Cell Transformation Box-Binding Protein 1 Blocks Oncogenic ...

10.1128/MCB.25.6.2095-2106.2005.

2005, 25(6):2095. DOI:Mol. Cell. Biol. Andreas G. Bader and Peter K. Vogt Cell TransformationBox-Binding Protein 1 Blocks Oncogenic Inhibition of Protein Synthesis by Y

http://mcb.asm.org/content/25/6/2095Updated information and services can be found at:

These include:

REFERENCEShttp://mcb.asm.org/content/25/6/2095#ref-list-1at:

This article cites 83 articles, 41 of which can be accessed free

CONTENT ALERTS more»articles cite this article),

Receive: RSS Feeds, eTOCs, free email alerts (when new

http://journals.asm.org/site/misc/reprints.xhtmlInformation about commercial reprint orders: http://journals.asm.org/site/subscriptions/To subscribe to to another ASM Journal go to:

on February 23, 2013 by P

EN

N S

TA

TE

UN

IVhttp://m

cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/cgi/alerts

http://mcb.asm.org/

MOLECULAR AND CELLULAR BIOLOGY, Mar. 2005, p. 2095–2106 Vol. 25, No. 60270-7306/05/$08.00�0 doi:10.1128/MCB.25.6.2095–2106.2005Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Inhibition of Protein Synthesis by Y Box-Binding Protein 1 BlocksOncogenic Cell Transformation†

Andreas G. Bader* and Peter K. VogtDepartment of Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, California

Received 12 October 2004/Returned for modification 16 November 2004/Accepted 17 December 2004

The multifunctional Y box-binding protein 1 (YB-1) is transcriptionally repressed by the oncogenic phos-phoinositide 3-kinase (PI3K) pathway (with P3K as an oncogenic homolog of the catalytic subunit) and, whenreexpressed with the retroviral vector RCAS, interferes with P3K- and Akt-induced transformation of chickenembryo fibroblasts. Retrovirally expressed YB-1 binds to the cap of mRNAs and inhibits cap-dependent andcap-independent translation. To determine the requirements for the inhibitory role of YB-1 in P3K-inducedtransformation, we conducted a mutational analysis, measuring YB-1-induced interference with transforma-tion, subcellular localization, cap binding, mRNA binding, homodimerization, and inhibition of translation.The results show that (i) interference with transformation requires RNA binding and a C-terminal domain thatis distinct from the cytoplasmic retention domain, (ii) interference with transformation is tightly correlatedwith inhibition of translation, and (iii) masking of mRNAs by YB-1 is not sufficient to block transformation orto inhibit translation. We identified a noncanonical nuclear localization signal (NLS) in the C-terminal half ofYB-1. A mutant lacking the NLS retains its ability to interfere with transformation, indicating that a nuclearfunction is not required. These results suggest that YB-1 interferes with P3K-induced transformation by aspecific inhibition of translation through its RNA-binding domain and a region in the C-terminal domain.Potential functions of the C-terminal region are discussed.

The phosphoinositide 3-kinase (PI3K) signaling pathwayplays a major role in malignant cell transformation. Its molec-ular participants are frequently deregulated in human cancers(7, 79). A homolog of the catalytic subunit of the lipid kinasePI3K (P3K) and its downstream target, the serine-threonineprotein kinase Akt, have been identified as oncogenic elementsof transforming retroviruses (11, 14, 71). The PI3K and Aktgenes are frequently mutated in cancer (10, 15, 46, 50, 62, 64);constitutively active forms of these proteins are transforming incell culture and tumorigenic in vivo (1, 14, 47, 70). Negativeregulators of PI3K-induced signaling are PTEN (phosphataseand tensin homolog deleted on chromosome 10) and the tu-berous sclerosis protein complex, consisting of the proteinsTSC1 and TSC2. PTEN is a lipid phosphatase and antagonistof PI3K and shows loss of function in human cancers at afrequency comparable to that of p53 (13, 67). The TSC1/2complex, located downstream of Akt, functions as a GTPaseactivating protein and negatively regulates the small GTPaseRheb (33, 34). Germ line loss of function of TSC1 or TSC2results in the development of benign tumors known as hamar-tomas (51). Another tumor suppressor, LKB1, controls TSC1/2through the AMP-dependent protein kinase (16, 65). A loss ofLKB1 function causes the Peutz-Jeghers syndrome, a benigntumor histologically similar to hamartomas (17, 30). An im-portant downstream branch of the PI3K signaling pathway isrepresented by the serine-threonine kinase TOR (target ofrapamycin). TOR regulates cell growth in response to PI3K

signaling, nutrients, and endogenous energy levels (76). It stim-ulates translation by activating p70 S6 kinase (S6K) and theeukaryotic translation initiation factor and cap-binding protein4E (eIF-4E) (29, 56). Phosphorylated and activated S6K phos-phorylates ribosomal protein S6, which has been implicated inthe recruitment of 5�TOP mRNAs to the ribosome (37). How-ever, recent evidence has amended this hypothesis (74).eIF-4E is regulated by interaction with 4E-binding proteins(4E-BP). 4E-BP are negative regulators of cap-dependenttranslation. Hypophosphorylated 4E-BP binds to eIF-4E andprevents initiation of translation. TOR-mediated phosphoryla-tion of 4E-BP1 frees eIF-4E from 4E-BP1 and thereby enableseIF-4E to assemble the translational initiation complex eIF-4F.

Increased translational activity is common during malignanttransformation (28, 56). Examples documenting the essentialrole of translation during oncogenic transformation are pro-vided by 4E-BP1, eIF-4E, eIF-4G, and Pdcd4 (programmedcell death 4). A constitutively active form of 4E-BP1 blocksc-Myc-induced transformation (45). eIF-4E and eIF-4G aretransforming in cell culture (24, 43); overexpression of eIF-4Ecooperates with c-Myc in the development of lymphomas inmice (63). Pdcd4 blocks tetradecanoyl phorbol acetate-inducedtransformation in susceptible JB6 cells and inhibits the helicaseactivity of eIF-4A, a component of the 4F translation initiationcomplex (82). These data are complemented by work with theimmunosuppressant rapamycin. Rapamycin, in complex withthe cellular protein FKBP12 (FK506-binding protein), bindsTOR and inactivates it (76). Rapamycin is able to block P3K-and Akt-mediated transformation and interferes with tumorformation in PTEN-deficient mice (2, 53, 58).

In the present study with the Y box-binding protein 1 (YB-1), we provide more evidence for a fundamental role of trans-lation during oncogenic transformation. YB-1, also known as

* Corresponding author. Mailing address: The Scripps ResearchInstitute, 10550 North Torrey Pines Rd., BCC239, La Jolla, CA 92037.Phone: (858) 784-9732. Fax: (858) 784-2070. E-mail: [email protected].

† This is manuscript no. 16934-MEM of The Scripps Research In-stitute.

2095


EN

N S

TA

TE

UN

IVhttp://m

cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

p50 or DNA-binding protein B (dbpb), regulates transcriptionand translation. It binds to single-stranded RNA, single-stranded DNA, and double-stranded DNA (35). As a DNA-binding protein, YB-1 binds to promoters containing the Y boxelement and either activates or represses gene expression (23,48, 54, 77). As an mRNA-binding protein, YB-1 is the mostabundant protein of messenger ribonucleoprotein particles(mRNPs) and controls translation in a dose-dependent fashion(9, 12, 49). Low concentrations stimulate translation, andhigher ones are inhibitory. Inactive mRNPs contain abouttwice as much YB-1 as active mRNPs (49). YB-1 blocks pro-tein synthesis at the initiation stage (52). Masking of mRNA byYB-1 has been suggested as an explanation for YB-1-mediatedinhibition of translation (7, 20, 61, 68). In P3K- and Akt-transformed chicken embryo fibroblasts (CEF), YB-1 is tran-scriptionally repressed (5). Overexpression of YB-1 leads to aspecific resistance to oncogenic transformation induced byP3K or Akt. This transformation-resistant cellular phenotypeis correlated with a flat cellular morphology, a cytoplasmiclocalization of YB-1, the ability to bind to the cap of mRNAs,and inhibition of cap-dependent and cap-independent transla-tion. A competition between YB-1 and eIF-4E for cap bindinghas been suggested (5, 19). A YB-1 mutant, unable to bind tothe cap structure of mRNAs, fails to inhibit translation andalso does not interfere with transformation (5).

Available data on YB-1-induced resistance to P3K- and Akt-mediated transformation favor a mechanism involving controlof protein synthesis. Cycloheximide, a general inhibitor oftranslation, does not result in an inhibition of P3K- or Akt-induced oncogenesis, suggesting that YB-1 affects the transla-tion of specific mRNAs differentially (unpublished data). Inthis study, we determined the requirements for interferencewith transformation in a mutational analysis of the YB-1 pro-tein. We provide evidence that neither mRNA binding nor capbinding of mRNAs is sufficient for inhibition of translation orfor interference with transformation. YB-1-induced resistanceto transformation by P3K or Akt requires RNA binding and a90-amino-acid region within the C-terminal domain and istightly correlated with inhibition of translation. We identified anonconventional nuclear localization signal (NLS) of YB-1. Amutant lacking the NLS retains its ability to block transforma-tion, indicating that a nuclear function of YB-1 is not requiredfor inhibition of transformation. These results suggest that

YB-1 blocks PI3K-induced transformation by a specific inhibi-tion of protein synthesis.

MATERIALS AND METHODS

Cell culture and interference assays. Fertilized chicken eggs (White Leghorn)were obtained from SPAFAS (Preston, Conn.). Preparation and cultivation ofprimary CEF have been described previously (80). Stable transfections using 5�g of RCAS vectors were carried out using 4 � 106 secondary CEF grown in a100-mm dish overnight in F10 medium (Sigma) supplemented with 5.87% iron-enriched bovine serum (Omega Scientific, Inc., Tarzana, Calif.), 0.93% L-glu-tamine–penicillin–streptomycin solution (Sigma, St. Louis, Mo.), and 2 ng ofPolybrene (Sigma)/ml. Cells were incubated with DNA for 4 h, treated withF10–0.25% dimethyl sulfoxide for 1 min, washed twice with F10, and grown inF10 medium containing 5.87% iron-enriched bovine serum and 0.93% L-glu-tamine–penicillin–streptomycin solution. Cell culture continued following stan-dard procedures (80). After transfection, CEF were transferred at least twicebefore they were used for interference assays or immunofluorescence or reporterassays. For interference assays, CEF were transfected with RCAS(B) vectors andseeded onto MP6 wells (5 � 105 cells per 35-mm well). After 10 days, cells wereinfected with oncogenic RCAS(A)myr-p3k�72 (3) virus or RCAS(A)myr-Akt�11–60 virus (1) and overlaid with agar medium on the next day. Fresh agarmedium was added every 2 days. Upon formation of transformed cell foci, cellswere stained with 2% crystal violet in 20% methanol.

Plasmids. All RCAS vectors are based on RCAS.Sfi (1), a derivative of RCAS(32) containing SfiI(A) and SfiI(B) sites for unidirectional cloning. RCAS(B)FLAG-YB-1, RCAS(B)FLAG-YB-1*, and pcDNA3.Sfi have been describedelsewhere (4, 5). RCAS(B)-I�B-SR was kindly provided by M. Aoki. pBSFI-FLAG-YB-1 was created by moving the FLAG–YB-1 SfiI fragment frompFBnFLAG-YB-1 (5) into the SfiI sites of pBSFI. YB-1 deletion mutants weregenerated by PCR using pBSFI-FLAG-YB-1 as template and PCR primers asdescribed in Table 1. PCR products were cut with NotI and BamHI and clonedinto the NotI and BamHI sites of pBSFI-FLAG. Inserts were recloned as SfiIfragments into RCAS(B) and pcDNA3.Sfi. The chicken YB-1 protein publishedunder accession number AAA02573 was used in this study. Internal deletionswere prepared by altering the YB-1 nucleotide sequences in pBSFI-FLAG-YB-1and pBSFI-FLAG-YB-1* to StuI sites at amino acid positions 183 and 273(YB-1�183-273), 183 and 202 (YB-1�183-202 and YB-1*�183-202), and 190 and202 (YB-1�190-202 and YB-1*�190-202) by using the QuikChange XL site-directed mutagenesis kit from Stratagene (La Jolla, Calif.). Mutated pBSFIvectors were cut with StuI, gel purified, and religated. Inserts were retrieved bySfiI digestion and cloned into the SfiI sites of RCAS(B). YB-1(1-202,4R-4A) wasgenerated by replacing the four arginines at amino acid positions 186 to 189 withalanines by using the QuikChange XL site-directed mutagenesis kit from Strat-agene and pBSFI-YB-1(1-202) as template. The particular SfiI cDNA fragmentswere moved into RCAS(B) or pcDNA3.Sfi as described above. For the genera-tion of pcDNA3-HA-YB-1, a YB-1 cDNA fragment was amplified by PCR using5�-AACCCATGGTTATGAGCAGCGAGGCCGAGACCCAGCCG-3� as for-ward primer and 5�-AACGAATTCTTACTCAGCCCCGCCCTGCTCGGCCTCGGG-3� as reverse primer and pBSFI-FLAG-YB-1 as template. The DNAfragment was gel purified, cut with NcoI and EcoRI, and cloned into NcoI-EcoRI-cut pBSFI-HA vector (69), creating pBSFI-HA-YB-1. From this vector,

TABLE 1. Forward and reverse primers used for generation of YB-1 deletion mutants

YB-1 protein Forward primer Reverse primer

AP-CSD 5�ACGCGGCCGCCCATGAGCAGCGAGGCCGAGACCCAGCCG3� 5�ACGGATCCTTATGCGTATTTGCTGCCTTGCACTGGAAC3�C-term 5�ACGCGGCCGCCCGCAGACCGTAACCATTACAGACGATAT3� 5�ACGGATCCTTACTCAGCCCCGCCCTGCTCGGCCTCGGG3�YB-1(1-176) 5�ACGCGGCCGCCCATGAGCAGCGAGGCCGAGACCCAGCCG3� 5�TTCGGATCCTTATTCCGGGATGTTCTCTGCTCCTTCGTTC3�YB-1(1-183) 5�ACGCGGCCGCCCATGAGCAGCGAGGCCGAGACCCAGCCG3� 5�ACGGATCCTTAACGGCGCTGCTGGGCTTGGCCTTCCGG3�YB-1(1-202) 5�ACGCGGCCGCCCATGAGCAGCGAGGCCGAGACCCAGCCG3� 5�ACGGATCCTTATCGACGCCCGTAGGGCCTACGCATGTA3�YB-1(1-243) 5�ACGCGGCCGCCCATGAGCAGCGAGGCCGAGACCCAGCCG3� 5�ACGGATCCTTAGCGGAATCGTGGTCTGTAACCTCGATA3�YB-1(1-264) 5�ACGCGGCCGCCCATGAGCAGCGAGGCCGAGACCCAGCCG3� 5�ACGGATCCTTATTGGTTCTCTTTATCTTCTTCGTTTCC3�YB-1(1-271) 5�ACGCGGCCGCCCATGAGCAGCGAGGCCGAGACCCAGCCG3� 5�ACGGATCCTTACTGACCTTGGGTCTCATCTCCTTGGTT3�YB-1(1-290) 5�ACGCGGCCGCCCATGAGCAGCGAGGCCGAGACCCAGCCG3� 5�AACGGATCCTTACTCTGGGCGTCTGCGTCTGTAGTTG3�YB-1(1-308) 5�ACGCGGCCGCCCATGAGCAGCGAGGCCGAGACCCAGCCG3� 5�TTCGGATCCTTACTCAGCTGGTGGTTCGGCTGTCTTCG3�YB-1(41-321) 5�AACGCGGCCGCCCGCGGCGCCTCCCGCCGGCGGGGACAAGAAG3� 5�ACGGATCCTTACTCAGCCCCGCCCTGCTCGGCCTCGGG3�YB-1(41-308) 5�AACGCGGCCGCCCGCGGCGCCTCCCGCCGGCGGGGACAAGAAG3� 5�TTCGGATCCTTACTCAGCTGGTGGTTCGGCTGTCTTCG3�YB-1(41-290) 5�AACGCGGCCGCCCGCGGCGCCTCCCGCCGGCGGGGACAAGAAG3� 5�AACGGATCCTTACTCTGGGCGTCTGCGTCTGTAGTTG3�

2096 BADER AND VOGT MOL. CELL. BIOL.


EN

N S

TA

TE

UN

IVhttp://m

cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

the SfiI fragment was cloned into pcDNA3.Sfi. To generate pc-luc, the HindIII-BamHI fragment from pGL3 Basic (Promega) encoding the firefly luciferasegene was cloned into the HindIII and BamHI sites of pcDNA3 (Invitrogen,Carlsbad, Calif.).

Immunofluorescence. Cells grown overnight on glass coverslips were washedwith phosphate-buffered saline (PBS) and fixed with 3.7% formaldehyde for 30min, rinsed twice with PBS, and incubated with PBS containing 0.1% TritonX-100 (Sigma) for 30 min. After a wash with PBS, the coverslips were incubatedwith 10% goat serum for 1 h at room temperature in a humidified containerfollowed by incubation with rabbit polyclonal anti-FLAG antibody (Sigma) foranother hour. Coverslips were washed with PBS three times and incubatedwith fluorescein isothiocyanate-conjugated goat anti-rabbit immunoglobulin G(Sigma) for 1 h. During the last 5 min, 4,6-diamidino-2-phenylindole (DAPI) wasadded. The coverslips were again washed three times with PBS and mounted onglass slides using Slowfade mounting medium (Molecular Probes, Eugene,Oreg.). Primary and secondary antibodies were used at a final dilution of 1:100,and the final concentration of DAPI was 2 ng/�l.

Immunoblotting. Cells were trypsinized, counted, pelleted for 3 min at 960 �g, and lysed in sample buffer containing 60 mM Tris-HCl (pH 6.8), 10% (vol/vol)glycerol, 3% (wt/vol) sodium dodecyl sulfate (SDS), 5% (vol/vol) �-mercapto-ethanol, and 0.005% (wt/vol) bromophenol blue. Lysates from 6.25 � 104 cellswere separated on SDS–10% polyacrylamide gel electrophoresis (SDS-PAGE)and transferred onto a nitrocellulose membrane. Membranes were blocked inTris-buffered saline (TBS)–Tween 20 (0.1%) containing 5% bovine serum albu-min for 2 h at room temperature, followed by incubation with horseradishperoxidase-conjugated anti-FLAG M2 antibodies (1:20,000; Sigma) for 40 min atroom temperature in TBS-T (0.1%) with 5% bovine serum albumin.

m7GTP pull-down and mRNA-binding assays. m7GTP pull-down assays weredone according to a published protocol (8, 44). Briefly, cells were grown toconfluence and suspended in 700 �l of m7GTP lysis buffer containing 20 mMTris, 100 mM KCl, 20 mM �-glycerophosphate, 1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N�,N�-tetraacetic acid (EGTA), 1 mM EDTA, 1 mM di-thiothreitol, 1 mM phenylmethylsulfonyl fluoride, 0.25 mM Na3VO4, 10 mMNaF, and 1� protease inhibitor cocktail from Roche (Indianapolis, Ind.). Nativeprotein extracts were prepared with six cycles of freeze-thaw using a dry ice-methanol bath and thawing in water. Debris was separated by centrifugation, andthe protein concentration was determined using the BCA system from Pierce(Rockford, Ill.). For the m7GTP pull down, 300 �g of protein together with 50�l of 7-methyl GTP–Sepharose 4B beads (Amersham Pharmacia, Piscataway,N.J.) were incubated overnight at 4°C. Beads were washed seven times withm7GTP washing buffer containing 20 mM Tris, 100 mM KCl, 0.2 mM EDTA, and7 mM �-mercaptoethanol, and bound proteins were applied to an SDS-PAGE(10%). Western blotting was carried out as described above. For themRNA-binding assay, 150 �g of total protein of lysates that had been used forthe m7GTP pull down were immunoprecipitated with anti-FLAG M2 agarose(Sigma) for 30 min at 4°C. Beads were washed four times with m7GTP washingbuffer and were incubated with 2 �l of RNase inhibitor (Superase�In; Ambion,Austin, Tex.) and 3.3 � 106 cpm of riboprobe in a total volume of 200 �l ofm7GTP washing buffer at room temperature for 2 h. As riboprobe, in vitro-transcribed, [32P]UTP-labeled mRNA was used that had been generated withlinearized pBSFI-FLAG-YB-1 vector as template and the MaxiScript kit fromAmbion according to the manufacturer’s protocol. The approximately 1,000-nucleotide (nt) YB-1 mRNA was purified using MicroSpin G-50 columns fromAmersham Pharmacia. After incubation, the beads were washed twice withm7GTP washing buffer and four times with m7GTP washing buffer supplementedwith 500 mM NaCl. Beads were suspended in 50 �l of sample buffer (18 mMEDTA, 1� TBE, 3% [wt/vol] SDS, 0.03% [wt/vol] bromophenol blue, 68.5%[vol/vol] formamide) and boiled for 3 min. Results were quantified by measuringCherenkov radiation of 5 �l. Ten microliters was separated on a 4% polyacryl-amide gel with 8 M urea and visualized by autoradiography.

Coimmunoprecipitation. HEK293 cells were transiently transfected with 3 �geach of pcDNA3-HA-YB-1 and pcDNA3-FLAG encoding various YB-1 pro-teins. The empty vector pcDNA3.Sfi was cotransfected to reach equal amountsof transfected DNA. Cells were lysed in immunoprecipitation lysis buffer con-taining 0.5% NP-40, 10% glycerol, 20 mM Tris, 150 mM NaCl, 1 mM MgCl2, 1mM phenylmethylsulfonyl fluoride, 50 mM NaF, 1 mM dithiothreitol, 50 mM�-glycerolphosphate, 1 mM Na3VO4, and 1� protease inhibitor cocktail fromRoche. Five hundred micrograms of total protein was incubated at 37°C for 2 hwith 1 �g of RNase A/�l to ensure complete degradation of mRNAs and appliedonto agarose beads conjugated with M2 FLAG-specific antibodies (Sigma) for 30min at 4°C. Beads were washed five times with immunoprecipitation lysis bufferwithout protease inhibitors. Bound proteins were separated by SDS-PAGE(10%) and visualized by Western blotting using horseradish peroxidase-conju-

gated M2 FLAG antibodies (Sigma) or polyclonal HA.11 antibodies (Sigma).Tubulin was detected with monoclonal anti-tubulin from ICN Biomedicals Inc.,Aurora, Ohio.

Reporter assays, RNA isolation, RT-PCR, and Northern blotting. Transienttransfections, preparation of cell lysates, and luciferase assays were performed asdescribed previously (5). A total of 1.5 � 105 cells were seeded onto 12-wellplates, grown overnight, and transfected with 600 ng of pc-luc; luciferase assayswere done using 5 �g of protein. Isolation of total RNA was performed by CsClgradient centrifugation. Briefly, total protein was lysed in guanidium isothiocya-nate buffer containing 4 M guanidine thiocyanate, 25 mM sodium acetate, and0.835% (vol/vol) �-mercaptoethanol. Lysates were drawn through a 20-gaugeneedle to shear chromosomal DNA. Lysates were overlaid on a 5.7 M CsClcushion, and total RNA was pelleted by centrifugation at 107,000 � g for 18 to24 h, ethanol precipitated, and dissolved in 20 �l of water. Eight microliters oftotal RNA was used for cDNA synthesis using the ThermoScript reverse tran-scription-PCR (RT-PCR) system from Invitrogen according to the manufactur-er’s instructions. PCR was carried out at a 62°C annealing temperature for 25cycles. The YB-1-specific primers 5�-AACGCGGCCGCCCGCGGCGCCTCCCGCCGGCGGGGACAAGAAG-3� and 5�-ACGGATCCTTAGCGGAATCGTGGTCTGTAACCTCGATA-3� were used to amplify a 606-nt cDNA product.For Northern analyses, 4 � 106 CEF were seeded onto 100-mm dishes, grownovernight, and transiently transfected with 3 �g of pc-luc. Cells were serumstarved and stimulated with serum growth factors as described elsewhere (5).Isolation of total RNA, RNA gel electrophoresis, Northern blotting, and North-ern hybridizations were done as described previously (6). Firefly luciferase andglyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA fragments werelabeled with [�-32P]dCTP using the Random Primed DNA labeling kit fromRoche.

RESULTS

The CSD and C-terminal sequences of YB-1 are required toblock oncogenic transformation induced by P3K or Akt. YB-1consists of three major domains: an N-terminal alanine-pro-line-rich domain (AP), a central cold shock domain (CSD),and a C-terminal tail domain comprising four alternating clus-ters of basic and acidic residues (Fig. 1A). The core of theprotein is the CSD, which forms a distinct structure and facilitatesbinding to the nucleic acid; it also contains an RNA-bindingmotif (20). Mutation of the RNA-binding motif eliminatesRNA binding and the ability to interfere with P3K-inducedtransformation, suggesting that RNA binding is essential forYB-1 to block P3K-mediated transformation (5). In a searchfor domains of YB-1 necessary for interference with transfor-mation, we generated various deletion mutants (Fig. 1A). Allmutants were derived from the chicken YB-1 protein consist-ing of 321 residues. We cut the protein in half, generating aC-terminal fragment (residues 137 to 321) and an N-terminalfragment consisting of the AP domain and the CSD (AP-CSD,residues 1 to 136). We deleted portions of the C terminus,deleted almost the entire AP domain, and created a YB-1mutant with an internal deletion within the C-terminal domain.All cDNAs contained an N-terminal FLAG tag and were ex-pressed from the retroviral expression vector RCAS. cDNAswere entirely sequenced, and correct expression of the individ-ual YB-1 proteins was verified by Western analysis (Fig. 1B).To test for interference with Akt- or P3K-induced transforma-tion, CEF transfected with RCAS vectors encoding the YB-1deletions were superinfected with oncogenic P3K or Akt viruscarrying an N-terminal myristylation signal (myr-P3K and myr-Akt). As shown in Fig. 2, neither the AP-CSD nor the C-ter-minal domains were able to block transformation. Interferencewith transformation required the CSD and a major portion ofthe C-terminal domain adjacent to the CSD up to amino acid290 (Table 2). The mutant lacking amino acids 183 to 273 was

VOL. 25, 2005 INHIBITION OF TRANSLATION AND TRANSFORMATION BY YB-1 2097


EN

N S

TA

TE

UN

IVhttp://m

cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

also unable to block transformation, highlighting the impor-tance of the C-terminal domain. Protein sequences that aredispensable for interference are the AP domain and C-termi-nal sequences beyond amino acid 290.

Subcellular localization of YB-1 deletion mutants. The full-length YB-1 protein localizes predominantly in the cytoplasm(5, 41, 59, 73). However, derivatives of YB-1 have also beenfound in the nucleus (38, 73). The YB-1 mutant YB-1*, whichno longer binds to RNA, is retained in the nucleus (5). Theability to interfere with transformation could simply be con-trolled by the subcellular distribution of YB-1. Therefore, wedetermined the localization of the YB-1 deletion mutants byimmunofluorescence (Fig. 2; Table 2). As expected, wild-typeYB-1 was predominantly found in the cytoplasm. Some of thedeletion mutants were nuclear and some were cytoplasmic,depending on the protein sequence that had been deleted. Theresults allowed the following conclusions: (i) the C-terminalhalf of the protein contains a potential NLS between residues183 and 202. This is demonstrated by the cytoplasmic YB-1(1-

183) and the nuclear YB-1(1-202) proteins. (ii) YB-1 residues264 to 290 encode a cytoplasmic retention site (CRS) thatprevails over the NLS (Table 2). This is shown by YB-1(1-264)and YB-1(1-290). YB-1(1-264) localizes to the nucleus, where-as YB-1(1-290) is cytoplasmic even in the presence of the NLS.(iii) A stabilization of the RNA-binding module in the cyto-plasm is required but not sufficient for interference with trans-formation. YB-1(1-183) and YB-1�183-273 are two examplesthat localize in the cytoplasm and contain an intact CSD butare unable to block transformation. This observation alsoshows that the CRS and the C-terminal domain, which medi-ates interference, are two distinct domains.

The noncanonical NLS of YB-1. As shown above, YB-1residues 183 to 202 encode a potential NLS. To verify that thissite is biologically active in the full-length protein, we furtheranalyzed the NLS with the YB-1* mutant that contains a dis-rupted RNA-binding motif and localizes in the nucleus (5). Wegenerated YB-1* mutants lacking parts of or the entire se-quence encompassing residues 183 to 202 and expressed theseproteins in CEF using RCAS (Fig. 3A, B, and C). A partialdeletion mutant of that site, lacking amino acids 190 to 202,resulted only in an incomplete release of the protein into thecytoplasm (Fig. 3D). Deleting all 20 amino acids (183 to 202)increased cytoplasmic localization and suggested that the res-idues 183 to 202 play an important role in the control ofcellular localization of YB-1 (Fig. 3D). We concede that thecytoplasmic staining is not absolute. However, the stainingobtained with YB-1*�183-202 strongly resembled that of theAP-CSD fragment (cf. Fig. 2), indicating that the N-terminalhalf of the protein, consisting of the AP domain and CSD, hasresidual nuclear localization activity.

Conventional NLSs are either monopartite, such as the NLSof the SV40 large T-antigen (KKKRK), or bipartite, composedof the structure K/R K/R K/R (X)10-12 K/R K/R (18, 39, 40).Considering the relative position and the high content of ar-ginines within the sequence encompassing residues 183 to 202,this sequence could act as a classic NLS. We therefore deter-mined whether the cluster of four arginines at position 186 to189 is essential for nuclear localization. We generated themutant YB-1(1-202,4R-4A), encoding YB-1 residues 1 to 202with alanines in positions 186 to 189 (Fig. 3A, B, and C). Wecompared the localization of this mutant with its unalteredcounterpart YB-1(1-202). Both proteins were retained in thenucleus, suggesting that the arginines are not essential fornuclear localization (Fig. 3E). Even with the further deletionof the two terminal arginines in positions 201 and 202, themutant protein remained in the nucleus (data not shown).These data suggest that residues 183 to 202 form a noncanoni-cal NLS that functions independently of basic residues.

In a subsequent experiment we examined whether nuclearexport of YB-1 is mediated by CRM1 (chromosome regionmaintenance 1). CRM1 belongs to the exportin proteins andcontrols nuclear export of many shuttling proteins, such asMDM2/p53 (murine double minute 2), cyclin B1, and I�B(inhibitor of NF-�B) (22, 31, 83). We treated YB-1-expressingcells with leptomycin B, which prevents CRM1-mediated nu-clear export by competing for CRM1 (21, 42, 72). After a 24-htreatment with leptomycin B, the I�B superrepressor accumu-lates in the nuclei due to inhibition of nuclear export. In con-trast, there was no measurable increase in nuclear localization

FIG. 1. YB-1 deletion mutants. (A) Schematic diagram of YB-1mutants. The three major domains of the YB-1 protein are outlined atthe top: AP domain, CSD (hatched box), and C-terminal domain(C-term). The four alternating clusters of acidic and basic residueswithin the C-terminal domain are indicated by black (basic) and grey(acidic) boxes. All YB-1 proteins contain an N-terminal FLAG tag.The nomenclature of deletion mutants refers to amino acid positionsof the chicken YB-1 protein. (B) Protein expression of YB-1 deletionmutants. Total lysates of 6.25 � 104 CEF transfected with RCASvectors as indicated were subjected to Western analysis with FLAG-specific antibodies.



EN

N S

TA

TE

UN

IVhttp://m

cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

FIG. 2. Inhibition of transformation and subcellular localization of YB-1 deletion mutants. (Left) CEF were stably transfected with RCASvectors encoding YB-1 deletion mutants and superinfected with oncogenic myr-P3K virus. Individual RCAS vectors and the log10 of virus dilutionsare shown. Cells were fed with agar medium and stained after 15 days with crystal violet. Data obtained with myr-Akt were equivalent to thoseof myr-P3K and are not shown. (Right) YB-1 proteins were visualized by immunofluorescence as described in Materials and Methods. Fluorescein(FITC) and phase-contrast (phase) micrographs were taken using a 40� objective lens.



EN

N S

TA

TE

UN

IVhttp://m

cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

of YB-1, suggesting that nuclear export of YB-1 occurs inde-pendently of CRM1 (Fig. 3F). It may be directed throughmRNA export instead.

Nuclear localization is not required for interference withtransformation by P3K. Full-length YB-1 localizes to the cy-toplasm (5, 41, 59, 73). However, it is still possible that tracesof YB-1 travel into the nucleus, mediating interference withP3K and Akt by a mechanism that is distinct from its role as acytoplasmic translational regulator. Therefore, we deleted theNLS from wild-type YB-1 and tested this mutant in an inter-ference assay. As shown in Fig. 4, interference was neitherabolished nor diminished by the lack of an intact NLS, sug-gesting that the nuclear function of YB-1 is not necessary toprevent transformation. The C-terminal domain that is re-quired for YB-1 function can be further confined to a 90-amino-acid region between residues 202 and 290 that includesthe CRS. In vitro, the C-terminal half of the YB-1 proteinalone effectively blocks translation (52). To test whether thisdomain is sufficient to block transformation when localized inthe cytoplasm, we used the mutant YB-1*�183-202 that lacksRNA-binding activity and the NLS but retains the C-terminaldomain 202-290 and localizes to the cytoplasm (Fig. 3D). Thedata revealed that the C-terminal domain of YB-1 alone is notable to prevent transformation and suggested that the CSD inconcert with the C-terminal region is required to block trans-formation.

Cap binding is required but not sufficient for interferencewith P3K-induced transformation. YB-1 binds to the cap re-gion of mRNAs and could function as a competitor of eIF-4E(5). The antioncogenic effect of YB-1 could therefore be me-diated by binding to the mRNA cap. In order to explore thispossibility, we harvested cells expressing wild-type or mutantYB-1 proteins and applied native cell lysates onto a 7-methylGTP resin (m7GTP). m7GTP beads mimic the cap region ofmRNAs and allow the isolation of cap-binding proteins (44).Bound proteins were identified by Western blotting withFLAG-specific antibodies (Fig. 5A). All YB-1 mutants thatwere able to block transformation were also bound to the

beads. However, some of the mutants that failed to interferewith transformation were also able to bind to the m7GTP resin.Among these were proteins that were abundantly expressed inthe cytoplasm, such as YB-1(1-271) and YB-1�183-273. Thisresult suggests that mere cap binding is not sufficient for in-terference. Competition with eIF-4E is therefore not a likelymechanism for the antioncogenic activity of YB-1.

YB-1 nonspecifically binds to mRNAs, preferring sequenceswith a high G content (84). Masking mRNAs could be anotherpossible way by which YB-1 inhibits translation. Therefore, weinvestigated mRNA-binding activities of various YB-1 mutantswith in vitro-transcribed YB-1 mRNA as an arbitrary mRNA.YB-1 proteins were immunoprecipitated with FLAG-specificantibodies and incubated with [32P]UTP-labeled mRNA.Beads were washed with high salt to break nonspecific protein-RNA interactions. Bound mRNAs were quantified and visual-ized by PAGE. A majority of YB-1 mutants was able to bind tothe mRNA, including mutants that failed to interfere withP3K-induced transformation (Fig. 5B and C). This result issimilar to the cap-binding assay, with the exception that capbinding requires additional C-terminal sequences whereasmRNA binding solely depends on a functional CSD.

Oligomerization of YB-1 is required but not sufficient toblock P3K-mediated transformation. Cap binding or mRNAbinding are not sufficient for YB-1 function as shown above.However, it still possible that mRNA binding in concert withhomodimerization is required to prevent transformation. YB-1is able to dimerize, forming homodimers and oligomers (25,35). The domain necessary for oligomerization has beenmapped to the C-terminal half of the protein (35). We con-firmed homodimerization by coimmunoprecipitation of full-length YB-1 with full-length YB-1 by using FLAG-tagged andhemagglutinin (HA)-tagged proteins (Fig. 6A). Before precip-itation, protein lysates were treated with RNase A to ensurecomplete degradation of mRNAs (Fig. 6B). To test the possi-bility that oligomerization of YB-1 bound to RNA causes in-terference with transformation, we performed coimmunopre-cipitation experiments with full-length HA–YB-1 and variousYB-1 mutants containing the FLAG tag. The capacity to ho-modimerize was compared to the ability to interfere with P3K-induced transformation. As shown in Fig. 6C, a great numberof YB-1 mutants, including loss-of-function mutants, were ableto form homodimers. The domain facilitating homodimeriza-tion can be mapped to residues 137 to 183, a domain C-terminally adjacent to the CSD. The data suggest that maskingthe mRNA as a homodimeric protein complex is not sufficientfor the antioncogenic activity of YB-1.

Interference with transformation is tightly correlated withinhibition of translation. YB-1-expressing cells resistant totransformation by P3K and Akt show a dramatic decrease intranslational activity. Cap-dependent and cap-independenttranslation are affected equally by YB-1 (5). Protein synthesisin cells expressing the YB-1 mutants was therefore measuredand compared to the sensitivity to transformation. Cap-depen-dent translation was measured with the reporter construct pc-luc, encoding the luciferase gene that is driven by a cytomeg-alovirus promoter and translated in a cap-dependent manner.Transient transfection of pc-luc into CEF that expressed var-ious YB-1 mutants was followed by a luciferase assay as areadout for translational activity (Fig. 7A). The data revealed

TABLE 2. Effects of various YB-1 deletion mutants ontransformation by myr-P3k and their subcellular localization in CEF

YB-1 protein EOTa Localization

YB-1 0.02 CytoplasmAP-CSD 1.69 Cytoplasm, nucleusC-term 0.79 NucleusYB-1(1-176) 0.89 CytoplasmYB-1(1-183) 0.67 CytoplasmYB-1(1-202) 1.19 NucleusYB-1(1-243) 1.27 NucleusYB-1(1-264) 1.29 NucleusYB-1(1-271) 1.33 Nucleus, cytoplasmYB-1(1-290) 0.00 CytoplasmYB-1(1-308) 0.02 CytoplasmYB-1(41-321) 0.05 CytoplasmYB-1(41-308) 0.00 CytoplasmYB-1(41-290) 0.02 CytoplasmYB-1�183-273 0.90 CytoplasmRCAS 1.00 NAb

a Efficiency of transformation: focus-forming units per milliliter on YB-1-expressing cells over that of RCAS controls. Data were taken from one repre-sentative assay.

b NA, not applicable.



EN

N S

TA

TE

UN

IVhttp://m

cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

that inhibition of translation is tightly correlated with the abil-ity to block P3K-induced transformation. All mutants that re-tained the ability to interfere with transformation also greatlyreduced translation, similar to wild-type YB-1. Mutants unable

to affect transformation barely reduced translation. The reduc-tion in translational activity was independent of transcriptionalactivity, as RCAS–YB-1- and RCAS-infected cells showedequal levels of luciferase mRNAs (Fig. 7B). The data suggest

FIG. 3. NLS of YB-1. (A) The chicken YB-1 protein sequence encompassing amino acids 183 to 202 is shown. The four arginines that havebeen replaced by alanines in the YB-1(1–202,4R-4A) mutant are underlined. (B) Schematics of YB-1 mutants lacking the amino acid sequences190 to 202 or 183 to 202. The major protein domains are highlighted by the same patterns as in Fig. 1A. The asterisks refer to two point mutationsin the RNA-binding motif; the cross indicates the replacement of arginines 186 to 189 with alanines in the mutant YB-1(1–202,4R-4A). All proteinscontain an N-terminal FLAG tag. (C) Immunoblot of mutants shown in panel B. Total lysates of 6.25 � 104 cells were probed for YB-1 proteinswith anti-FLAG antibodies. (D and E) Subcellular localization of YB-1 proteins outlined in panel B. YB-1 proteins were visualized with anti-FLAGfluorescein-conjugated secondary antibodies. DAPI and phase-contrast images are shown to the right. All micrographs were taken using the 40�objective lens. (F) CEF expressing full-length YB-1 or I�B-SR were incubated in the presence of 5 ng of leptomycin B (Sigma)/ml for 24 h. Controlswere treated with solvent (70% methanol) only. Cells were fixed and subjected to immunofluorescence as described in Materials and Methods.



EN

N S

TA

TE

UN

IVhttp://m

cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

that the two regions critical for antioncogenic activity, theRNA-binding domain and the C-terminal domain, function inconcert to interfere with protein synthesis and induce resis-tance to transformation.

DISCUSSION

YB-1 functions as an mRNA-binding protein regulatingtranslation and as a DNA-binding protein controlling geneexpression. In addition, YB-1 is a nucleo-cytoplasmic shuttlingprotein that may be involved in DNA repair and RNA splicing(38, 59, 78). Heterozygous knockout of YB-1 results in majordefects of the cell cycle in DT40 cells (75). Overexpression ofYB-1 induces a specific resistance to P3K- and Akt-mediatedoncogenic cell transformation (5). The mutational analysis ofYB-1 presented here seeks to correlate the antioncogenic ac-tivity of YB-1 with specific domains and functions of the pro-tein.

In an analysis of the subcellular localization of YB-1 mu-tants, we found that a cytoplasmic localization of YB-1 isrequired but not sufficient for interference with transforma-tion. A YB-1 mutant lacking the NLS retained its capacity toblock translation and P3K-induced transformation, suggestingthat a nuclear function and—by implication—transcriptionalregulation are not required. We mapped the domains thatcontrol subcellular localization: the NLS encompasses aminoacids 183 to 202, and the CRS resides between residues 264 to290. The sites of these domains are similar to those that havebeen determined previously (38, 73). We found that the CRSis necessary for cytoplasmic localization but is dispensable formRNA binding. Loss of either RNA binding or the CRS re-

FIG. 4. YB-1 proteins lacking the NLS in an interference assay.CEF stably transfected with RCAS vectors encoding YB-1�183–202,YB-1�190–202, or YB-1*�183–202 were superinfected with trans-forming myr-P3K virus in a serial dilution as shown. Cells were stainedafter 15 days.

FIG. 5. mRNA-binding and cap-binding activities of YB-1 mutants.(A) Cap-binding assay. Three hundred micrograms of total protein ofnative cell lysates was incubated with m7GTP resin at 4°C overnight.Bound YB-1 proteins were detected on a Western analysis usingFLAG-specific antibodies (top panel). To show expression of YB-1proteins, 25 �g of total cell lysates was probed in an immunoblot assay(bottom panel). YB-1 mutants were sorted by the ability to interferewith P3K-induced cell transformation. (B) mRNA binding assay. YB-1proteins from total lysates as used in panel A were immunoprecipi-tated with anti-FLAG antibodies and incubated with [32P]UTP-labeledin vitro-transcribed YB-1 mRNA. Beads were washed with 500 mMNaCl to diminish nonspecific protein-mRNA interactions. BoundmRNAs were separated on a 4% PAGE with 8 M urea. As a control,105 cpm of the mere riboprobe (R) was used. Asterisks indicate mRNAbreakdown products. (C) Quantification of the results shown in panel B.



EN

N S

TA

TE

UN

IVhttp://m

cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

sults in a nuclear localization (5, 73). Under these conditions,the NLS prevails and directs YB-1 into the nucleus. YB-1 hasa noncanonical NLS, since it functions independently of itsbasic residues. Inhibition of the CRM1-mediated nuclear ex-port by leptomycin B fails to block cytoplasmic localization ofYB-1, suggesting that nuclear export is facilitated throughmRNA export. The data favor a model in which YB-1 inter-feres with oncogenic transformation by functioning as a cyto-plasmic translational regulator and not as a nuclear proteinregulating transcription. Nuclear export and cytoplasmic local-ization are accomplished by association of YB-1 with mRNA,whereas nuclear localization is mediated by the NLS in con-junction with a loss of the CRS. This is demonstrated by site-specific cleavage of YB-1 in response to thrombin, which leadsto a loss of the CRS and nuclear localization (73). Nuclearlocalization can also be achieved by other stimuli, such as UVtreatment, phosphorylation, or association with p53 (41, 78,85). Whether the CRS stabilizes YB-1 in the cytoplasm byinteracting with mRNA or another component of mRNPs re-mains to be determined.

YB-1 is frequently overexpressed in ovarian, breast, andlung cancers (27, 36, 66, 81). In many of these cancers, YB-1shows increased nuclear localization. YB-1 positively controlsthe expression of the matrix metalloproteinase 2 and the mul-tidrug resistance gene 1, both of which are important for tumorprogression (48, 55). Nuclear localization of YB-1 correlateswith tumor progression and a poor prognosis in tumor patients(27, 66). The prooncogenic activity of YB-1 may be explainedby elevated levels of YB-1 in the nucleus. In this context, YB-1may act as a transcriptional regulator, rather than as a cyto-plasmic mRNA-binding protein.

As an mRNA-binding protein, YB-1 controls translation ina dose-dependent manner (49). High concentrations are inhib-itory and block cap-dependent and cap-independent transla-tion (5). Masking the mRNA and, thereby, making the mRNAinaccessible to the translational machinery has been a plausibleexplanation for this inhibitory activity (7, 20, 61, 68). YB-1would bind mRNA as a monomer or as an oligomer, condens-ing mRNAs intramolecularly and intermolecularly. Our datado not support this model but rather suggest that the inhibition

FIG. 6. Oligomerization of YB-1 mutants. (A) Coimmunoprecipitation of full-length YB-1 with full-length YB-1. FLAG–YB-1 and HA–YB-1were transiently expressed in HEK293 cells. FLAG–YB-1 and HA–YB-1 proteins were singly expressed to show the specificity of the assay. EmptypcDNA3 vector was added when necessary to reach equal amounts of transfected DNA. A 500-�g aliquot of total protein was preincubated with1 mg of RNase A/ml at 37°C for 2 h. Lysates were precipitated on a FLAG-conjugated resin and probed for coimmunoprecipitated HA–YB-1.Western analysis using 25 �g of total protein was performed to show expression of YB-1 proteins (bottom panels). Tubulin was used as a loadingcontrol. (B) Degradation of mRNA by RNase A treatment. A 500-�g aliquot of total protein of HEK293 cells expressing FLAG–YB-1 was treatedwith (�) or without () RNase A as described above. Total RNA was isolated, reverse transcribed, and amplified using YB-1-specific primers. Thearrow indicates a 606-nt PCR product. (C) Coimmunoprecipitation of YB-1 mutants. HA–YB-1 and various YB-1 mutants containing anN-terminal FLAG tag were coexpressed in HEK293 cells and subjected to coimmunoprecipitation as described in the legend for panel A. Fivemicrograms (FLAG) and 10 �g (HA and tubulin) of total lysates were used in an immunoblot assay to show expression of YB-1 proteins. YB-1mutants were sorted by the ability to interfere with P3K-induced transformation. CSD indicates the AP-CSD fragment.



EN

N S

TA

TE

UN

IVhttp://m

cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

of translation involves a more specific mechanism. mRNAbinding and the ability to oligomerize are not sufficient forinhibition of translation. Inhibition requires a C-terminal do-main that is distinct from both the CRS and the domain thatfacilitates dimerization. Nekrasov et al. have shown that YB-1interferes with translation at the initiation stage of translation.YB-1 binds to the cap region of mRNAs, but there is noapparent competition between YB-1 and eIF-4E in a 7-methylcap-binding assay (5). Several deletion mutants of YB-1 areable to bind to the cap but fail to inhibit translation and alsofail to interfere with P3K-mediated transformation. Coopera-tive binding of YB-1 and eIF-4E to the cap may occur, sinceYB-1 binds to the sugar component of mRNAs, leaving nucle-otide bases free to interact with other mRNA-binding proteins(57). Initiation of cap-dependent translation is negatively con-trolled by 4E-BPs and eIF-2� kinases (26). However, 4E-BP1levels bound to the cap are not increased in the presence ofYB-1. Likewise, phosphorylation of eIF-2� at Ser51 remainsunaffected by YB-1 (unpublished data). High levels of YB-1impair the formation of the 48S preinitiation complex (57).Therefore, YB-1 may not prevent the assembly of the transla-tional initiation complex 4F but may interfere at a later stageof initiation. It is conceivable that YB-1 interferes with mRNAscanning, assembly of the 80S ribosome, or recognition of thestart codon. We speculate that the CSD facilitates the associ-ation of YB-1 and mRNAs, whereas the C-terminal domainhas a yet-to-be-defined trans-acting function.

Our data establish a fundamental role of translation duringP3K-induced oncogenicity. YB-1 inhibits translation and as aconsequence prevents P3K- and Akt-induced transformation.Cycloheximide, a general inhibitor of translation, fails to blocktransformation by P3K or Akt, suggesting that YB-1 differen-tially affects certain mRNAs that are essential for the trans-formed phenotype (unpublished data). In this view, the sus-ceptibility to inhibition by YB-1 would be encoded by cis- or

trans-acting elements of the particular mRNAs. A recent studydescribed mRNAs that are differentially regulated during Rasor Akt activation (60). While total mRNA levels remainedlargely unchanged, a specific subset of mRNAs associated withpolysomes and entered translation. Many of these mRNAsencode proteins that regulate growth, transcription, cell-to-cellinteractions, and morphology. The challenge is now to identifythe mRNAs that are crucial for P3K-induced oncogenesis andhow they are regulated by YB-1.

ACKNOWLEDGMENTS

We thank G. Denning, J. Shi, and L. Zhao for helpful discussionsand H. Filoteo-Velasco for excellent technical assistance.

This work was supported by National Institutes of Health researchgrant CA78230. A. Bader is the recipient of Erwin-Schrodinger fel-lowships J2101 and J2278-B04 from the Austrian Science Foundation(FWF).

REFERENCES

1. Aoki, M., O. Batista, A. Bellacosa, P. Tsichlis, and P. K. Vogt. 1998. The aktkinase: molecular determinants of oncogenicity. Proc. Natl. Acad. Sci. USA95:14950–14955.

2. Aoki, M., E. Blazek, and P. K. Vogt. 2001. A role of the kinase mTOR incellular transformation induced by the oncoproteins P3k and Akt. Proc. Natl.Acad. Sci. USA 98:136–141.

3. Aoki, M., C. Schetter, M. Himly, O. Batista, H. W. Chang, and P. K. Vogt.2000. The catalytic subunit of phosphoinositide 3-kinase: requirements foroncogenicity. J. Biol. Chem. 275:6267–6275.

4. Aoki, M., V. Sobek, D. J. Maslyar, A. Hecht, and P. K. Vogt. 2002. Oncogenictransformation by beta-catenin: deletion analysis and characterization ofselected target genes. Oncogene 21:6983–6991.

5. Bader, A. G., K. A. Felts, N. Jiang, H. W. Chang, and P. K. Vogt. 2003. Ybox-binding protein 1 induces resistance to oncogenic transformation bythe phosphatidylinositol 3-kinase pathway. Proc. Natl. Acad. Sci. USA 100:12384–12389.

6. Bader, A. G., M. Hartl, and K. Bister. 2000. Conditional cell transformationby doxycycline-controlled expression of the ASV17 v-jun allele. Virology270:98–110.

7. Bader, A. G., and P. K. Vogt. 2004. An essential role for protein synthesis inoncogenic cellular transformation. Oncogene 23:3145–3150.

8. Barash, I. 1999. Prolactin and insulin synergize to regulate the translationmodulator PHAS-I via mitogen-activated protein kinase-independent but

FIG. 7. Inhibition of translation by YB-1 mutants. (A) CEF expressing YB-1 proteins as indicated were transiently transfected with pc-lucencoding the luciferase gene. Five-microgram aliquots of protein were subjected to luciferase assays. The luciferase readout was normalized to thatof cells transfected with the empty vector RCAS (1.00). YB-1 proteins able to interfere with P3K-induced transformation are indicated by blackbars; data for YB-1 proteins unable to block transformation are shown in grey. The standard deviations of three independent experiments areshown in the graph. CSD indicates the AP-CSD fragment. (B) Analysis of luciferase mRNA levels of CEF stably infected with RCAS-YB-1 orRCAS only. Cells were treated as for panel A and harvested for total RNA isolation. Luciferase mRNAs were detected by Northern blotting.GAPDH was used as a loading control.



EN

N S

TA

TE

UN

IVhttp://m

cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

wortmannin- and rapamycin-sensitive pathway. Mol. Cell. Endocrinol. 155:37–49.

9. Barrieux, A., H. A. Ingraham, S. Nystul, and M. G. Rosenfeld. 1976. Char-acterization of the association of specific proteins with messenger ribonucleicacid. Biochemistry 15:3523–3528.

10. Bellacosa, A., D. de Feo, A. K. Godwin, D. W. Bell, J. Q. Cheng, D. A.Altomare, M. Wan, L. Dubeau, G. Scambia, V. Masciullo, et al. 1995. Mo-lecular alterations of the AKT2 oncogene in ovarian and breast carcinomas.Int. J. Cancer 64:280–285.

11. Bellacosa, A., J. R. Testa, S. P. Staal, and P. N. Tsichlis. 1991. A retroviraloncogene, akt, encoding a serine-threonine kinase containing an SH2-likeregion. Science 254:274–277.

12. Blobel, G. 1972. Protein tightly bound to globin mRNA. Biochem. Biophys.Res. Commun. 47:88–95.

13. Cantley, L. C., and B. G. Neel. 1999. New insights into tumor suppression:PTEN suppresses tumor formation by restraining the phosphoinositide 3-ki-nase/AKT pathway. Proc. Natl. Acad. Sci. USA 96:4240–4245.

14. Chang, H. W., M. Aoki, D. Fruman, K. R. Auger, A. Bellacosa, P. N. Tsichlis,L. C. Cantley, T. M. Roberts, and P. K. Vogt. 1997. Transformation ofchicken cells by the gene encoding the catalytic subunit of PI 3-kinase.Science 276:1848–1850.

15. Cheng, J. Q., A. K. Godwin, A. Bellacosa, T. Taguchi, T. F. Franke, T. C.Hamilton, P. N. Tsichlis, and J. R. Testa. 1992. AKT2, a putative oncogeneencoding a member of a subfamily of protein-serine/threonine kinases, isamplified in human ovarian carcinomas. Proc. Natl. Acad. Sci. USA 89:9267–9271.

16. Corradetti, M. N., K. Inoki, N. Bardeesy, R. A. DePinho, and K. L. Guan.2004. Regulation of the TSC pathway by LKB1: evidence of a molecular linkbetween tuberous sclerosis complex and Peutz-Jeghers syndrome. GenesDev. 18:1533–1538.

17. Devroede, G., B. Lemieux, S. Masse, J. Lamarche, and P. S. Herman. 1988.Colonic hamartomas in tuberous sclerosis. Gastroenterology 94:182–188.

18. Dingwall, C., and R. A. Laskey. 1991. Nuclear targeting sequences—a con-sensus? Trends Biochem. Sci. 16:478–481.

19. Evdokimova, V., P. Ruzanov, H. Imataka, B. Raught, Y. Svitkin, L. P.Ovchinnikov, and N. Sonenberg. 2001. The major mRNA-associated proteinYB-1 is a potent 5� cap-dependent mRNA stabilizer. EMBO J. 20:5491–5502.

20. Evdokimova, V. M., and L. P. Ovchinnikov. 1999. Translational regulation byY-box transcription factor: involvement of the major mRNA-associated pro-tein, p50. Int. J. Biochem. Cell Biol. 31:139–149.

21. Fornerod, M., M. Ohno, M. Yoshida, and I. W. Mattaj. 1997. CRM1 is anexport receptor for leucine-rich nuclear export signals. Cell 90:1051–1060.

22. Freedman, D. A., and A. J. Levine. 1998. Nuclear export is required fordegradation of endogenous p53 by MDM2 and human papillomavirus E6.Mol. Cell. Biol. 18:7288–7293.

23. Fukada, T., and N. K. Tonks. 2003. Identification of YB-1 as a regulator ofPTP1B expression: implications for regulation of insulin and cytokine sig-naling. EMBO J. 22:479–493.

24. Fukuchi-Shimogori, T., I. Ishii, K. Kashiwagi, H. Mashiba, H. Ekimoto, andK. Igarashi. 1997. Malignant transformation by overproduction of transla-tion initiation factor eIF4G. Cancer Res. 57:5041–5044.

25. Gaudreault, I., D. Guay, and M. Lebel. 2004. YB-1 promotes strand sepa-ration in vitro of duplex DNA containing either mispaired bases or cisplatinmodifications, exhibits endonucleolytic activities and binds several DNArepair proteins. Nucleic Acids Res. 32:316–327.

26. Gebauer, F., and M. W. Hentze. 2004. Molecular mechanisms of transla-tional control. Nat. Rev. Mol. Cell Biol. 5:827–835.

27. Gessner, C., C. Woischwill, A. Schumacher, U. Liebers, H. Kuhn, P. Stiehl,K. Jurchott, H. D. Royer, C. Witt, and G. Wolff. 2004. Nuclear YB-1 expres-sion as a negative prognostic marker in non-small cell lung cancer. Eur.Respir. J. 23:14–19.

28. Graff, J. R., and S. G. Zimmer. 2003. Translational control and metastaticprogression: enhanced activity of the mRNA cap-binding protein eIF-4Eselectively enhances translation of metastasis-related mRNAs. Clin. Exp.Metastasis 20:265–273.

29. Hay, N., and N. Sonenberg. 2004. Upstream and downstream of mTOR.Genes Dev. 18:1926–1945.

30. Hemminki, A., D. Markie, I. Tomlinson, E. Avizienyte, S. Roth, A. Loukola,G. Bignell, W. Warren, M. Aminoff, P. Hoglund, H. Jarvinen, P. Kristo, K.Pelin, M. Ridanpaa, R. Salovaara, T. Toro, W. Bodmer, S. Olschwang, A. S.Olsen, M. R. Stratton, A. de la Chapelle, and L. A. Aaltonen. 1998. Aserine/threonine kinase gene defective in Peutz-Jeghers syndrome. Nature391:184–187.

31. Huang, T. T., N. Kudo, M. Yoshida, and S. Miyamoto. 2000. A nuclearexport signal in the N-terminal regulatory domain of I�B� controls cytoplas-mic localization of inactive NF-�B/I�B� complexes. Proc. Natl. Acad. Sci.USA 97:1014–1019.

32. Hughes, S. H., J. J. Greenhouse, C. J. Petropoulos, and P. Sutrave. 1987.Adaptor plasmids simplify the insertion of foreign DNA into helper-inde-pendent retroviral vectors. J. Virol. 61:3004–3012.

33. Inoki, K., Y. Li, T. Xu, and K. L. Guan. 2003. Rheb GTPase is a direct target

of TSC2 GAP activity and regulates mTOR signaling. Genes Dev. 17:1829–1834.

34. Inoki, K., Y. Li, T. Zhu, J. Wu, and K. L. Guan. 2002. TSC2 is phosphory-lated and inhibited by Akt and suppresses mTOR signalling. Nat. Cell Biol.4:648–657.

35. Izumi, H., T. Imamura, G. Nagatani, T. Ise, T. Murakami, H. Uramoto, T.Torigoe, H. Ishiguchi, Y. Yoshida, M. Nomoto, T. Okamoto, T. Uchiumi, M.Kuwano, K. Funa, and K. Kohno. 2001. Y box-binding protein-1 bindspreferentially to single-stranded nucleic acids and exhibits 3�35� exonucle-ase activity. Nucleic Acids Res. 29:1200–1207.

36. Janz, M., N. Harbeck, P. Dettmar, U. Berger, A. Schmidt, K. Jurchott, M.Schmitt, and H. D. Royer. 2002. Y-box factor YB-1 predicts drug resistanceand patient outcome in breast cancer independent of clinically relevanttumor biologic factors HER2, uPA and PAI-1. Int. J. Cancer 97:278–282.

37. Jefferies, H. B., S. Fumagalli, P. B. Dennis, C. Reinhard, R. B. Pearson, andG. Thomas. 1997. Rapamycin suppresses 5�TOP mRNA translation throughinhibition of p70s6k. EMBO J. 16:3693–3704.

38. Jurchott, K., S. Bergmann, U. Stein, W. Walther, M. Janz, I. Manni, G.Piaggio, E. Fietze, M. Dietel, and H. D. Royer. 2003. YB-1 as a cell cycle-regulated transcription factor facilitating cyclin A and cyclin B1 gene expres-sion. J. Biol. Chem. 278:27988–27996.

39. Kalderon, D., W. D. Richardson, A. F. Markham, and A. E. Smith. 1984.Sequence requirements for nuclear location of simian virus 40 large-T anti-gen. Nature 311:33–38.

40. Kalderon, D., B. L. Roberts, W. D. Richardson, and A. E. Smith. 1984. Ashort amino acid sequence able to specify nuclear location. Cell 39:499–509.

41. Koike, K., T. Uchiumi, T. Ohga, S. Toh, M. Wada, K. Kohno, and M.Kuwano. 1997. Nuclear translocation of the Y-box binding protein by ultra-violet irradiation. FEBS Lett. 417:390–394.

42. Kudo, N., B. Wolff, T. Sekimoto, E. P. Schreiner, Y. Yoneda, M. Yanagida, S.Horinouchi, and M. Yoshida. 1998. Leptomycin B inhibition of signal-me-diated nuclear export by direct binding to CRM1. Exp. Cell. Res. 242:540–547.

43. Lazaris-Karatzas, A., K. S. Montine, and N. Sonenberg. 1990. Malignanttransformation by a eukaryotic initiation factor subunit that binds to mRNA5� cap. Nature 345:544–547.

44. Lin, T. A., X. Kong, T. A. Haystead, A. Pause, G. Belsham, N. Sonenberg,and J. C. Lawrence, Jr. 1994. PHAS-I as a link between mitogen-activatedprotein kinase and translation initiation. Science 266:653–656.

45. Lynch, M., C. Fitzgerald, K. A. Johnston, S. Wang, and E. V. Schmidt. 2004.Activated eIF4E-binding protein slows G1 progression and blocks transfor-mation by c-myc without inhibiting cell growth. J. Biol. Chem. 279:3327–3339.

46. Ma, Y. Y., S. J. Wei, Y. C. Lin, J. C. Lung, T. C. Chang, J. Whang-Peng, J. M.Liu, D. M. Yang, W. K. Yang, and C. Y. Shen. 2000. PIK3CA as an oncogenein cervical cancer. Oncogene 19:2739–2744.

47. Mende, I., S. Malstrom, P. N. Tsichlis, P. K. Vogt, and M. Aoki. 2001.Oncogenic transformation induced by membrane-targeted Akt2 and Akt3.Oncogene 20:4419–4423.

48. Mertens, P. R., S. Harendza, A. S. Pollock, and D. H. Lovett. 1997. Glomer-ular mesangial cell-specific transactivation of matrix metalloproteinase 2transcription is mediated by YB-1. J. Biol. Chem. 272:22905–22912.

49. Minich, W. B., and L. P. Ovchinnikov. 1992. Role of cytoplasmic mRNPproteins in translation. Biochimie 74:477–483.

50. Miwa, W., J. Yasuda, Y. Murakami, K. Yashima, K. Sugano, T. Sekine, A.Kono, S. Egawa, K. Yamaguchi, Y. Hayashizaki, and T. Sekiya. 1996. Isola-tion of DNA sequences amplified at chromosome 19q13.1-q13.2 includingthe AKT2 locus in human pancreatic cancer. Biochem. Biophys. Res. Com-mun. 225:968–974.

51. Montagne, J., T. Radimerski, and G. Thomas. 2001. Insulin signaling: les-sons from the Drosophila tuberous sclerosis complex, a tumor suppressor.Sci. STKE 2001:PE36.

52. Nekrasov, M. P., M. P. Ivshina, K. G. Chernov, E. A. Kovrigina, V. M.Evdokimova, A. A. Thomas, J. W. Hershey, and L. P. Ovchinnikov. 2003. ThemRNA-binding protein YB-1 (p50) prevents association of the eukaryoticinitiation factor eIF4G with mRNA and inhibits protein synthesis at theinitiation stage. J. Biol. Chem. 278:13936–13943.

53. Neshat, M. S., I. K. Mellinghoff, C. Tran, B. Stiles, G. Thomas, R. Petersen,P. Frost, J. J. Gibbons, H. Wu, and C. L. Sawyers. 2001. Enhanced sensitivityof PTEN-deficient tumors to inhibition of FRAP/mTOR. Proc. Natl. Acad.Sci. USA 98:10314–10319.

54. Norman, J. T., G. E. Lindahl, K. Shakib, A. En-Nia, E. Yilmaz, and P. R.Mertens. 2001. The Y-box binding protein YB-1 suppresses collagen alpha1(I) gene transcription via an evolutionarily conserved regulatory element inthe proximal promoter. J. Biol. Chem. 276:29880–29890.

55. Ohga, T., T. Uchiumi, Y. Makino, K. Koike, M. Wada, M. Kuwano, and K.Kohno. 1998. Direct involvement of the Y-box binding protein YB-1 ingenotoxic stress-induced activation of the human multidrug resistance 1gene. J. Biol. Chem. 273:5997–6000.

56. Pandolfi, P. P. E. 2004. Translation and cancer. Oncogene 23:3134–3248.57. Pisarev, A. V., M. A. Skabkin, A. A. Thomas, W. C. Merrick, L. P. Ovchin-

nikov, and I. N. Shatsky. 2002. Positive and negative effects of the major



EN

N S

TA

TE

UN

IVhttp://m

cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

mammalian messenger ribonucleoprotein p50 on binding of 40S ribosomalsubunits to the initiation codon of beta-globin mRNA. J. Biol. Chem. 277:15445–15451.

58. Podsypanina, K., R. T. Lee, C. Politis, I. Hennessy, A. Crane, J. Puc, M.Neshat, H. Wang, L. Yang, J. Gibbons, P. Frost, V. Dreisbach, J. Blenis, Z.Gaciong, P. Fisher, C. Sawyers, L. Hedrick-Ellenson, and R. Parsons. 2001.An inhibitor of mTOR reduces neoplasia and normalizes p70/S6 kinaseactivity in Pten�/ mice. Proc. Natl. Acad. Sci. USA 98:10320–10325.

59. Raffetseder, U., B. Frye, T. Rauen, K. Jurchott, H. D. Royer, P. L. Jansen,and P. R. Mertens. 2003. Splicing factor SRp30c interaction with Y-boxprotein-1 confers nuclear YB-1 shuttling and alternative splice site selection.J. Biol. Chem. 278:18241–19248.

60. Rajasekhar, V. K., A. Viale, N. D. Socci, M. Wiedmann, X. Hu, and E. C.Holland. 2003. Oncogenic Ras and Akt signaling contribute to glioblastomaformation by differential recruitment of existing mRNAs to polysomes. Mol.Cell 12:889–901.

61. Ranjan, M., S. R. Tafuri, and A. P. Wolffe. 1993. Masking mRNA fromtranslation in somatic cells. Genes Dev. 7:1725–1736.

62. Ruggeri, B. A., L. Huang, M. Wood, J. Q. Cheng, and J. R. Testa. 1998.Amplification and overexpression of the AKT2 oncogene in a subset ofhuman pancreatic ductal adenocarcinomas. Mol. Carcinog. 21:81–86.

63. Ruggero, D., L. Montanaro, L. Ma, W. Xu, P. Londei, C. Cordon-Cardo, andP. P. Pandolfi. 2004. The translation factor eIF-4E promotes tumor forma-tion and cooperates with c-Myc in lymphomagenesis. Nat. Med. 10:484–486.

64. Samuels, Y., Z. Wang, A. Bardelli, N. Silliman, J. Ptak, S. Szabo, H. Yan, A.Gazdar, S. M. Powell, G. J. Riggins, J. K. Willson, S. Markowitz, K. W.Kinzler, B. Vogelstein, and V. E. Velculescu. 2004. High frequency of mu-tations of the PIK3CA gene in human cancers. Science 304:554.

65. Shaw, R. J., N. Bardeesy, B. D. Manning, L. Lopez, M. Kosmatka, R. A.DePinho, and L. C. Cantley. 2004. The LKB1 tumor suppressor negativelyregulates mTOR signaling. Cancer Cell 6:91–99.

66. Shibahara, K., K. Sugio, T. Osaki, T. Uchiumi, Y. Maehara, K. Kohno, K.Yasumoto, K. Sugimachi, and M. Kuwano. 2001. Nuclear expression of theY-box binding protein, YB-1, as a novel marker of disease progression innon-small cell lung cancer. Clin. Cancer Res. 7:3151–3155.

67. Simpson, L., and R. Parsons. 2001. PTEN: life as a tumor suppressor. Exp.Cell. Res. 264:29–41.

68. Sommerville, J., and M. Ladomery. 1996. Masking of mRNA by Y-boxproteins. FASEB J. 10:435–443.

69. Sonderegger, C. K., M. Narisawa-Saito, and P. K. Vogt. 2003. The C-termi-nal region of cellular Qin oligomerizes: correlation with oncogenic transfor-mation and transcriptional repression. Oncogene 22:1908–1915.

70. Staal, S. P., and J. W. Hartley. 1988. Thymic lymphoma induction by theAKT8 murine retrovirus. J. Exp. Med. 167:1259–1264.

71. Staal, S. P., J. W. Hartley, and W. P. Rowe. 1977. Isolation of transformingmurine leukemia viruses from mice with a high incidence of spontaneouslymphoma. Proc. Natl. Acad. Sci. USA 74:3065–3067.

72. Stade, K., C. S. Ford, C. Guthrie, and K. Weis. 1997. Exportin 1 (Crm1p) isan essential nuclear export factor. Cell 90:1041–1050.

73. Stenina, O. I., K. M. Shaneyfelt, and P. E. DiCorleto. 2001. Thrombininduces the release of the Y-box protein dbpB from mRNA: a mechanism oftranscriptional activation. Proc. Natl. Acad. Sci. USA 98:7277–7282.

74. Stolovich, M., H. Tang, E. Hornstein, G. Levy, R. Cohen, S. S. Bae, M. J.Birnbaum, and O. Meyuhas. 2002. Transduction of growth or mitogenicsignals into translational activation of TOP mRNAs is fully reliant on thephosphatidylinositol 3-kinase-mediated pathway but requires neither S6K1nor rpS6 phosphorylation. Mol. Cell. Biol. 22:8101–8113.

75. Swamynathan, S. K., B. R. Varma, K. T. Weber, and R. V. Guntaka. 2002.Targeted disruption of one allele of the Y-box protein gene, Chk-YB-1b, inDT40 cells results in major defects in cell cycle. Biochem. Biophys. Res.Commun. 296:451–457.

76. Thomas, G., D. M. Sabatini, and N. M. Hall (ed.). 2004. TOR—target ofrapamycin. Current topics in microbiology and immunology, vol. 279.Springer, Berlin, Germany.

77. Ting, J. P., A. Painter, N. J. Zeleznik-Le, G. MacDonald, T. M. Moore, A.Brown, and B. D. Schwartz. 1994. YB-1 DNA-binding protein repressesinterferon gamma activation of class II major histocompatibility complexgenes. J. Exp. Med. 179:1605–1611.

78. Uramoto, H., H. Izumi, T. Ise, M. Tada, T. Uchiumi, M. Kuwano, K. Ya-sumoto, K. Funa, and K. Kohno. 2002. p73 Interacts with c-Myc to regulateY-box-binding protein-1 expression. J. Biol. Chem. 277:31694–31702.

79. Vivanco, I., and C. L. Sawyers. 2002. The phosphatidylinositol 3-kinase AKTpathway in human cancer. Nat. Rev. Cancer 2:489–501.

80. Vogt, P. K. 1969. Focus assay of Rous sarcoma virus, p. 198–211. In K. Habeland N. P. Salzman (ed.), Fundamental techniques in virology. AcademicPress, New York, N.Y.

81. Yahata, H., H. Kobayashi, T. Kamura, S. Amada, T. Hirakawa, K. Kohno,M. Kuwano, and H. Nakano. 2002. Increased nuclear localization of tran-scription factor YB-1 in acquired cisplatin-resistant ovarian cancer. J. CancerRes. Clin. Oncol. 128:621–626.

82. Yang, H. S., A. P. Jansen, A. A. Komar, X. Zheng, W. C. Merrick, S. Costes,S. J. Lockett, N. Sonenberg, and N. H. Colburn. 2003. The transformationsuppressor Pdcd4 is a novel eukaryotic translation initiation factor 4A bind-ing protein that inhibits translation. Mol. Cell. Biol. 23:26–37.

83. Yang, J., E. S. Bardes, J. D. Moore, J. Brennan, M. A. Powers, and S.Kornbluth. 1998. Control of cyclin B1 localization through regulated bindingof the nuclear export factor CRM1. Genes Dev. 12:2131–2143.

84. Zasedateleva, O. A., A. S. Krylov, D. V. Prokopenko, M. A. Skabkin, L. P.Ovchinnikov, A. Kolchinsky, and A. D. Mirzabekov. 2002. Specificity ofmammalian Y-box binding protein p50 in interaction with ss and ds DNAanalyzed with generic oligonucleotide microchip. J. Mol. Biol. 324:73–87.

85. Zhang, Y. F., C. Homer, S. J. Edwards, L. Hananeia, A. Lasham, J. Royds,P. Sheard, and A. W. Braithwaite. 2003. Nuclear localization of Y-box factorYB1 requires wild-type p53. Oncogene 22:2782–2794.



EN

N S

TA

TE

UN

IVhttp://m

cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

Cell Transformation Box-Binding Protein 1 Blocks Oncogenic ...

Documents

Transcript of Cell Transformation Box-Binding Protein 1 Blocks Oncogenic ...