another location, given that the terms and meanings are agreedupon. The science of classification is called taxonomy; the word is derived from theGreek root taxo (to organize or put into order). The organization of life by ancestor-descendent (evolutionary) relationships is called phylogeny.

More recently, biology has entered an era of molecular determinism. It is nowpossible to identify what molecules are engaged in transmitting parental traits to off-spring, guiding the development of an embryo to a complex organism, and so on.Additionally, elucidating the different ways by which molecules function together toelaborate reproduction, repair injuries, provide locomotion, and confer other salientfeatures of living organisms is of keen interest. The established molecular basis,which describes how cells function at the mechanistic rather than the behaviorallevel, has been used to challenge and alter prior classification schemes. We will firstreview the current classifications of cells. After discussing elemental and molecular

1.2 Origins and Divergence of Basic Cell Types 21

Eucarya

Bacteria

Microsporidia

Archaea

Slime molds

Aquifex

Thermotoga

Flavobacteria

Green non-sulfurbacteria

Cyanobacteria

Gram positive

Purple bacteria

PyrobaculumPyrodictium

SulfolobusDesulfurococcus

ThermoproteusThermofilum

Methanopyrus

Thermococcus

Methanobacterium

Methanothermus

Halobacterium

HalococcusArchaeaglobus

Mc. jannarchii

Mc. igneus

Mc. thermolithotrophicus

Mc. venniallii Methanosarcina

Methanoplanus

Methanospirillum

Ciliates Animals Plants Fungi Flagellates Diplomonates

FIGURE 1.1 Cellular life is viewed as splitting into three groups and originating from a common ancestor.

constituents of cells and information storage and utilization, an example of how theclassification scheme was developed will be provided.

The current classification of cell types and how they are thought to have evolvedfrom a common ancestor is shown in Figure 1.1. The three types are bacteria,Archaea, and Eucarya. Bacteria are unicellular organisms that are capable of repro-ducing. They vary in size and shape; a typical dimension is 1 µ Bacteria arefound in a wide range of environments and exhibit different capabilities. The rod-shaped bacterium, Escherichia coli, for example, can use just glucose and inorganicsalts as raw materials for growth and multiplication. Figure 1.2 shows what these bac-teria look like. Other bacteria exist in parasitic or symbiotic relationships. They mustacquire some raw materials from the host or symbiont for growth and multiplication.

Bacteria can be agents of disease. For example, a Streptococcus infection resultsin “strep throat” and a week off from school or work. Worse yet, George Washingtonis believed to have perished from a Streptococcus infection because the antibiotics wenow take for granted were not available in the 1700s. However, without the activityof bacteria, life as we know it would be quite different. Bacteria break down pollu-tants and organic matter in the environment, thereby allowing elements and chemicalbuilding blocks to reenter food chains and nutrient cycles. Additionally, some bacteria

(10-6 m).

22 Chapter 1 Cellular, Elemental, and Molecular Building Blocks of Living Systems

FIGURE 1.2 A transmis-sion electron micrographof the bacterium E. coli.

in the digestive systems of animals convert ingested food molecules into essential vita-mins. Indeed, bacteria constitute a large fraction of the functional biomass found onthe living surface of the Earth. Finally, bacteria are among the workhorses of thebiotechnology industry. Through genetic manipulation, they can be programmed toproduce pharmaceutical products such as insulin. Biotechnologists and biochemicalengineers work on harnessing this productive potential.

The Archaea are similar to bacteria in many respects. They are about the samesize and grow on a number of raw materials. One difference is they tend to be foundin more extreme environments. These environments include hot springs and acidicwaters. These environments are thought to resemble those found in the early days ofthe Earth, so Archaea are viewed as ancient remnants of the past. Their ability toprosper in extreme environments has also piqued interest about the possibility of lifebeyond the Earth. Because Archaea live in extreme environments, others view theirproteins and other biological molecules as being potentially unique sources of cata-lysts and medicinal compounds. As will be detailed later in this chapter, the chemicalcomposition of some molecules found in Archaea also differs from bacteria, whichallows for their identification and definition in precise molecular biological terms.

Eucarya include the cells that compose our body. One distinguishing feature isthese cells have compartments within them. Consequently, Eucarya are viewed asmore complex and evolved than bacteria and Archaea. These compartments arecalled organelles. One important organelle is the nucleus, which houses the DNAmolecule. The DNA molecule(s) encodes all the information for building the cell andconferring it with function.

In animals, cells can be either primitive or terminally differentiated, or fall inbetween these two extremes. The former means that when certain chemical or othersignals are received, a particular cell can be activated to form another type of cell.Bone marrow stem cells provide one example. When quiescent, they exist in modestnumbers in the bone marrow mass. When certain signals are transmitted and received,however, these stem cells start replicating and transforming themselves into the cells ofthe immune system, red blood cells, or other cells that the body requires. The transfor-mation into a specialty is called differentiation.

A terminally differentiated cell is one that has undergone the change in functionand, in the process, has lost the ability to replicate. The platelets found in the blood-stream provide one example. Platelets participate in wound healing, which will bepresented in more detail in Chapter 12, when biomaterial engineering is introduced.

The ability of some cells to differentiate has excited those interested in repair-ing or regenerating diseased organs. Many researchers envision that primitive cells

1.3 Elemental and Molecular Composition of a Cell 23

can be activated and coaxed to divide and grow into a functional tissue or organ.This possibility is the basis for one line of research in the field, tissue engineering.Tissue engineering is the practice of growing cells in a controlled manner such thatthe spatial organization and metabolic attributes of healthy organs or tissues areattained. The example of using (presumed) stem cells to grow a replacement retinafor vision-impaired patients will be provided in Chapter 8.

1.3

|

Elemental and Molecular Composition of a Cell

1.3.1 Elemental Abundance

Cells and thus humans are mostly water. A typical cell is about 70 percent water,and on a water-free basis, the mass is 50 percent by weight carbon. Nitrogen andphosphorus are the next most abundant elements; they typically constitute 14 and4 percent of the water-free mass, respectively. That means for 1 g of cells, there is 0.3 gof water-free material and of that mass, carbon, nitrogen, and phosphorus are pres-ent as 0.15, 0.04, and 0.01 g, respectively.

1.3.2 Protein and Amino Acids Constituents

As is the case for the elemental composition, some molecules are more prevalentthan others. Working again on a water-free basis, protein is the most abundant mol-ecule in terms of mass percentage and a typical value is 60 percent. A protein is apolymer of amino acids, as shown in Figure 1.3. The polymer nature of the protein

FIGURE 1.3 A protein chain consists of different connected combinations of 20 aminoacids. All amino acids have an α carbon (bold), to which an acidic carboxyl group (COOH)and an amino group ( ) are attached. The other group attached to the α carbon variesand distinguishes one amino acid from another. Two common amino acids are alanine andglutamic acid.

NH2

Chain of amino acids

Alanine

OH

OH

NH2

C

H

H

H

C C

Glutamic acid

OH

OHH

HH

H

CO

O

H C C C C

NH2

24 Chapter 1 Cellular, Elemental, and Molecular Building Blocks of Living Systems

molecule means that individual acids are connected to make a long chain. The chainthen folds upon itself to form an organized globular or rod-like structure. As will bediscussed further in Chapters 3 and 5, the particular three-dimensional shapeattained contributes immensely to the functionality of the protein.

As the structures in Figure 1.3 indicate, an amino acid derives its name from thefact that an amino group is attached to a carbon that is adjacent to an acidic

carboxyl moiety (COOH). What is linked to the carboncan vary, so a general amino acid is often denoted as , wherethe “R” symbol indicates that different combinations of elements can be attached tothe defining portion of the molecule. There are 20 common amino acids, and so thereare 20 different R groups. Glutamate is a very prevalent amino acid found in cells; itis also the active component of the seasoning monosodium glutamate, which is oftenreferred to as MSG.

Some cells can make all 20 amino acids. In other cases, some amino acids mustbe provided by food intake; hence, those amino acids are referred to as “essential (orrequired) amino acids.” As Table 1.1 summarizes, humans require nine amino acidsto be provided by dietary intake. Rats and humans have the same amino acid require-ments, whereas some bacteria can synthesize all 20 from sugars and inorganic salts,which raises an interesting question about the definition of an “advanced” versus a“simple” organism.

Within a cell or our bodies, proteins perform multiple functions. They can, forexample, serve as structural elements, as represented by the collagen fibers in theskin. As discussed in later chapters, proteins can also bind to other molecules toenable the turning on and off of different events. The acceleration (i.e., catalysis) ofbiochemical reactions is also mediated by special proteins called enzymes, whichwill be discussed further in later chapters.

R-CH(NH2)-COOHNH2-bearing(H+ yielding)

(NH2)

TABLE 1.1

Essential versus NonessentialAmino Acids

Nonessential Essential

Alanine Histidine

Arginine Isoleucine

Asparagine Leucine

Aspartate Lysine

Cysteine Methionine

Glutamate Phenylalanine

Glutamine Threonine

Glycine Tryptophan

Proline Valine

Serine –

Tyrosine –

1.4 Molecules That Contain Information 25

1.4 | Molecules That Contain Information

The DNA molecule is less abundant than protein (a few mass percent on a water-free basis), but its structure-endowed function is extremely important. The DNAmolecule contains all the instructions for producing every molecule currently in thecell as well as those that could have some future use if environmental conditionschange or differentiation occurs. Four bases are linked in varying patterns to buildthis biopolymer. The four bases are adenine (A), cytosine (C), guanine (G), andthymine (T). The DNA found in cells contains two strands, sometimes called aduplex or double-stranded DNA. Attractive forces between A and T, as well as Gand C, hold the two strands together and contribute to establishing the coil spring-like structure of DNA. The association of A (or G) on one strand with T(or C) on the other strand is called base pairing.

The sequence in which the A, C, G, and T bases appear on a strand is veryimportant because of the existence of the genetic code. To illustrate how the geneticcode works in conjunction with the composition of DNA, consider a protein com-posed of 20 amino acids. The amino acids must be linked in a particular order for theprotein to fold properly and perform its function. This is accomplished by devoting astretch of the DNA molecule for recording the recipe for this protein. This stretchcontaining the recipe is known as a (structural) gene. Within the stretch, the A, C, G,and T bases are linked according to a code to provide the instructions for linking theprotein’s amino acids in the correct order. The linkage is such that the information isread in a set direction, much the way a cassette tape is “read” in a fixed direction sothe recording and playback of music are consistent and intelligible.

1.4.1 How Information and Language Are Imbedded in DNA

Every three bases code for one amino acid; a set of three bases is called a triplet.Each amino acid has its own triplet(s), just like we have unique phone numbers. Forexample, GAA and GGG encode for the amino acids glutamate and glycine, respec-tively. So, if the first two amino acids that appear in the protein are glutamate andglycine, the bases will appear in the gene in the order GAAGGG. Since there are 20amino acids in the protein, there will be 20 triplets, and thus a total of 60 bases areneeded to code for the protein.

Basic information theory suggested why triplets are used and provided priorresearchers with some hints as to what to look for when trying to crack the geneticcode. When one has n letters to work with, the number of unique words consistingof a specified number of letters, m, is That is, when developing a language witha given alphabet, there is a maximum number of unique words of fixed length thatcan be assembled from the alphabet. To illustrate, consider an alphabet consisting ofthree letters, A, B, and C. The formula indicates that the number of two-letter wordsis We can work out the unique two-letter words by hand to verify the for-mula; the words are

AB AC BCBA CA CBAA BB CC

32= 9.

nm.

a-helical,

26 Chapter 1 Cellular, Elemental, and Molecular Building Blocks of Living Systems

When there are four letters (A, G, C, T) in the alphabet, there must be at least 20words in order to encode for the 20 common amino acids. If two-letter words wereused (e.g., AA, AT, GC), we come up short because there are only uniquewords. If, instead, three-letter words were used to encode for the 20 amino acids, thelanguage now has words, which is more than sufficient. The 44 extra wordsmeans that synonyms exist in the genetic language in that some amino acids may beencoded by more than one triplet. However, no two amino acids share a triplet. Someextra words can also be used for indicating where genes begin and end.

1.4.2 Mutation, Phenotype, and Genotype

Sometimes the code is altered when a cell makes a copy of its DNA during reproduc-tion. The large number of bases in a DNA molecule and the multitude of cell divi-sions that can occur over an animal’s lifetime means that even if the error rate in thecopying process is low, mistakes can occur. This is akin to airplane safety. Strict andeffective maintenance standards exist, and the average person’s odds of being in anaccident are low, but the large number of passenger-miles still results in an accidentnow and then. Chemicals found in the environment or other factors may also mod-ify the DNA molecule and thus the coding it contains. An alteration in an organ-ism’s genetic code is called a mutation.

When the code is altered, there may be no effect because a triplet may be changedinto another that can code for the same amino acid. Thus, the same protein can be pro-duced. For more radical changes in base sequence, the instructions may no longerfaithfully produce a fully functional protein. However, even such a mutation may notnecessarily result in the death of a cell or an animal. Rather, the ability to contendwith only one situation may be impaired, while other functions can be fulfilled.

Because an offspring receives some DNA coding from the parent(s), a muta-tion can be inherited. Hemophilia, which arises when the gene that codes for ablood-clotting protein (factor VIII) is mutated, is a classic example. A person carry-ing that mutation can function fine until injured by a cut or bruised. Then, excessivebleeding occurs, which can be lethal.

What traits an organism presents is called the phenotype and the traits are linkedto the instructions encoded in the DNA. The raw instructions are, in turn, called thegenotype. Modern molecular biology tools have allowed researchers to unravel thegenotype of organisms ranging from bacteria to humans. The existence of synonymsin the genetic code and other issues, however, have posed the challenging problem ofrelating an organism’s phenotype to genotype. Research is now under way that isaimed at trying to more fully understand how genotype and phenotype are linked.

1.4.3 Using the Information in DNA

The information present in the DNA molecule is “read out” via other molecularmachinery. First, a photocopy of a gene is made, much like what you do when yougo to the library. The full volume remains on the shelf and serves as an archivalcopy. You copy only the particular section of text you immediately need. The bio-molecular “photocopy” is called messenger RNA (mRNA) and the copying processis referred to as transcription. More details on this will be provided in Chapter 5where binding is covered in more mechanistic and mathematical detail.

43= 64

42= 16

1.4 Molecules That Contain Information 27

The sequence information now copied on the mRNA molecule is thentranslated and utilized by large molecular complexes called ribosomes. The ribosomesfirst bind to the mRNA copy. Then the ribosomes move down the length of themRNA molecule. At each triplet, a ribosome, in a sense, pauses and allows for thetriplet-prescribed amino acid to be added to the growing protein molecule at pre-cisely the right position. This process resembles how you read a sentence. Your eyemoves from left to right and each word has a particular significance to you. At theend of the sentence, all the words combine to convey a particular thought. Thus, thetriplets are akin to words, and the sequence of amino acids that leads to a proteinthat executes a particular function is analogous to a complete sentence. The unit ofsequence information that encodes for an amino acid is also called a codon.

1.4.4 Copying DNA in the Laboratory

Through the study of cells, the enzymes that enable a cell to copy its DNA for pas-sage on to a progeny cell have been well established. When a process such as DNAreplication occurs within an intact cell, it is called in vivo DNA replication. Manyaspects of how cells replicate their DNA can now be reproduced in the laboratorywithout intact cells. When a subset of cellular components is used in, for example, atest tube, to perform a task, the reproduced natural process is said to be performedin vitro (e.g., “in vitro DNA replication”).

Three important enzymes have emerged. Restriction endonuclease enzymes cutDNA where particular base sequences occur. For example, a particular restriction maycut after the occurrence of a GGCC sequence. The result of treating DNA with this par-ticular restriction enzyme is the creation of fragments with sticky ends as shown here:

ATACCGTAGGCCATTAGATCTGGCCTATGCGATATGGCATCCGGTAATCTAGACCGGATACGCT

ATACCGTAGGCC ATTAGATCTGGCC TATGCGATATGGCAT CCGGTAATCTAGA CCGGATACGCT

The ends are “sticky” because they have a tendency to form a base pair with any com-plementary four-base sequence. There are numerous restriction enzymes and they nor-mally occur within cells, because one useful function they can perform is thedestruction of foreign DNA, such as that from a virus. DNA ligase is an enzyme thatseals breaks that occur within a strand in a duplex. This enzyme is thus useful forrepairing DNA when breaks occur. Finally, DNA polymerase is an enzyme that cat-alyzes the synthesis of duplex DNA from one strand when a primer is used to start theprocess. How the primer-based synthesis works is shown in the following sequence:

ATACCGTAGGCCATTAGATCTGGCCTATGCGA Single strandTATGG Primer

ATACCGTAGGCCATTAGATCTGGCCTATGCGATATGGCATCCGGTAATCTAGACCGGATACGCT.

Performing these reactions in vitro is the basis for technologies such as gene amplifi-cation and crime scene investigation. To illustrate the former, suppose the sequence

� DNA Polymerase � G � C � A � T :

28 Chapter 1 Cellular, Elemental, and Molecular Building Blocks of Living Systems

of at least the start of a gene is known, and it is desired to amplify the amount of DNAthat encodes for the gene. Having more DNA would facilitate further study of thegene’s properties, possibly through other recombinant DNA efforts where that gene’sDNA is inserted into a bacterium or another cell in order to synthesize a large quan-tity of protein encoded by that gene. A primer can be first synthesized with a genemachine. This machine adds the bases A, T, G, and C in the order specified by the userto create short to moderate chains of single-strand DNA.

When the primer is added to the single-strand DNA, the DNA is single stranded,except where the primer is bound as in the previously shown primer sequence.Allowing DNA polymerase to do its work will extend the primer so that a doublestrand of DNA is produced. If this duplex is heated, it will fall apart into two singlestrands, because the thermal energy exceeds the strength of the G-C and A-T associa-tions; this is akin to the “melting” of a material. Primers can again be added and DNApolymerase used to extend the newly added primers according to the instructions pro-vided in the single strand. Overall, the process began with a single strand-primer com-bination. Each time DNA polymerase is used, the total number of single strands ofDNA is doubled. Twenty doublings is a significant gain and leads to a million-foldincrease in the amount of DNA originally present. The temperature and polymeriza-tion cycling that reproduces DNA in a geometric fashion is known as the polymerasechain reaction (PCR).

PCR and restriction enzymes find practical uses outside life science or biotech-nology laboratories. DNA from blood, hair follicles, or other samples from a murderscene can be cut with restriction enzymes to produce a fragment profile that has a highprobability of belonging to one person, much like each person has a distinctive finger-print. PCR can be used to increase the amount of DNA obtained from a crime scenesample. Such DNA fingerprinting is powerful because given the size of the total popu-lation in an average city, there will be a considerable number of people possessing anyparticular blood type. Thus, even if the victim’s blood type is found on a suspect’sclothing, the odds are high that the blood may not belong to the victim; hence, a com-pelling case requires additional evidence. However, if there is a match between the vic-tim’s DNA and that from blood found on the suspect’s clothing, then the situationstarts to look worse for the suspect’s defense. Conversely, as was found in the earlyuses of the technology, some convicted suspects were later exonerated by reanalyzingarchived crime scene evidence with modern in vitro DNA technology.

1.5

|

Unique versus Interchangeable Parts Leadsto Molecular-Based Classification

A ribosome is composed of different parts that enable mRNA binding and aminoacid addition. The parts are called subunits. They are characterized and distin-guished by how apt they are to settle while being spun in a centrifuge. Based onsuch physical sorting, they are assigned S-values, where S stands for a Svedbergunit; the larger the value of S, the more readily a part settles to the bottom of a cen-trifuge tube. The unit bears the name of the researcher who studied the behavior ofmacromolecules and small particles. For his work, Theodor Svedberg (1884–1971)received the Nobel Prize in 1926 (http://www.nobel.se/chemistry/laureates/1926/svedberg-bio.html).

1.6 Cellular Anatomy 29

One key part of a ribosome is the 16S rRNA component, which is found in the30S subunit along with proteins. Many seemingly different cells appear to have inter-changeable parts in that the 16S RNAs found in the ribosomal subunits have similarmolecular compositions and S-values. Consequently, the genes that encode for the16S RNAs that arise in seemingly different cells exhibit similar base sequences. Whenthere is a high degree of base overlap in a coding sequence, the DNAs from differentsources are said to exhibit high homology.

Other cells, however, have been found to possess significantly different compo-nents that make up the intact ribosome. The S-value can vary slightly. For example,in eucaryotic cells, the rRNA that corresponds to the 16S rRNA “part” in bacterialcells actually “weighs in” somewhat higher at 18S. More notably, the encodinggenes show low homology. Thus, cells are grouped together based on the homologyof their 16S rRNA-encoding genes. This means of categorization is akin to lumpingOldsmobiles and Chevrolets together as General Motors products because their fuelpumps are interchangeable. Toyotas, in contrast, have quite different fuel pumps, sothey belong in another group of automobile types. The phylogenic outlook shown inFigure 1.1 is based on 16S rRNA comparisons.

1.6 | Cellular Anatomy

Portraits of typical animal and bacterial cells are shown in Figure 1.4. While mostcells have similar anatomical details such as a plasma membrane, distinguishing dif-ferences exist that can radically alter a cell’s properties or capabilities. For example,a red blood cell and a bacterium both have a plasma membrane that encapsulates all

FIGURE 1.4 Some basic features that bacterial and eucaryotic cells share and also differ by.The bacterial cell on the left has a rigid cell wall, flexible plasma membrane, and a protein-richcytoplasm that also contains DNA and ribosomes. A eucaryotic cell is typically larger than a bac-terial cell (figure not to scale) and it also possesses a plasma membrane and a protein-rich cyto-plasm. However, its DNA and energy-producing capability are housed in different organelles(nucleus and mitochondria). Eucaryotic cells possess other organelles that are not shown.

Plasma membrane

DNA

Ribosomes

Cell wall

Protein-rich cytoplasm

Mitochondria

30 Chapter 1 Cellular, Elemental, and Molecular Building Blocks of Living Systems

the water and molecules in the cell’s interior. However, bacteria have an outer enve-lope that provides more mechanical strength, thereby allowing bacteria to survive ina greater range of physical and chemical environments. Figure 1.4 also illustrates thecompartmentalized nature of the Eucarya.

1.7 | Cellular Physiological Lifestyles

The requirements of a functioning living system will be discussed in more detail inChapter 3. Here, an outline of the essentials is provided. Whether one considers abacterium or a moose, there are two invariant requirements: (1) an energy sourcemust be available, and (2) raw materials must exist for building molecules.

Energy is obtained from oxidizing molecules that are imported into the cell.For example, many cells can derive energy from oxidizing a molecule such as glu-cose. When glucose (C6(H2O)6) is oxidized, the reaction is

Living systems have devised ways to store and direct the use of the energy releasedfrom oxidation so that less is immediately lost as heat. Instead, the energy is used todrive the synthesis of proteins and other molecules. Some heat generation still doesoccur, as, for example, our 98.6°F body temperature attests.

The raw materials needed for growth are defined by the elemental compositionas well as the amino acid and other special requirements. Often an energy sourcesuch as glucose can serve as an energy and raw material (carbon) source. However,sources of nitrogen, phosphorus, and other elements must also exist because a mol-ecule like glucose contains only C, H, and O. Often these other nutrients are foundin salts or other dietary intakes. When a cell derives its energy from the oxidation ofan organic compound, it is said to have heterotrophic metabolism.

Ample cases exist in nature where the energy and carbon source are not thesame. An interesting example is provided by the bacteria that enable ore leaching.These bacteria use the energy liberated when iron sulfides (e.g., in pyrite) andother minerals are oxidized and in the process, acid is produced. When thismicrobial reaction is deliberately fostered in a process called bioleaching, the aciditytends to mobilize metals such as copper in the ore. However, the reaction can just be aside effect when excavation occurs. Coal mining provides an example, and a problemcan arise. Rainwater and groundwater can drain through the mine excavation, andthe acid mine drainage can negatively impact nearby streams in the watershed. Whena cell uses inorganic materials for energy, it is referred to as having chemolithotrophicmetabolism. The cells in our body are heterotrophic.

Regardless of how a cell obtains its energy and raw materials, an efficiencycan be defined to quantify how a cell transforms its raw materials to cell mass.Typically, the limiting factor is the basis for defining the efficiency. For example,when all needed materials except glucose are in excess, a yield on glucose can bedefined as

Y = mass cells produced/mass glucose used.

(H +)FeS2

C6(H2O)6 + 6O2 : 6CO2 + 6H2O + heat.

1.9 Prions 31

Values tend to be 0.1–0.5 g cell water-free/g glucose. Variations arise that reflect thediffering efficiencies in using a compound such as glucose for energy and carbon, aswell as the nature of the metabolism.

1.8 | Viruses

There is another actor in the biological world that does not fully conform to thegenetic, molecular, and physiological attributes we have discussed so far. Viruses arevery small particles that are capable of infecting and altering the behavior of bacte-rial, plant, or animal cells. Without entering a host, a virus cannot reproduce itself.Reproduction occurs when a cell’s manufacturing resources are redirected accordingto the genetic information possessed by the virus. When the virus invades the cell,the instructions for producing the proteins and other molecules that constitute thevirus are inserted into the host cell. The host cell then becomes subservient to the virus’instructions. Often the relationship is fatal. After a host cell has produced the com-ponents to build many viruses, the components assemble, and they are released tocontinue the infection by causing the host cell to burst. In other cases, a virus maysimply integrate its instructions into a host’s genetic material and not produce newvirus particles. When infection occurs without reproduction, the condition is latent.Many diseases, such as chicken pox and AIDS, are due to viruses. The fact that avirus invades a host cell contributes to the difficulty in treating viral infections withdrugs, because the virus and its life cycle must be attacked without excessivelyharming the host cell.

Viruses also carry out some useful functions. In the course of infection andburst, sometimes genetic information from the current host cell is packaged bynewly produced viruses. When these viruses invade other cells, some genetic capabil-ities from the prior host can be passed on to the new host. This is one way in whichgenetic information is exchanged between cells. If the viral infection is mild or entersa latent state, the new genetic information a host cell receives can be used by thehost. Indeed, the use of mutated or mild viral strains is used in the technology oftransferring new genetic information to a cell. One example is gene therapy, wherethe goal is to replace a patient’s defective gene with a correct one. Gene therapyresearchers continue to view viruses as one option for repairing defective genes andremedying genetic-based diseases.

1.9 | Prions

If viruses challenge definitions of what is “alive” versus “dead,” then prions testestablished norms even further. Prions are altered proteins that may be capable offostering their synthesis. Notably, prions are very resistant to physical destruction(e.g., through heat) or to the mechanisms the body uses to recycle materials or toeliminate signals that are no longer valid. Diseases of the brain, such as Creutzfeldt-Jakob disease (humans), chronic wasting disease (CWD), and bovine spongiformencephalopathy are linked to the accumulation of prions.

How prions are formed and accumulate in brain tissue is under intense inves-tigation. Among the ideas proposed is that prion proteins are associated with a virusor virus-like particle. Failures to date to find nucleic acids involved have led to analternative, “protein-only” hypothesis. The idea is that a protein normally presentundergoes an alteration in three-dimensional organization. The altered protein can,however, bind to normal protein. The consequence of the binding encounter is thata normal protein is “refolded” to a degradation-resistant version. A chain reactioncan occur that leads to the accumulation of protein in the brain, which, in turn,interferes with normal brain function. More research will reveal if a prion is linkedto a disease agent or is itself the culprit.

Because prion-linked diseases affect livestock, wildlife, and humans, manysocietal stakeholders and researchers from different disciplines are concerned anddevoted to elucidating the mechanisms and nature of prion-related diseases. Theprospects for prion-related diseases exchanging between interconnected livestock,wildlife, and human populations further amplifies interest. For example, elk, whitetail deer, and mule deer have been found to suffer from CWD. Consequently, moni-toring studies are underway in Colorado (http://resourcescommittee.house.gov/107cong/forests/2002may16/miller.htm, http://www.nrel.colostate.edu/projects/cwd/)and elsewhere.

EXERCISES |

1.1 (a) If our DNA contained combinations of threebases instead of four, how many amino acids couldbe encoded when a codon contains one, two, orthree bases?

(b) Why do you suppose living systems use four basesinstead of three bases in the genetic code?

1.2 If a cell is maintaining 200 proteins and the aver-age number of amino acids per protein is 75, what isthe total number of A, G, C, and T bases used to codefor the construction of the proteins?

1.3 Match the statement on the left with the bestanalogous match on the top of the next column:

A car is either a Toyota or a Ford. _____The Naval Tomcat aircraft was based on the F14 prototype. _____Ford water pumps do not work in Toyotas. _____Each musical measure has the same number of beats. _____A taped message in Mission Impossibleincinerates after it is read. _____

32 Chapter 1 Cellular, Elemental, and Molecular Building Blocks of Living Systems

(a) Taxonomy (b) 16S RNA gene in Archaea versusEucarya (c) mRNA lifetime (d) Phylogeny (e) Codontriplet (f) Universal genetic code (g) Prions

1.4 Which compound(s) below would not likely beused by a heterotroph for energy?

(a) Carbon dioxide (b) Glucose (c) Methane(d) Fructose (e) Reduced iron

1.5 A microbe was found in a fossilized meteor inAntarctica. It appears to have a DNA-like moleculemade of five different types of base-like molecules. Ananalysis of other molecules suggests that 25 differentamino acid-like molecules make up something thatresembles proteins. If there is a genetic code in use, thenwhat is the minimum number of base molecules percodon? Why is the value a minimum?

1.6 If the yield for the growth of E. coli on glucoseis 0.3 g cell (water-free basis)/g glucose, answer thefollowing:

(a) What will be the mass concentration of E. coli on awater-free basis when provided 5 g glucose/L?

(b) What will be total mass of E. coli per liter?

(Fe°)

Web-Based Material Exercises and Research 33

1.7 Assume that a typical protein has 100 aminoacids, and a “ballpark” molecular weight for an aminoacid is 100 g/mol. How many protein molecules arepresent per 70 kg (i.e., average weight of a human) ofhydrated animal cells? If a protein’s typical dimensionis 10 Å (1 Å � 10�8 cm), could the distance betweenPittsburgh and Los Angeles be spanned by aligning theprotein molecules end-to-end?

1.8 What type of cell, on average, has more transcrip-tion going on—a growing bacterial cell or a stem cellresiding in the bone marrow?

1.9 Where would one most likely look to isolate anew Archaea—in a spoiled hamburger or in a boilinghot spring in Yellowstone National Park?

1.10 Identify what is not true about the followingstatement: Bacteria and animal cells use the samegenetic code (i.e., codons) to store protein “recipes”and use the same ribosomal machinery to translate theinformation into functional proteins.

1.11 Assume a cell possesses 1000 genes, but at anypoint in time, 10 percent are being used (i.e.,

“expressed”). If a typical protein has 100 amino acids,what is the total number of A, G, C, and T bases thatencode the cell’s (a) expressed and (b) total geneticrepertoire?

1.12 A codon in a Martian bacterium contains combi-nations of four of the five base-like molecules that makeup what passes for Martian DNA. An average bacteriumon Earth has 4000 genes. On Mars, life is quite different;hence, a larger repertoire of 6000 genes is needed to pro-vide flexibility. By what factor is the DNA larger in aMartian bacterium compared to an Earthling bac-terium? Assume a Martian protein contains about asmany amino acids as an Earthling protein.(a) 1.2 (b) 1.33 (c) 1.67 (d) 2.0 (e) 2.66

1.13 A new organism may have been found in theUniversity Center dining hall in the coleslaw. What isthe best thing to do first to characterize the new cell?

(a) Sequence the entire genome(b) Measure mRNA stability(c) Look for similarity with the 16S RNA-encoding

stretch of DNA in other known organisms

WEB-BASED MATERIAL EXERCISES AND RESEARCH |

W1.1 Visit the Protein Data Bank. What is the“Molecule of the Month”? What role does it play in acell, and in general terms, how does the molecule work?

W1.2 The basic work of Theodor (The) Svedberg oncolloid systems has made a significant impact on lifescience where, for example, people now speak of “16SRNA.” Via the Companion Website, obtain and readSvedberg’s biography. Report on the following:

(a) He constructed a device that allowed him to inves-tigate colloid and macromolecule systems in a newway. What is the device called and what does it do?

(b) Did he seem to be a boring or interesting person?

W1.3 You read in an article a medical term new toyou. The term you saw was “craniosynsotis.” Is itspelled correctly, and what does it mean?