Cell Host & Microbe, Volume 17

Supplemental Information

RNase L Activates the NLRP3 Inflammasome during Viral Infections

Arindam Chakrabarti, Shuvojit Banerjee, Luigi Franchi, Yueh-Ming Loo, Michael Gale Jr, Gabriel

Núñez, and Robert H. Silverman

Supplemental Information Inventory

Supplementary Figures Figure S1. Related to Figure 1 Figure S2. Related to Figure 2 Figure S3. Related to Figure 3 Figure S4. Related to Figure 5 Figure S5. Related to Figure 6 Figure S6. Related to Figure 7 Supplementary Experimental Procedures Supplementary Reference List

Figure S1 related to Figure 1.

Figure S1. RNasel-/- mice are deficient in IFN-β production during IAV infections. Related to Figure 1. WT and Rnasel-/- mice were infected intranasally with 105 pfu of IAV. IFN-β levels were measured by ELISA (PBL Assay Science) in the BALF at 2 days post-infection. Results are expressed as the mean ± standard deviation (SD), n=5 mice in each group.

Figure S2 related to Figure 2.

Figure S2. Kinetics of IL-1β induction in wt and RNasel-/- BMDC during viral infections. Related to Figure 2. (A & B) Wt and Rnasel-/- BMDCs were unprimed or primed with LPS (200 ng/ml) for 6 hrs (as indicated) and infected with (A) VSV (moi 1) or (B) IAV (moi 1). IL-1β was measured by ELISA from cell supernatants at different times post-infection (x axes). **, p<0.01;***, p<0.001. Error bars show SD and p-values were determined by two-tailed Student’s t tests.

Figure S3 related to Figure 3.

Figure S3. Induction of IL-1β in response to ATP is independent of MAVS. Related to Figure 3. Wt and Mavs-/- BMDCs were treated with LPS (200 ng/ml) for 6 hrs or primed with LPS and treated with extracellular ATP (0.5 mM) for 1 hr (as indicated). IL-1β was measured by ELISAs.

Figure S4 related to Figure 5.

Figure S4. Cleavage of cellular and viral RNA by RNase L and characterization of the 3’-termini. Related to Figure 5. (A) Cellular RNA from Rnasel-/- peritoneal macrophages (20 µg) or (B) IAV/ΔNS1 total genomic RNA (2 µg) were incubated at 22oC with FRET probe (75 nM) in the absence and presence of (2’-5’)p3A3 and RNase L as described in Supplementary Experimental Procedures. Samples were removed at the indicated times to measure fluorescence as an indicator of RNA cleavage. RFU, relative fluorescence units. (C) Cellular RNA (20 µg) or (D) IAV/ΔNS1 RNA (2 µg) were incubated (as indicated) and analyzed on RNA chips. M, marker RNAs. (E) Wt and Rig-I-/-/Mda5-/- BMDC were primed with Pam3Csk4 (200 ng/ml) for 6 hrs and transfected with intact or RNase L-cleaved cellular RNA for 8 hrs. IL-1β was measured by ELISAs. (F,G) BMDC isolated from mice of different genotypes (as indicated) were primed with Pam3Csk4 and transfected with uncleaved or RNase L-cleaved cellular RNAs for 8 hrs. TNF-α was measured by ELISAs from cell supernatants. Error bars show SD. (H) RNA cleavage products from incubating 1 µM of C11U2C7 with 300 pM of RNase L activated with 1 µM of (2’-5’)p3A3, digested with 1 U of PNK or 2 U of SAP at 37oC for 2 min or 1hr and ligated to 5’-[32P]pCp as described [Supplementary Experimental Procedures]. Radiolabeled RNA was analyzed by 7M urea /20% PAGE and exposure of x-ray film. (I) Radioactivity of the ligated cleavage product, 5’-C11U2-5’-[32P]pCp, from panel H.

Figure S5. Related to Figure 6

Figure S5. SiRNA depletion of RNase L leads to a reduction in procaspase-1 cleavage and IL-1β secretion after IAV/ΔNS1 infection. Related to Figure 6. (A) Primary peritoneal macrophages were isolated as described previously(Banerjee et al., 2014) and infected with IAV/∆NS1 (moi=1). IL1-β levels were determined in culture supernatants by ELISAs after 18 hrs of infection. Results are shown as the means ± SD (*, p<0.05). (B, C) THP1 cells were transfected with Dharmafect II and control or RNase L specific siRNAs (100nM) (Santa Cruz Biotech). After 48 hrs, cells were infected with IAV/∆NS1 (moi of 1) for 16 hrs or primed with LPS (1 µg/ml) for 4 hrs and stimulated with ATP (5 mM) for 30 min. (B) Extracts were prepared from cells plus culture supernatants and immunoblotted with antibody to caspase-1 (Cell signaling Technology), monoclonal antibody to human RNase L(Dong and Silverman, 1995) and antibody to β-actin (Sigma-Aldrich). (C) Cell-free supernatants were analyzed by ELISAs for production of IL-1β. Values represent means ± SD. *, p<0.05; ns, not significant.

Figure S6 related to Figure 7.

Figure S6. Competition RNA binding assays with DHX33. Related to Figure 7. Purified Flag-tagged DHX33 was incubated with RNase L-cleaved biotinylated IAV M fragments (200 ng) in absence or presence (2 or 20µg of intact, RNase L-cleaved (cleaved) or cleaved and PNK-treated unlabeled IAV M RNA as competitors. Biotinylated RNA was precipitated with streptavidin beads followed by immunoblotting with anti-Flag M2 antibody to detect tagged DHX33.

SUPPLEMENTARY EXPERIMENTAL PROCEDURES MAVS knockout mice MAVS knockout mice in the C57Bl/6 background were created using conventional methods at inGenious Targeting Laboratory, Inc. using C57Bl/6 ES cells by replacing exons 2-3 of MAVS (containing the ATG start codon) with a neomycin cassette. Deletion of exons 2-3 was verified by Southern blot. Northern blot, immunoblot and qPCR analyses confirm that cells from knockout mice do not express MAVS mRNA or protein. Mice were genotyped using primers 5’-ATGGGATCGGCCATTGAACAAGATC-3’, 5’-CACCCAGCCACCAGAGTCCCCAG-3’, and 5’-CCCTGCCTCCTGTCTAAGGAAGG-3’ for detection of both the wt and mutant alleles (Y.M.L. and M.G., unpublished). Reagents and antibodies Lipopolysaccharides (LPS) from E. coli 0111:B4 (cat # L3024) and polyinosinic–polycytidylic acid sodium salt (pIC) were from Sigma-Aldrich. Pam3CSK4 (Cat. # tlrl-pms) was from InvivoGen. Recombinant murine TNF-α (315-01A) and recombinant murine GM-CSF (315-03) were from Peprotech. Antibodies used were murine IL-1β antibody (AF-401-NA) (R&D Systems), rabbit anti-murine caspase-1 antibody (generated by L.F. and G.N.), cleaved caspase-1 antibody (# 4199) (Cell Signaling Technologies), anti-human caspase-1 (A-19) antibody (cat # sc- 622) and DHX33 antibody (S-15) (cat # sc-137424) (both from Santa Cruz), DDX-1 antibody (cat # 11357-1-AP) (Proteintech), β-actin antibody (cat # A2228) (Sigma-Aldrich), anti-NLRP3 antibody (Cell Signaling Technology, D2P5E), and anti-myc antibody (clone 9E10) (Sigma-Aldrich). Mouse IL-1β ELISA kit (cat # 559603), mouse TNF-α ELISA kit (cat # 555268), human IL-1β ELISA kit (cat # 557953) were from BD Biosciences. Phorbol-12-myristate-13-acetate (PMA) (cat # 524400) was from EMD Millipore. Synthesis and purification of 2′,5′-oligoadenylates (2-5A) was performed as we described(Jha et al., 2011). Plasmids and shRNA constructs Human RNase L (wt and R667A mutant) ORF was PCR amplified and cloned into 3X-Flag-pCMV-10 plasmid (Sigma-Aldrich) between Eco RI and Bam HI sites, using following primers: Fwd, 5’ATGCATGAATTCATGGAGAGCAGGGATC 3’; Rev, 5’ATGCATGGATCCTCAGCACCCAGGGCTGG 3’. 3X FLAG-human RNase L was PCR amplified to be inserted in lentiviral vector pCMV-PL4-Neo (Addgene, Principal Investigator Eric Campeau) between NheI and BamHI sites using following primers: Fwd, 5’ATGCATGCTAGCACCATGGACTACAAAG3’ and Rev, 5’ATGCATGGATCCTCAGCACCCAGGGCTGG 3’. Human DHX33 pLVX-3X-Flag DHX33 was a generous gift from Dr. Jason Weber (Washington University, St. Louis)(Zhang et al., 2011). Human RNase L shRNA (TRCN0000226437); DDX1 shRNA (TRCN0000050500); DHX33 shRNAs (TRCN0000303662) were from Sigma-Aldrich.

siRNA mediated knockdown of RNase L in THP1 cells PMA-treated THP1 cells were grown in 24 well plates (105 cells per well) in antibiotic-free medium and transfected with 100nM siRNA(Control siRNA or RNase L siRNA from Santa Cruz Biotechnology, Inc.) using Dharmafect II siRNA transfection reagent (Thermo Scientific) according to the manufacturer’s protocol. After 48 hrs of transfection the THP1 cells were infected with IAV/∆NS1 at a moi of 1, as described above. Combined cell supernatant and cell lysate was used for immunoblots as described(Marina-Garcia et al., 2008). Immunoblotting of concentrated cell supernatants The cell supernatants were concentrated by TCA precipitation using 72 µl of 100% (w/v) trichloroacetic acid (TCA) and 30 µl of 5% cholic acid (w/v) per ml of conditioned media. The pellets were precipitated at 12000Xg for 10 minutes, washed two times with 300 µl of ice-cold acetone, and dissolved in SDS PAGE sample buffer containing 16.6% 0.2M NaOH. WesternBright ECL HRP substrate (Advansta) was used on the immunoblots. Purification of cellular and IAV/∆NS1 genomic RNA Total cellular RNA isolated from Rnasel-/- primary peritoneal macrophages was prepared using Trizol (Invitrogen). IAV/∆NS1 was grown in MDCK-NS1 cells as described previously(Gack et al., 2009). At 72 hrs post-infection (moi, 0.01), the culture supernatants were clarified by centrifugation at 6,000g at 4oC for 15 min. The clarified supernatants were passed through 0.22 µm filters (Millipore) and the filtrates were then layered on 30% sucrose cushions and further centrifuged at 112,500g for 2.5 hrs as described(Gao et al., 2012). The viral RNAs were extracted from virus pellets with TRIzol reagent (LifeTechnologies). The precipitated viral RNA preparations were resuspended in 50µl DEPC-treated water and stored at -80oC. Cleavage of RNA by RNase L Total cellular RNA from Rnasel-/- primary peritoneal macrophages (20 µg per reaction) or IAV/∆NS1 genomic RNA isolated from virus particles (2 µg per reaction) was digested in vitro with purified recombinant human RNase L (200 ng)(Dong and Silverman, 1995) and (2’-5’)p3A3 (10 µM). Control reactions were with RNase L in the absence of (2’-5’)p3A3. Cleavage of cellular and viral RNA was monitored in side reactions that included an RNA FRET probe (75 nM) containing multiple cleavage sites for RNase L(Thakur et al., 2007). Samples were taken from 0 to 60 min at 22°C to measure fluorescence as an indicator of RNase L activity. RNA cleavage products were purified using a solid-phase method (mirVana miRNA Isolation Kit, Ambion). Briefly, the cleaved RNA were purified by phenol:chloroform followed by addition 1.25 volume 100% ethanol and then passed through a filter (mirVana, Ambion). The column was then washed with wash buffers according to manufacturer’s protocol (once with wash solution 1 and twice with wash solution 2) and the total cleaved RNA was then eluted from the column using elution buffer (Ambion). There was no 2-5A carryover (<0.1 nM) in the purified cleaved RNA as determined by highly

sensitive FRET assays(Thakur et al., 2005). RNase L-cleaved IAV RNA was separated in a 0.75%TBE agarose gels and <200 nt cleaved RNA was recovered from gel pieces with Quantum Prep Freeze ‘N Squeeze Spin Columns (Bio-Rad) and precipitated with LiCl (Ambion)(Rehwinkel et al., 2010). For analysis of rRNA cleavage, total RNA from LPS-treated, pIC- transfected or virus-infected cells were isolated using Trizol (Life Technologies) and quantified using a Nanodrop analyzer. RNA was separated on RNA chips and analyzed with an Agilent Bioanalyzer 2100 (Agilent Technologies) as described previously(Xiang et al., 2003). Removal of cyclic 2’,3’-phosphoryl groups from RNA cleavage products Cellular and viral RNA (2 µg each) cleaved with RNase L:2-5A were incubated with 1U of T4 polynucleotide kinase (PNK) (Thermo Scientific) in PNK buffer (70mM Tris-HCl, pH 7.6; 10mM MgCl2; 100 mM KCl; 1mM 2-mercaptoethanol) or 2 U of shrimp alkaline phosphatase (SAP) (Affymetrix) in SAP buffer (20mM Tris HCl, pH8.0 and 10 mM MgCl2) at 37oC for 30 min. The PNK was subsequently heat inactivated at 95oC for 5 min and the SAP was inactivated at 65oC for 15 min. The RNA was isolated with mirVana micro RNA isolation kits (Ambion). To monitor removal of the cyclic 2’,3’-phosphoryl group, RNA cleavage products from incubating HPLC-purified 1 µM of C11U2C7 (IDT) with 300 pM of RNase L activated with 1 µM of (2’-5’)p3A3 and digested with 1 U of PNK or 2 U of SAP at 37oC for 2 min or 1 hr were ligated to 5’-[32P]pCp for 30 min at 37°C with 1 U of T4 RNA ligase (ThermoScientific) and 1 µM of [5’-32P]pCp [3,000 Ci/mmol] (Perkin Elmer) and analyzed by denaturing PAGE and autoradiography(Nedialkova et al., 2009). Expression and purification of Flag-DHX33 293T cells (4 x 106) were transfected using lipofectamine 2000 (Invitrogen) with FLAG-tagged human DHX33 cDNA (10 µg). At 72 h post-transfection, cells were lysed and Flag-DHX33 was immunoprecipitated using Flag M2 magnetic beads (Sigma-Aldrich). To purify Flag-DHX33 protein, the immunoprecipitated beads were incubated with Flag peptide (100 µg/mL) in 50 mM Tris-HCl, pH 7.4; 150 mM NaCl for 20 min at 25°C. The Flag-DHX33 was concentrated using Microcon centrifugal devices with a 30-kDa molecular weight cut-off (Millipore) and the purity of the protein preparations were determined by SDS/PAGE. In Vitro RNA Binding Assay IAV M RNA was internally labeled with biotinylated cytidine by in vitro transcription reactions (Life Technologies) with IAV M DNA as template (a gift from Adolfo Garcia-Sastre). Transcription reactions contained biotin-16-amino-allyl-cytidine-5’phosphate (1 mM) (Trilink Biotechnology) and unmodified ATP, CTP, UTP and GTP (7.5 mM each). Labeled RNA was gel purified and precipitated with ammonium acetate followed by phenol-chloroform extraction and ethanol precipitation. Labeled RNA (2 µg) was subjected to RNase L- mediated cleavage and, in some instances, followed by PNK treatment as described above. Purified flag-DHX33 protein (20 pMol) was incubated with

biotinylated RNA (300 ng) in buffer (50 mM Tris, pH 7.5; 150 mM NaCl; 0.3% [vol/vol] Nonidet-P40; 5 mM EDTA; and 10% [vol/vol] glycerol). Biotin-labeled RNA was precipitated with Streptavidin Agarose (Thermo Scientific). For the confirmation of DHX33-binding specificity to the cleaved, labeled IAV M RNA, precipitation was done in the absence or presence of competitor RNA (unlabeled intact, cleaved and cleaved and PNK-treated IAV M RNA; as indicated in the legend to Figure S6).

SUPPLEMENTARY REFERENCE LIST Gao, Q., Chou, Y.Y., Doganay, S., Vafabakhsh, R., Ha, T., and Palese, P. (2012). The influenza A virus PB2, PA, NP, and M segments play a pivotal role during genome packaging. Journal of virology 86, 7043-7051.

Jha, B.K., Polyakova, I., Kessler, P., Dong, B., Dickerman, B., Sen, G.C., and Silverman, R.H. (2011). Inhibition of RNase L and RNA-dependent protein kinase (PKR) by sunitinib impairs antiviral innate immunity. The Journal of biological chemistry 286, 26319-26326.

Marina-Garcia, N., Franchi, L., Kim, Y.G., Miller, D., McDonald, C., Boons, G.J., and Nunez, G. (2008). Pannexin-1-mediated intracellular delivery of muramyl dipeptide induces caspase-1 activation via cryopyrin/NLRP3 independently of Nod2. J Immunol 180, 4050-4057.

Rehwinkel, J., Tan, C.P., Goubau, D., Schulz, O., Pichlmair, A., Bier, K., Robb, N., Vreede, F., Barclay, W., Fodor, E., and Reis e Sousa, C. (2010). RIG-I detects viral genomic RNA during negative-strand RNA virus infection. Cell 140, 397-408.

Thakur, C.S., Jha, B.K., Dong, B., Das Gupta, J., Silverman, K.M., Mao, H., Sawai, H., Nakamura, A.O., Banerjee, A.K., Gudkov, A., and Silverman, R.H. (2007). Small-molecule activators of RNase L with broad-spectrum antiviral activity. Proceedings of the National Academy of Sciences of the United States of America 104, 9585-9590.

Thakur, C.S., Xu, Z., Wang, Z., Novince, Z., and Silverman, R.H. (2005). A convenient and sensitive fluorescence resonance energy transfer assay for RNase L and 2',5' oligoadenylates. Methods in molecular medicine 116, 103-113.

Xiang, Y., Wang, Z., Murakami, J., Plummer, S., Klein, E.A., Carpten, J.D., Trent, J.M., Isaacs, W.B., Casey, G., and Silverman, R.H. (2003). Effects of RNase L mutations associated with prostate cancer on apoptosis induced by 2',5'-oligoadenylates. Cancer research 63, 6795-6801.

Zhang, Y., Forys, J.T., Miceli, A.P., Gwinn, A.S., and Weber, J.D. (2011). Identification of DHX33 as a mediator of rRNA synthesis and cell growth. Molecular and cellular biology 31, 4676-4691.