CARACTERIZAÇÃO MORFOLÓGICA E MOLECULAR DE

Instituto de PG BGABiociências

Campus de Botucatu

CARACTERIZAÇÃO MORFOLÓGICA E MOLECULAR DE

Rhabdias spp. (NEMATODA, RHABDIASIDAE) PARASITAS DE

SERPENTES DA REGIÃO DE BOTUCATU –SP.

Thomaz Henrique Barrella

Tese apresentada ao Instituto de Biociências, Câmpus de Botucatu, UNESP, para obtenção do título de Doutor no Programa de Pós-Graduação em Biologia Geral e Aplicada, área de concentração Biologia de parasitas e microorganismos

Orientador: Reinaldo José da Silva

BOTUCATU - SP2009

UNIVERSIDADE ESTADUAL PAULISTA

“Júlio de Mesquita Filho”

INSTITUTO DE BIOCIÊNCIAS DE BOTUCATU

CARACTERIZAÇÃO MORFÓLOGICA E MOLECULAR DE

Rhabdias spp. (NEMATODA, RHABDIASIDAE) PARASITAS DE

SERPENTES DA REGIÃO DE BOTUCATU – SP.

Thomaz Henrique Barrella

Orientador: Reinaldo José da Silva

Tese apresentada ao Instituto de Biociências, Campus de Botucatu, UNESP, para obtenção do título de Doutor no Programa de Pós-Graduação em Biologia Geral e Aplicada, área de concentração Biologia de Parasitas e Microorganismos

BOTUCATU - SP2009

FICHA CATALOGRÁFICA ELABORADA PELA SEÇÃO TÉCNICA DE AQUISIÇÃO E TRATAMENTO DA INFORMAÇÃODIVISÃO TÉCNICA DE BIBLIOTECA E DOCUMENTAÇÃO - CAMPUS DE BOTUCATU - UNESP

BIBLIOTECÁRIA RESPONSÁVEL: SELMA MARIA DE JESUS

Barrella, Thomaz Henrique. Caracterização morfológica e molecular de Rhabdias spp . (Nematoda, Rhabdiasidae) parasitas de serpentes da Região de Botucatu - SP / Thomaz Henrique Barrella. – Botucatu : [s.n.], 2009.

Tese (doutorado) – Universidade Estadual Paulista, Instituto de Biociências de Botucatu 2009 Orientador: Reinaldo José da Silva Assunto CAPES: 20301000

1. Serpentes - Parasito – Botucatu ( SP) 2. Nematoda 3. Biologia molecular

CDD 595.182 Palavras-chave: Análise molecular; Morfologia; Rhabdias; Serpentes

Resumo

O gênero Rhabdias possui apenas uma espécie descrita como parasita de serpentes no Brasil,

Rhabdias vellardi, com sua descrição baseada apenas na fêmea parasita, e sem estudos

posteriores sobre quaisquer aspectos biológicos desse parasita. No presente estudo realizamos

a caracterização morfológica e molecular dos parasitas de serpentes do gênero Rhabdias da

região de Botucatu – SP. Das serpentes estudadas, 20,8% apresentaram-se positivas no exame

coproparasitológico para o gênero em estudo. As amostras positivas foram submetidas a

coprocultura, afim de obter as formas larvais e de vida livre para caracterização morfológica.

As fêmeas partenogenéticas parasitas foram obtidas em necrópsia de serpentes que vieram a

óbito no cativeiro e foram caracterizadas morfologicamente e molecularmente. A análise

morfológica das formas parasitas apresentou resultados que discordam dos dados existentes

para a espécie previamente descrita como parasita de serpentes do Brasil, bem como de

outras espécies do gênero, o que sugere que esta seja uma nova espécie. A análise molecular

do gene SSUrDNA foi inconclusiva.

Abstract

The genus Rhabdias has only one species described as parasite of snakes in Brazil, Rhabdias

vellardi, with the description based only on the parasitic female, with no further studies on

any biological aspects of this parasite. On the present study the morphological and molecular

characterization of the parasites of the genus Rhabdias of snakes from the Botucatu region,

São Paulo state was performed. Twenty point eight percent of the snakes were positive on the

coproparasitological exams for rhabdiasid nematodes. The positive samples were submited to

coproculture to obtain the free living and larval stages, in order to proceed their

morphological characterization. The parasitic females were obtained from the necropsy of

animals that died in captivity, and their morphological and molecular characterization was

performed. The results obtained disagree with the data for the species previously described in

Brazil and with other species from the genus, suggesting that this is a new species. The

molecular analisys of the SSUrDNA gene was inconclusive.

Agradecimentos

Em primeiro lugar agradeço à minha esposa, meu grande amor, minha amiga,

companheira, “chefa”, em fim, a razão pela qual vivo hoje… Evelinne, sem você não teria

chegado aonde cheguei, você, por muitas vezes, foi a força que me motivou a continuar

trabalhando, mesmo com tantas adversidades que se colocaram em nosso caminho ao longo

desses anos.

Agradeço aos meus pais por seu apoio, carinho, fé e amor. Sem vocês eu não

seria o homem que sou hoje, tanto pessoal como profissionalmente, os valores que trago

comigo aprendi com vocês e levarei por toda a vida.

Agradeço ao Reinaldo, meu querido orientador e amigo, pois, mesmo com todos

os problemas que enfrentamos me deu seu voto de confiança e a chance de mostrar meu

potencial. Sei que abusei, e abuso, de sua paciência por muitas vezes, mas saiba que tenho em

você uma referência de vida, um homem honesto, batalhador, dedicado e altamente altruísta,

abraçando a todos que se aproximam de você como seus filhotes, protegendo das situações

adversas, mas sem deixar de cobrar e exigir resultaodos, afim de que possamos crescer,

amadurecer e enfim alçar voô sozinhos.

Profa. Dra. Karina Rodrigues dos Santos, essa pessoa é muito mais que uma

colega de trabalho, é uma amiga muito especial, sem a qual acredito que nunca teria

terminado este trabalho. Mais uma vez peço desculpas pelos tanstornos que lhe causei, e vou

lhe agradecer eternamente por toda ajuda.

Eriquinha! Essa menina chegou de mansinho, entrou no grupo quietinha e ganhou

o coração de todos com seu jeito carinhoso, amigo e solidário. Seu apoio e auxílio foram

muito importante nesses anos de convivência, que espero se estendam por muitos e muitos

mais, mas agora sem tanta pressão… Saiba que esteja aonde estiver você sempre terá seu

amigo pronto a lhe ajudar, ouvir, aconselhar e divertir, pois a vida não é só trabalho.

Agradeço a todos os amigos de laboratório e departamento por sua amizade, pelas

palavras de carinho e apoio, vocês farão parte de minha vida para sempre, pois com cada uma

de vocês aprendi algo diferente que levarei comigo para sempre.

Agradeço ao CEVAP e toda sua equipe pela oportunidade e apoio.

Obrigado Deus por me guardar e permitir que eu chegasse até onde cheguei.

Sumário

Revisão de literatura...................................................................................................................1

Introdução.......................................................................................................................2

Revisão de literatura.......................................................................................................3

As serpentes........................................................................................................3

Trematódeos de serpentes brasileiras.................................................................5

Cestódeos de serpentes brasileiras.....................................................................5

Nematódeos de serpentes brasileiras..................................................................6

Gênero Rhabdias................................................................................................6

Caracterização molecular das espécies do gênero Rhabdias..............................9

Artigo1: Rhabdias filicaudalis n. sp. (Nematoda, Rhabdiasidae) from the snake Spilotes

pullatus (Linnaeus, 1758) (Serpentes, Colubridae).………………….....…..……….........11

Artigo2: Morphological analysis of Rhabdias sp. (Nematode, Rhabdiasidae) parasites of

snakes(Reptilia, Serpentes) from the Botucatu region, São Paulo state, Brasil...............24

Artigo3: On the life cycle of Rhabdias filicaudalis (Nematoda, Rhabdiasidae).…...……..32

Artigo4: Molecular data of Rhabdias filicaudalis (Nematoda, Rhabdiasidae) from

brazilian snakes......................................................................................................................39

Considerações gerais................................................................................................................47

Referências bibliográficas........................................................................................................49

1

Revisão de literatura

2

Introdução

Os répteis podem ser parasitados por diversos agentes, entre eles, artrópodes,

protozoários e helmintos. As serpentes (Reptilia, Squamata) estão sujeitas a todos esses

agentes parasitários, fazendo parte desse grupo de parasitas, os nematódeos pertencentes ao

gênero Rhabdias(Nematoda, Rhabdiasidae), que habitam no pulmão da serpente, podendo

levar a alterações clínicas relevantes (Santos et al., 2008).

A criação de serpentes em cativeiro, prática em franco crescimento,

principalmente em regime semi-extensivo, é uma atividade que expõe os animais à ação de

diversos parasitas (Mader, 1996). A prevalência de parasitas de ciclo monoxênico é mais

elevada do que aqueles de ciclo heteroxênico, pois este último necessita de um hospedeiro

intermediário para que o ciclo se complete (Smyth, 1994). A transmissão de parasitas de ciclo

monoxênico é favorecida pelas condições físicas e orgânicas do cativeiro e, desse modo, uma

serpente pode contaminar outros animais ou mesmo se recontaminar com agentes parasitários

de suas próprias fezes. Além disso, a condição de cativeiro ou o estresse relacionado a essa

condição pode ser responsável pela aquisição ou pelo aumento na infecção parasitária

(Klingenberg, 1993). Por esses motivos, as infecções parasitárias têm sido um dos grandes

problemas para a criação de serpentes em cativeiro e cada vez mais vem despertando a

atenção da comunidade científica. Nesse sentido, Araujo et al. (1999) necropsiaram

exemplares de cascavéis (Crotalus durissus terrificus) e urutus (Bothrops alternatus),

mantidas em cativeiro. Esses animais apresentavam anorexia, desidratação, diarréia, anemia e

foram a óbito em torno de dois meses após o início dos sinais clínicos. Foram identificados,

nesses animais, helmintos dos gêneros Kalicephalus, Ophidascaris, Rhabdias e Oxyuris;

protozoários do gênero Hepatozoon (citado como Haemogregarina pelos autores); e ácaros do

gênero Ophionyssus. Silva et al. (2001) estudaram a freqüência de nematódeos em 24

exemplares de serpentes C. d. terrificus no cativeiro e encontraram parasitas no estômago

(16,7%), intestino (12,5%) e pulmão (70,8%). Rosselini (2007) fez a caracterização da

helmintofauna de Helicops leopardinus provenientes do pantanal sul matogrossense. Grego et

al. (2004) fizeram um estudo comparativo dos efeitos patológicos dos parasitas em serpentes

Bothrops jararaca provenientes da natureaza e de cativeiro e relataram que os efeitos

patológicos eram mais intensos nas serpentes mantidas em cativeiro do que em serpentes

provenientes da natureza, embora essas possuíssem algumas vezes uma maior quantidade de

parasitas. Santos et al. (2008) estudaram os efeitos patológicos de parasitas do gênero

3

Rhabdias em serpentes, e puderam verificar alterações relevantes no tecido pulmonar e em

fatores hematológicos que podem comprometer a sanidade das serpentes.

Entre os nematódeos parasitas de répteis no Brasil, pode-se destacar a ocorrência

de espécies do gênero Rhabdias. Apesar das alterações patológicas causadas por nematódeos

desse gênero (Grego et al., 2004, Santos et al., 2008), a literatura relacionada à caracterização

morfológica e molecular é ainda precária. Para as serpentes do Brasil a única espécie descrita

é Rhabdias vellardi, uma vez que outra espécie, Rhabdias labiata foi considerada sinonímia

de Acanthorhabdias acanthorhabdias por Baker et al. (1983).

Revisão de literatura

As serpentes:

As serpentes pertencem ao filo Chordata, subfilo Vertebrata, classe Reptilia,

ordem Squamata, subordem Serpentes. Como outros répteis, possui o corpo recoberto por

escamas de queratina, respiração aeróbica e são heterotérmicas, além disso, podem ser

ovíparas ou vivíparas, são predadoras, possuem o corpo longo e cilíndrico, sem membros, não

possuem ouvido externo, não possuem pálpebras, em seu lugar apresentam uma escama

modificada, espéculo, que recobre e protege o olho. Os órgãos internos são alongados afim de

acomodarem-se no estreito espaço celomático (Silva, 2000). As serpentes estão divididas em

17 famílias, 455 gêneros e 2974 espécies (Benton, 2005), das quais 9 famílias ocorrem no

Brasil, com um total de 358 espécies (SBH, 2009).

As serpentes podem ser infectadas por uma grande variedade de parasitas internos

e externos. Os helmintos de serpentes são parasitas tipicamente internos e são relatados com

freqüência nesses animais. Trematódeos, cestódeos e nematódeos são os mais importantes

helmintos de serpentes brasileiras (Silva, 2000).

As infecções parasitárias são uma das causas de morte mais importantes em

serpentes. Entretanto, a taxa de mortalidade em criações tem diminuído devido ao

melhoramento das práticas de herpetocultura, mas é ainda um problema muito significativo.

Os sintomas associados com o parasitismo são a anorexia (recusa a alimentar), perda do peso,

inatividade, letargia, retardo no crescimento, problemas na reprodução, regurgitação, diarréia,

muco nas fezes, desidratação, depressão ou agitação, anormalidades neurológicas e morte

(Klingenberg,1993).

4

Helmintos podem afetar a saúde das serpentes por vários mecanismos. Por

exemplo, os ancilostomídeos sugam e causam a perda de sangue, os vermes pulmonares

promovem exsudatos, alguns nematódeos promovem a obstrução mecânica do intestino, e a

maioria deles compete com o hospedeiro pelo alimento ingerido (Klingenberg, 1993). Por

estas razões, o controle dos helmintos em serpentes é muito importante., Muitos

pesquisadores estudam a helmintofauna das serpentes a fim conhecê-la e, dessa forma, tratar e

prevenir melhor as infecções.

A literatura possui vários trabalhos relatando novas espécies de helmintos ou

novos hospedeiros para as espécies já descritas, porém, há poucos trabalhos de revisão

específicos sobre os helmintos brasileiros. Yamaguti (1971), Travassos et al. (1969), Correa

(1980), e Thatcher (1993) são as principais revisões sobre trematódeos; Yamaguti (1961) e

Vicente et al. (1993) são importantes trabalhos sobre nematódeos; e Yamaguti (1959) e

Schmidt (1986), sobre cestódeos.

Após estes estudos de revisão, poucos trabalhos sobre helmintos de serpentes

brasileiras foram publicados. Foram descritas duas novas espécies de nematódeos,

Ophidascaris durissus (Panizzutti et al., 2003) e Ophidascaris tuberculatum (Siqueira et al.,

2005), e também uma espécie de trematódeo, Haplometroides intercaecalis (Silva et al.,

2007). Além disso, outros estudos foram publicados relatando algumas espécies de serpentes

brasileiras como novos hospedeiros para helmintos já descritos, entre eles, Ochetosoma

heterocoelium em Chironius exoletus (Silva et al., 1999), Rhabdias labiata , em Crotalus

durissus terrificus (Silva et al., 2001a); Crepidobothrium sp. e Sticholecitha serpentis em

Bothrops moojeni (Silva et al., 2001b; Barrella e Silva, 2003), Haplometroides buccicola em

Micrurus frontalis (Silva e Barrella, 2002), Phalotris lativittatus (Silva et al., 2005a),

Leptotyphlopps koppesi (Silva et al., 2005b), Haplometroides intercaecalis (Silva et al., 2007)

em Phalotris matogrossensis (Silva et.al., 2008) e Ophiotaenia sp. em Corallus caninus

(Silva et al., 2006).

Esses achados demonstram que a relação parasito-hospedeiro, levando-se

consideração a fauna de animais silvestres, em particular, as serpentes, é ainda objeto de

estudo dos parasitologistas e reforçam sobremaneira a necessidade de estudo da

helmintofauna desses animais.

Treamtódeos de serpentes brasileiras

5

Existem 44 espécies de trematódeos parasitas de serpentes brasileiras. Estas

espécies estão agrupadas em 4 ordens, 12 famílias e 23 gêneros (Rosselini, 2008; Trombeta,

2008).

As espécies são: Ophiodiplostomum spectabile,Ophiodiplostomum

ophiodiplstomum, Heterodiplostomum lanceolatum, Petalodiplostomum ancyloides,

Petalodiplostomum aristotersi, Paradistomum boae, Paradistomum parvissimum, Infidum

infidum, Infidum similis, Mesocoelium monas, Mesocoelium sibynomorphi, Aliptrema

ribeiroi, Ochetosoma heterocoelium, Plagiorchis luehei, Glypthelmins linguatula,

Glossidiella ornata, Bieria artigasi, Styphlodora condita, Styphlodora gili, Styphlodora

styphlodora, Glossidioides loossi, Travtrema stenocotyle, Sticholecitha serpentis,

Haplometroides buccicola, Haplometroides odhneri, Haplometroides intercaecalis,

Opisthogonimus afranioi, Opisthogonimus artigasi, Opisthogonimus fariai, Opisthogonimus

fonsecai, Opisthogonimus interrogativus, Opisthogonimus lecithonotus, Opisthogonimus

megabothrium, Opisthogonimus pereirai, Westella sulina, Westella philodryadum, Westella

serpentis, Liophistrema pulmonalis, Telorchis clava, Leurosoma rufolbarthi, Cotylotretus

rugosus, Catadiscus dolichocotyle, Catadiscus freitaslenti e Catadiscus rochai.

Cestódeos de serpentes brasileiras

Existem 14 espécies de cestódeos parasitas de serpentes brasileiras. Essas espécies

estão incluídas na ordem Protocephalidea, família Proteocephalidae, e estão agrupadas 3

gêneros, Crepidobothrium, Proteocephalus e Ophiotaenia (Fabio & Taty – Son Rolas, 1974;

Rosselini, 2008; Trombeta, 2008).

As espécies são: Crepidobothrium dollfusi, Crepidobothrium garzonii,

Crepidobothrium gerrardii, Crepidobothrium lachesidis, Crepidobothrium viperis,

Ophiotaenia calmetti, Oochoristica vanzolinni, Ophiotaenia elongata, Ophiotaenia flava,

Ophiotaenia hyalina, Ophiotaenia macrobothria, Ophiotaenia racemosa, Proteocephalus

arandasi, Proteocephalus jarara e Proteocephalus joanae.

Nematódeos de serpentes brasileiras

Existem 39 espécies de nematódeos parasitas de serpentes brasileiras. Essas

espécies estão agrupadas em 10 ordens, 13 famílias e 20 gêneros (Rosselini, 2008; Trombeta,

2008).

6

As espécies são: Rhabdias vellardi, Acanthorhabdias acanthorhabdias,

Strongyloides ophidae, Capillaria crotali, Pseudocapillaria (pseudocapillaria) amarali,

Pseudocapillaria (Pseudocapillaria) cesarpintoi, Pseudocapillaria (Ichthyocapillaria)

murinae, Kalicephalus appendiculatus, Kalicephalus costatus costatus, Kalicephalus inermis

inermis, Kalicephalus rectiphilus neorectiphilus, Kalicephalus subulatus, Oswaldocruzia

brasiliensis, Aplectana papilifera, Aplectana travassossi, Cruzia rudolphii, Falcaustra

mascula, Oxyascaris oxyascaris, Contracaecum serpentis, Bufonerakis rodriguesi, Ascaridia

flexuosa, Hexametra boddaertii, Ophidascaris arndti, Ophidascaris cretinorum, Ophidascaris

durissus, Ophidascaris obconica, Ophidascaris sicki, Ophidascaris sprenti, Ophidascaris

travassosi, Ophidascaris trichuriformis, Ophidascaris tuberculatum, Polydelphis

quadrangularis, Travassosascaris araujoi, Physaloptera liophis, Physaloptera monodens,

Physaloptera obtusissima, Hastospiculum digiticaudatum, Hastospiculum onchocercum,

Piratuba carinii.

Gênero Rhabdias

Os nematódeos, chamados de vermes cilíndricos, são o maior filo dentre os

Aschelmintos, com mais de 12000 espécies descritas. Podem ser de vida-livre, habitando

ambientes aquáticos (água doce ou salgada) e terrestres, ou parasitas, exibindo diversos graus

de parasitismo em virtualmente todos os grupos de vegetais e animais (Ruppert et al., 2005).

Existem numerosas espécies deste grupo que parasitam anfíbios, répteis, aves e mamíferos

(Smith, 1994). Entre os répteis brasileiros, existem descritas mais de 120 espécies de

nematódeos parasitas, sendo 39 parasitas de serpentes, dentre eles aqueles pertencentes ao

gênero Rhabdias (Vicente et al., 1993).

O gênero Rhabdias foi criado por Stiles e Hassall (1905) para acomodar a espécie

Rhabdias bufonis, previamente descrita por Schrank (1788) sob outro gênero. O gênero

Rhabdias possui, hoje, 56 espécies descritas, sendo 37 parasitas de anfíbios (Anura, Apoda e

Caudata) e 19 de répteis (Sauria, Chamaleones e Serpentes). Após a descrição do gênero por

Stiles e Hassall (1905), os artigos de descrição de espécies tiveram uma retomada em 1924

com 2 trabalhos de Goodey, descrevendo Rhabdias sphaerocephala e incluindo no gênero a

espécie Rhabdias fucovenosa, originalmente descrito por Railliet (1899) em outro gênero.

Durante o período de 1924 a 1945 foram descritas outras 21 espécies, sendo estas até hoje

incluídas no gênero. Outras espécies, como R. labiata foram retiradas do gênero, neste caso

7

por estudos mais recentes terem mostrado que o que se conhecia como R. labiata, na verdade

era a forma imatura de A. acanthorhabdias, outro gênero da família Rhabdiasidae (Baker,

1983). De 1945 até o final da década de 1990, 20 novas espécies foram descritas ou incluídas

no gênero Rhabdias. Desde 2001 até o presente momento foram descritas 12 novas espécies,

sendo Rhabdias leonae (Martinez- Salazar, 2006) a última espécie descrita no gênero (Baer,

1930; Bursey et al., 2003; Bursey e Goldberg 2005; Kuzmin, 2003; Kuzmin et al., 2003;

Kuzmin et al. 2005; Lhermitte-Vallarino e Bain, 2004; Martínez-Salazar, 2006; Martínez-

Salazar e León-Règagnon, 2006; Sarkar e Manna, 2004; Tkach et al. 2006; Yuen, 1965).

As espécies do gênero Rhabdias parasitam hospedeiros de grupos específicos

(Baker et al., 1983) e estão distribuídas da seguinte maneira:

Anuros: Rhabdias africanus, Rhabdias americanus, Rhabdias androgyna, Rhabdias

australensis, Rhabdias bakeri, Rhabdias bicornis, Rhabdias brachylaimus, Rhabdias

bufonis, Rhabdias bulbicauda, Rhabdias collaris, Rhabdias dossei, Rhabdias

elegans, Rhabdias fulleborni, Rhabdias globocephala, Rhabdias hermaphrodita,

Rhabdias hylae, Rhabdias incerta, Rhabdias joaquinensi, Rhabdias madagascariensis,

Rhabdias montana, Rhabdias mucronata, Rhabdias multiproles, Rhabdias nipponica,

Rhabdias polypedates, Rhabdias ranae, Rhabdias rhacophori, Rhabdias rotundata,

Rhabdias rubrovenosa, Rhabdias savagei, Rhabdias shortii, Rhabdias

sphaerocephala, Rhabdias thapari, Rhabdias tobagoensis e Rhabdias truncata.

Cecílias: Rhabdias bdellophis e Rhabdias escheri.

Salamandras: Rhabdias tokyoensis, Rhabdias tarichae, Rhabdias bermani e Rhabdias

ambystomae.

Lagartos: Rhabdias anolis, Rhabdias japalurae, Rhabdias jarki, Rhabdias leonae.

Camaleões: Rhabdias chameleonis e Rhabdias gemellipara.

Serpentes: Rhabdias agkistrodonis, Rhabdias elaphe, Rhabdias eustreptos, Rhabdias

fuscovenosa, Rhabdias horigutii, Rhabdias kurilensis, Rhabdias lamothei, Rhabdias

martinoi, Rhabdias vellardi e Rhabdias vibakari.

Na América do Sul foram relatadas as espécies R. androgyna, R. elegans , R.

fulleborni, R. hermaphrodita, R. mucronata e R. truncata como parasitas de anfíbios anuros e

R. vellardi como parasita de serpentes (Bursey et al., 2003).

No Brasil são relatadas a existência de R. vellardi em serpentes (Araujo et

al.,1999; Silva et al., 2007; Santos et al., 2008), R. androgyna, R. elegans, R. fuscovenosa e

8

R. sphaerocephala em anfíbios (Boquimpani-Freitas, 2001; Luque et al., 2005), e Rhabdias

sp. em lagartos (Goldberg et al., 2006), sendo que existem somente 4 espécies do gênero

Rhabdias descritas em lagartos, sendo a espécie descrita com ocorrência mais próxima R.

anolis, no México (Martinez–Salazar, 2006).

Os integrantes do gênero Rhabdias possuem ciclo de vida monoxênico com uma

fase parasitária, por alguns autores considerada um hermafrodita protândrico, e por outros

uma fêmea que se reproduz por partenogênesa, posição essa compartilhada por esse autor, e

uma fase de vida livre, com machos e fêmeas que se reproduzem de forma sexuada.

Apresentam 3 estádios larvais, sendo L1 e L2 correspondentes à forma rabditóide e L3, a

forma filarióide, sendo esta a forma infectante (Smyth, 1994).

As fêmeas partenogenéticas, parasitas alojam-se no pulmão dos hospedeiros e

podem liberar ovos larvados ou larvas na luz pulmonar. Esses ovos e larvas são levados para a

cavidade oral e faringe, sendo então deglutidos; passam pelo trato digestório e são eliminados

nas fezes. As larvas, L1, que eclodem dos ovos podem se desenvolver em L2, e passar

diretamente ao estágio infectante, L3, um processo conhecido como desenvolvimento

homogônico. Outras espécies possuem um ciclo aonde as larvas se desenvolvem em machos e

fêmeas de vida livre, que irão reproduzir e a partir dos ovos gerados por eles é que terão

origem as larvas infectantes, sendo este processo conhecido como desenvolvimento

heterogônico. Com exceção de R. fuscovenosa, R. agkistrodonis e R. elaphe, todas as outras

espécies que tiveram seus ciclos de vida estudados possuem a fase de vida livre homogônica

ou heterogônica, estas espécies, porém, apresentaram larvas infectantes originadas pelos dois

processos, possuindo assim tanto o ciclo homogônico como heterogônico (Anderson, 2000;

Chu, 1963; Kuzmin, 1999; Kuzmin e Miskov,1999) . A forma como as larvas infectntes

penetram no organismo do hospedeiro depende a que grupo ele pertence, anfíbios são

infectados por penetração ativa das larvas através da pele, enquanto que répteis, presume-se,

são infectados pela penetração ativa das larvas na mucosa oral, ou ainda através da ingestão

de hospedeiros paratênicos com posterior penetração das larvas pela mucosa do trato gastro-

intestinal. Ao penetrarem no organismo do hospedeiro as larvas se desenvolvem até sub-

adultos e migram via fáscia ou cavidade celomática até os pulmões, aonde terminam seu

desenvolvimento e começam a produzir ovos (Anderson, 2000).

As fêmeas parasitas são a forma do ciclo de vida pela qual as espécies do gênero

Rhabdias são caracterizadas, por ser a forma que podemos encontrar diretamente no

hospedeiro, não havendo dúvida da relação entre ambos, ao contrário das formas de vida livre.

Morfologicamente, as fêmeas parasitas deste gênero podem ter de 2,4 mm (R. horugutti) a

9

19,8 mm (R. africanus), na região oral podem apresentar 4 ou 6 lábios, 2 pseudolábios ou

ainda lábios ausentes, o esôfago é claviforme, podendo este apresentar corpo inflado ou não,

são didelfas e anfidelfas, com vulva na região pré-equatorial, equatorial ou pós-equatorial, os

ovos acumulam-se, em número variável, na região do útero próxima à vulva. A cauda é em

geral cônica podendo apresentar ou não um prolongamento cuticular (Bursey et al, 2003).

As formas larvais e de vida livre das espécies do gênero Rhabdias foram pouco

estudadas, sendo sua morfologia ainda pouco conhecida, porém de forma geral as larvas L1 e

L2 apresentam esôfago curto, do tipo rabditóide, as larvas L3 apresentam esôfago tipo

filarióide, ocupando até metade do comprimento total do corpo, os machos e fêmeas de vida

livre apresentam esôfago com istmo entre o bulbo e a porção anterior do esôfago. Os machos

possuem um par de espículos curvados, sem gubernáculo e as fêmeas são didelfas e

anfidelfas, com a vulva em posição equatorial, produzindo poucos ovos que se alojam em

fileira única no útero e são eliminados larvados.

No caso espeífico de R. vellardi, única espécie descrita em serpentes do Brasil, é

conhecida apenas a morfologia da fêmea parasita, que apresenta comprimento total variando

de 3,0 a 3,3 mm, 6 lábios, vulva equatorial, esôfago com 260 a 270 µm de comprimento e

ovos larvados com 69 µm de comprimento por 38 a 46 µm de largura, em média, e dos

adultos de vida livre (Bursey et al., 2003).

Caracterização molecular de espécies do gênero Rhabdias

Com relação à caracterização molecular dos animais deste gênero, os trabalhos

estão em fase inicial. O primeiro segmento sequenciado pertence ao gene 18s rRNA da

espécie Rhabdias bufonis por Dorris et al. (2002)(GenBank: AJ417022). O próximo registro

de sequencia genômica depositada no genebank deu-se em 2006, foram sequências de rRNA

(genes 18s, 5.8s e 28s) de Rhabdias ranae (GenBank: DQ264766). A partir de então outras 84

sequências foram depositadas, pertencendo estas às espécies R. ranae (GenBank: DQ264766,

DQ264767, DQ264768, EU360841, EU360842, EU360843, EU360844, EU360823,

EU360824, EU360825, EU360826), Rhabdias bakeri (GenBank: DQ264770, DQ264771,

DQ264772, DQ264773, DQ264774, EU360833, EU360834, EU360835, EU360836,

EU360837, EU360838, EU360839, EU360840, EU360827, EU360828, EU360829,

EU360830, EU360831, EU360832), Rhabdias pseudosphaerocephala (GenBank: DQ845734,

DQ845735, DQ845736, DQ845737, DQ845738, EU836833, EU836834, EU836835,

10

EU836836, EU836837, EU836838, EU836839, EU836871, EU836872, EU836873),

Rhabdias sphaerocephala (GenBank: DQ845739, DQ845740, DQ845741), Rhabdias sp. SD-

2008 (GenBank: EU836840, EU836841, EU836869, EU836870), Rhabdias cf. hylae

(GenBank: EU836842, EU836843, EU836844, EU836845, EU836846, EU836847,

EU836848, EU836849, EU836850, EU836851, EU836852, EU836853, EU836854,

EU836855, EU836856, EU836857, EU836858, EU836859, EU836860, EU836861,

EU836862, EU836863, EU836864, EU836865, EU836866, EU836867, EU836868,

EU836874) e Rhabdias okunensis (GenBank: FM179476, FM179477, FM179478,

FM179479), com a última sequência depositada em 2008. Apesar de existir 86 sequências

genéticas depositadas no GenBank, estas pertencem a somente 7 espécies das 56 descritas

para o gênero Rhabdias, e ainda não foi estabelecida uma sequência padrão para a

comparação entre as espécies, sendo esta ferramenta ainda insuficiente para, sozinha,

caracterizar uma espécie. Com mais estudos esta ferramenta poderá ser confiável para a

caracterização das espécies, porém, no presente momento, a forma de identificação mais

confiável ainda é a análise morfológica e morfométrica dos espécimes.

Os trabalhos científicos com parasitas do gênero Rhabdias no Brasil tem sido

limitados a relatos de ocorrência, registro de novos hospedeiros para espécies já conhecidas e

estudos de efeitos patológicos destes parasitas em seus hospedeiros. Nenhum trabalho de

análise morfológica detalhado foi realizado com as espécies de ocorrência no país,

especialmente no que diz respeito a R. vellardi, cujos dados morfométricos conhecidos são os

da descrição original feita por Pereira (1928).

Assim, trabalhos relacionados ao estudo do ciclo biológico e à caracterização

molecular destes nematódeos são ainda necessários para o melhor conhecimento destes

parasitas no Brasil.

11

Artigo 1 Rhabdias filicaudalis n. sp. (Nematoda, Rhabdiasidae) from the snake Spilotes

pullatus (Linnaeus, 1758) (Serpentes, Colubridae)

(Artigo redigido segundo as normas da revista no Journal of Helmintology)

12

Rhabdias filicaudalis n. sp. (Nematoda, Rhabdiasidae) from the snake Spilotes pullatus

(Linnaeus, 1758) (Serpentes, Colubridae)

T.H. Barrella1*, K.R. dos Santos2, R.J. da Silva3

1Postgraduate student, General and Applied Biology Postgraduate Course, Instituto de

Biociências, Universidade Estadual Paulista, Botucatu, São Paulo State, Brazil

2Departament of Veterinary Medicine, Universidade Federal do Piauí, Bom Jesus, Piauí State,

Brazil.

3Department of Parasitology, Instituto de Biociências, Universidade Estadual Paulista,

Botucatu, São Paulo State, Brazil.

ABSTRACT

Rhabdias filicaudalis n. sp (Nematoda, Rhabdiasidae) from the lung of Spilotes pullatus

(Serpentes, Colubridae) is described. The host snake was obtained in the municipality of

Avaré, São Paulo State, Brazil. This is the 57th species assigned to the genus. Rhabdias

filicaudalis n. sp. differs from all other species by the combination of the following

characters: straight body, truncated anterior end, 6 weakly developed lips placed in two

opposite groups of three, pre-equatorial vulva, esophagus length/body length ratio 5.1–7.5

(6.1 ± 0.8), nerve ring distance from anterior end/esophagus length ratio 36.9–59.1 (45.6 ±

7.8), tail length/body length ratio 3.1–4.2 (3.7 ± 0.4), vulva distance from anterior end/body

length ratio 40.6–47.5 (44.5 ± 2.7), and specially by the cuticular filiform tail tip.

Key words: Rhabdias filicaudalis n. sp., taxonomy, Nematoda, Rhabdiasid, Spilotes pullatus,

Colubridae, lungs, Brazil.

13

INTRODUCTION

Nematodes of the genus Rhabdias (Stilles and Hassall, 1905) are cosmopolitan and 56

species are included in this genus, 37 parasites of amphibians (Anura, Apoda and Caudata)

and 19 of reptiles (Sauria, Chamaleones and Serpentes)(Baer, 1930, Bursey et al., 2003,

Bursey & Goldberg, 2005, Kuzmin, 2003, Kuzmin et al., 2005, Lhermitte-Vallarino & Bain,

2004, Martínez-Salazar, 2006, Martínez-Salazar & León-Règagnon, 2006, Tkach et al., 2006,

Yuen, 1965).

Ten species have been recorded parasitizing snakes and only four are distributed in the

Americas, Rhabdias eustreptos (MacCallum, 1921, Chitwood and Chitwood, 1934), Rhabdias

fuscovenosa (Railliet, 1899, Goodey, 1924), Rhabdias lamothei (Martinez-Salazar and Leon-

Regagnon, 2006) and Rhabdias vellardi (Pereira, 1928). In Brazil, the only species recorded is

R. vellardi, with reports in many species of snakes throughout the country. Except the original

description by Pereira (1928), all publications are limited to the report of occurrence of this

parasite, with no new data on morphological aspects or life-cycle.

During a survey on the occurrence of rhabdiasid nematodes in snakes from São Paulo

State, Brazil, a Spilotes pullatus (Linnaeus, 1758) specimen hosting specimens of Rhabdias

sp. was found. The nematodes did not match with the data for R. vellardi or any other

Rhabdias species previously described as parasites of snakes. The aim of this study is to

describe a new species of Rhabdias.

MATERIAL AND METHODS

The host snake, an adult male S. pullatus, was collected in January 10th 2006, at

municipality of Avaré, São Paulo State, Brazil and was received at the Centro de Estudos de

Venenos e Animais Peçonhentos (CEVAP) at the Universidade Estadual Paulista (UNESP) in

Botucatu, São Paulo State, Brazil. The snake died in captivity and the necropsy revealed

14

nematodes in the lungs (n = 168). These nematodes were fixed in AFA solution and then

transferred to 70% alcohol for further processing. Six of them were cleared with lactophenol

and were analyzed in a computerized system for image analysis (Qwin Lite 3.1, Leica

Microsystems, Wetzlar, Germany). Measurements for these 6 specimens are here reported as

minimum–maximum (mean ± standard deviation). Drawings were made with the aid of a

drawing tube. The scanning electron microscopy was performed by a specialized unit at the

university in 3 specimens. Measures are given in micrometers unless otherwise specified. The

holotype was deposited in the Coleção Helmintológica of the Instituto Oswaldo Cruz

(CHIOC), Rio de Janeiro State, Brazil. The paratypes were deposited in the Coleção

Helmintológica (CHIBB) of the Departamento de Parasitologia, Instituto de Biociências,

Universidade Estadual Paulista, UNESP, Botucatu, São Paulo State, Brazil.

DESCRIPTION

Rhabdias filicaudalis n. sp. (Fig. 1-3)

Body straight, outer layers not swollen, fine transversal striations at the anterior and

posterior ends, anterior end truncated, posterior end conical, ending with a fine prolongation

of the cuticle, oral opening surrounded by 2 groups of 3 weakly developed lips, with buccal

capsule cup shaped in lateral view and round in apical view, esophagus club shaped, intestines

with thick walls, filled with a brown content, slightly pre-equatorial vulva with indistinct lips,

uterus filled with 30 to 40 embryonated or containing larvae eggs, genital system

amphidelphic.

Measures: total body length 3.89 – 5.34 (4.74 ± 0.55) mm; width 129.7 – 197.0 (170.8 ±

25.4); buccal capsule 10.6 – 14.2 (12.6 ± 1.1) wide and 8.3 – 11.2 (9.7 ± 1.1) deep; esophagus

271.7 – 301.0 (287.4 ± 10.3) in length with 28.6 – 35.9 (32.9 ± 2.6) width at the beginning,

35.4 – 40.3 (38.3 ± 2.2) width at the middle and 47.8 – 54.9 (51.4 ± 2.8) max width at the

15

posterior portion; nerve ring 105.6 – 173.4 (131.5 ± 24.9) from the beginning of the

esophagus; vulva from the anterior end 1693.0 – 2534.9 (2110.9 ± 318.9); tail 145.2 – 197.4

(176.1 ± 22.6); eggs 33.2 – 42.8 (40.0 ± 2.9) wide and 61.3 – 78.4 (67.6 ± 5.0) long.

Proportions (%): esophagus length to total body length 5.1 – 7.5 (6.1 ± 0.8), nerve ring

distance from anterior end to esophagus length 36.9 – 59.1 (45.6 ± 7.8), tail length to total

body length 3.1 – 4.2 (3.7 ± 0.4), vulva distance from anterior end to total body length 40.6 –

47.5 (44.5 ± 2.7).

Taxonomic summary

Type host and locality: S. pullatus, from the municipality of Avaré, São Paulo State, Brazil

(48o55’W, 23o6’S, 766 m).

Site of infection: lungs.

Specimens deposited: Holotype (CHIOCC 35653a) and 5 paratypes (CHIOCC 35653b),

parasitic adult female, deposited at the Coleção Helmintológica do Instituto Oswaldo Cruz

(CHIOC) at the Fundação Instituto Oswaldo Cruz (FIOCRUZ), Rio de Janeiro, Rio de Janeiro

State, Brazil. Other paratypes were deposited at the Coleção Helmintológica do Instituto de

Biociências de Botucatu at the Instituto de Biociências de Botucatu, Unesp, Botucatu, São

Paulo State, Brazil under the number CHIB 4755.

Etymology: The new species was named in reference to the filiform prolongation of the

cuticle at the tail.

Remarks: Rhabdias filicaudalis n. sp. differs from all other species of this genus by the

combination of the following characters: total body length 3.89–5.34 mm, truncated anterior

end, 6 weakly developed lips placed in two groups of three, esophagus length/total body

16

length ratio 5.1 – 7.5%, tail length/body length ratio 3.1 – 4.2%, pre-equatorial vulva, short

cone shaped tail with a terminal filiform prolongation of the cuticle.

Among the 56 species included in the genus Rhabdias, only 7 were reported in South

America: Rhabdias androgyna (Kloss, 1974), Rhabdias elegans (Gutierrez, 1945), Rhabdias

fuelleborni (Travassos, 1926), Rhabdias hermaphrodita (Kloss, 1971), Rhabdias mucronata

(Schuurmans Stekhoven, 1952) and Rhabdias truncata (Schuurmans Stekhoven, 1952) as

parasites of amphibians and R. vellardi as parasite of snakes. Only R. fuelleborni is close

related to R. filicaudalis n. sp. by the presence of 6 lips and pre-equatorial vulva. Rhabdias

fuelleborni differs from R. filicaudalis n. sp. by the total body length (10 – 20 mm to R.

fuelleborni vs. 3.89 – 5.34 mm to R. filicaudalis n. sp.), esophagus length (450 – 500 vs.

271.7 – 301 in R. filicaudalis n. sp.), presence of inflated corpus in R. fuelleborni and absence

in R. filicaudalis n. sp. and host preference (amphibians vs snakes to R. filicaudalis n. sp.).

Rhabdias mucronata and R. truncata could not be compared to R. filicaudalis n. sp. due to the

fact that the parasitic adults of this species are unknown.

Rhabdias agkistrodonis (Sharpilo, 1976), Rhabdias elaphe (Sharpilo, 1976), R.

eustreptos , Rhabdias fuscovenosa (Railliet, 1899, Goodey, 1924), Rhabdias

horigutii (Yamaguti, 1943), Rhabdias kurilensis (Sharpilo, 1976), Rhabdias

lamothei (Martinez-Salazar, Leon-Regagnon, 2007) and Rhabdias martinoi (Kurochkin et

Gus'kov, 1963) are close related to R. filicaudalis n. sp. in the host preference. Rhabdias

eustreptos, R. fucovenosa, R. lamothei, R. kurilensis and R. martinoi differ from R.

filicaudalis n. sp. by the position of the vulva (equatorial vs pre-equatorial in R. filicaudalis n.

sp.). Rhabdias agkistrodontis differs from R. filicaudalis n. sp. by the size and distribution of

the lips, body width, slightly wider in R. agkistrodontis, oral capsule width (16–23 vs. 10.6–

14.2 in R. filicaudalis n. sp.) and realm (paleartic vs. neotropical to R. filicaudalis n. sp.).

17

The only other species that shares with R. filicaudalis n. sp. the presence of 6 lips and

pre-equatorial vulva is R. anolis. They differ from each other on the anterior end shape

(rounded vs. truncated in R. filicaudalis n. sp.), total body length (4.6–7.4 vs. 3.89 – 5.34 in R.

filicaudalis n. sp.) and host preference (lizards vs. snakes to R. filicaudalis n. sp.).

DISCUSSION

The genus Rhabdias has been studied all over the globe, but the South America has

only a few old publications with descriptions of species. The more recent papers are limited to

records of new hosts, reports on the occurrence of the already known species or pathologic

studies (Araujo et al., 1999, Boquimpani-Freitas et al., 2001, Silva et al., 2001; Luque et al.,

2005, Silva et al., 2007, Santos et al., 2008).

Rhabdias filicaudalis n. sp. was found in S. pullatus, a snake species with a wide

distribution, ranging from the south of South America to north of Central America, what can

indicating that this parasite may have a wide geographical distribution and possibly more

snake species as hosts.

Brazil has 6 large distinct biomes, hosting more than 750 species of amphibians and

630 species of reptiles (Brazilian Herpetological Society - SBH, 2008,

www.sbherpetologia.org.br), being almost all of them potential hosts to species from the

genus Rhabdias. Considering this fact, it is reasonable to suggest that there may be more

species of the genus Rhabdias to be discovered and described, as well as other helminths,

creating a huge field of study.

18

ACKNOWLEDGMENTS

We thank the Centro de Estudos de Venenos e Animais Peçonhentos (CEVAP –

UNESP) that allowed us to work with the animals under their care and the Fundação de

Amparo à Pesquisa do Estado de São Paulo (FAPESP) for the financial support (Process:

06/50968-8).

REFERENCES

Araújo, T., Moro, L., Lúcia, M., Golloubeff, B.. & Vasconcelos, A.C. (1999) Ocorrência

de alguns endo e ectoparasitos no serpentário da UNIFENAS – Universidade de Alfenas -

MG. Brazilian Journal of Veterinary Research and Animal Science 36, 19- 22.

Baer, J.G. (1930) Deux helminthes nouveaux, parasites de Uraeotyphlus oxyurus,

gymnophyone de l'Inde meridionale. Revue Suisse Zoologie 37, 43-52.

Boquimpani-Freitas, L., Vrcibradic, D., Vicente, J.J., Bursey, C.R., Rocha, C.F.D. & Van

Sluys, M. (2001) Helminths of the horned leaf frog, Proceratophrys appendiculata, from

southeastern Brazil. Journal of Helminthology 75, 233-236.

Bursey, C.R. & Goldberg, S.R. (2005) New species of Oswaldocruzia (Nematoda:

Molineoidae), new species of Rhabdias (Nematoda: Rhabdiasidae), and other helminths

in Rana cf. forreri (Anura: Ranidae) from Costa Rica. Journal of Parasitology 91, 600–

605.

Bursey, C.R., Goldberg, S.R. & Telford Jr, S.R. (2003) Rhabdias anolis n. sp. (Nematoda:

Rhabdiasidae) from the lizard, Anolis frenatus (Sauria: Polychrotidae), from Panama. Journal

of Parasitology 89, 113–117.

Kuzmin, Y. (2003) Rhabdias japalurae sp. nov. (Nematoda, Rhabdiasidae) from the

japalures (Reptilia, Agamidae) and some notes on other Rhabdias spp. from lizards. Acta

Parasitologica 48, 6-11.

19

Kuzmin,Y., Tkach, V.V. & Vaughan, J.A. (2005) Rhabdias kongmongthaensis sp. n.

(Nematoda: Rhabdiasidae) from Polypedates leucomystax (Amphibia: Anura: Rhacophoridae)

in Thailand. Folia Parasitologica 52, 339–342.

Lhermitte-Vallarino, N. & Bain, O. (2004) Morphological and biological study of Rhabdias

spp. (Nematoda) from African chameleons with description of a new species. Parasite 11, 15-

31.

Luque, J.L., Martins, A.N. & Tavares, L.E.R. (2005) Community structure of metazoan

parasites of the yellow Cururu toad, Bufo ictericus (Anura, Bufonidae) from Rio de Janeiro,

Brazil. Acta Parasitologica 50, 215–220.

Martínez-Salazar, E.A. (2006) A new rhabdiasid species from Norops megapholidotus

(Sauria: Polychrotidae) from Mexico. Journal of Parasitology 92, 1325–1329.

Martinez-Salazar, E.A. & León-Règagnon, V. (2006) Rhabdias lamothei n. sp. (Nematoda:

Rhabdiasidae) from Leptodeira maculata (Colubridae) in Mexico, including new records of R.

fuscovenosa (Railliet, 1899) Goodey, 1924. Zootaxa 1257, 27–48.

Pereira, C. (1928) Fauna helminthologica dos ophideos Brasileiros. Boletim Biologico de São

Paulo 11, 13-22.

Santos, K.R., Takahira, R.K., Rall, V.L.M., Calderón, C., Sequeira, J.L & Silva, R.J.

(2008) Pulmonary, microbiological and hematological changes in Crotalus durissus terrificus

(Serpentes, Viperidae) parasitized by nematodes of the genus Rhabdias (Nematoda,

Rhabdiasidae). Arquivo Brasileiro de Medicina Veterinária e Zootecnia 60, 667-674.

Silva, R.J., Nogueira, M.F., Barrella, T.H. & Takahira, R. K. (2007) Frequency of

rhabdiasid nematodes in wild Crotalus durissus terrificus (serpentes, viperidae) from

Botucatu region, São Paulo state, Brazil. Journal of Venomous Animals and Toxins Including

Tropical Diseases 13, 122-129.

20

Sarkar, M. & Manna, B. (2004) On a new species of the genus Rhabdias Stiles and

Hassall, 1905 (Nematoda: Rhabditida) from Bufo melanostictus Schneider, 1799 from

Belur and Habra,West Bengal, India, with a Host-Parasite List. Philippine Journal of

Science 133, 53 – 64

Silva, R.J., Barella, T.H., Nogueira, M.F. & O’Dwyer, L.H. (2001) Frequency of helminths

in Crotalus durissus terrificus (Serpentes, Viperidae) in captivity. Revista Brasileira de

Parasitologia Veterinária 10, 91-93


rhabdiasid nematodes in wild Crotalus durissus terrificus (Serpentes, Viperidae) from



Tkach, V.V., Kuzmin,Y. & Pulis, E. E. (2006) A new species of Rhabdias from lungs of

the wood frog, Rana sylvatica, in North America: the last sibling of Rhabdias ranae?

Journal of Parasitology 92, 631–636.

Vicente, J.J., Rodrigues, H.O., Gomes, D.C. & Pinto, R.M.(1993) Nematódeos do Brasil.

Parte III - Nematódeos de répteis.. Revista Brasileira de Zoologia 10, 1-183.

Yuen, P.H. (1965) Some studies on the taxonomy and development of some rhabdiasoid and

cosmocercoid nematodes from Malayan amphibians. Zoologischer Anzeiger 174, 275-298

21

Figure 1. Rhabdias filicaudalis n. sp. (Nematoda; Rhabdiasidae) from Spilotes pullatus(Serpentes; Colubridae): A – anterior end, B – vulva region with embryonated eggs, C –posterior region (A,B,C – scale bar 30µm).

22

Figure 2. Rhabdias filicaudalis n. sp. (Nematoda; Rhabdiasidae) from Spilotes pullatus

(Serpentes; Colubridae): peribuccal papillae (scanning electron microscopy, scale bar 20µm).

23

Figure 3. Rhabdias filicaudalis n. sp. (Nematoda; Rhabdiasidae) from Spilotes pullatus

(Serpentes; Colubridae): posterior end (scanning electron microscopy, scale bar 50µm).

24

Artigo2: Morphological analysis of Rhabdias sp. (Nematode, Rhabdiasidae) parasites of

snakes (Reptilia, Serpentes) from the Botucatu region, São Paulo State, Brazil.

(Artigo redigido segundo as normas da revista Journal of Helmintology)

25

Morphological analysis of Rhabdias filicaudalis (Nematode, Rhabdiasidae) parasites of

snakes (Reptilia, Serpentes) from the Botucatu region, São Paulo State, Brazil.

T.H. Barrella1, K.R. dos Santos2, R.J. da Silva3

1General and Applied Biology Postgraduate Course, Instituto de Biociências, Universidade

Estadual Paulista, Botucatu, São Paulo State, Brazil 2Departament of Veterinary Medicine, Universidade Federal do Piauí, Bom Jesus, Piauí State,

Brazil.3Department of Parasitology, Instituto de Biociências, Universidade Estadual Paulista,


ABSTRACT

Rhabdias filicaudalis was identified in Boa constrictor amarali, Bothrops jararaca, Bothrops

neuwiedii, Crotalus durissus terrificus and Oxyrhopus guibei, being this the first ocurence of

this parasite in these hosts. The morphological analysis has increased the data for R.

filicaudalis, contributing for a more detailed description and characterization of this species,

setting new morphometric parameters. Presence of this parasite in hosts from different groups

and habitats suggests that it has a wide distribution and flexibility to survive in different

enviromental conditions.

26

INTRODUCTION

Nematodes of the genus Rhabdias (Stilles and Hassall, 1905) are cosmopolitan and 57

species are included in this genus, 37 parasites of amphibians (Anura, Apoda and Caudata)

and 20 of reptiles (Sauria, Chamaleones and Serpentes)(Baer, 1930; Barrella et al., 2009;

Bursey et al., 2003; Bursey & Goldberg, 2005; Kuzmin, 2003; Kuzmin et al., 2005;

Lhermitte-Vallarino & Bain, 2004; Martínez-Salazar, 2006; Martínez-Salazar & León-

Règagnon, 2006; Sarkar & Manna, 2004; Tkach et al., 2006; Yuen, 1965). Eleven species

have been recorded parasitizing snakes, but only two, Rhabdias filicaudalis Barrela, Santos &

Silva, 2009 (Barrella et al., 2009) and Rhabdias vellardi Pereira, 1928 (Pereira, 1928) were

previously reported in Brazil.

Except by the original description for both species, only reports of occurrence,

frequency of infection, reports of new hosts and pathological effects of the parasites were

published (Araujo et al., 1999, Pereira, 1928, Santos et al., 2008, Silva et al., 2001, Silva

et.al., 2007, Vicente et al., 1993), without any new information on morphological aspects.

The aim of the present study is to contribute to the morphological knowledge of the

genus Rhabdias parasites of snakes from Brazil.


During the years of 2005 and 2006, 125 snakes received by the Centro de Estudos de

Venenos e Animais Peçonhentos (CEVAP) at the Universidade Estadual Paulista (UNESP) in

Botucatu, São Paulo State, Brazil had their feces collected, using fisiological solution, at 1%

in volume of the total weight (Mader, 1996), injected with a probe and recovered after a

gentle massage at the final portion of the intestine. Coproparasitological analyzes were made

using Hoffman (sedimentation) and Willis-Molley (flotation) thecniques.

Animals with positive results for eggs and/or larvae compatible with those described

to the genus Rhabdias that died during captivity were submitted to necropsy, to search for

parthenogenetic females in lungs.

Parthenogenetic females obtained during necropsy were fixed in AFA (Alcohol-

Formalin- Acetic acid) and transferred to ethanol 70% for conservation. Some specimens

from each sample were clarified with lactophenol and analyzed in a computerized system for

image analysis (Qwin Lite 3.1, Leica Microsystems, Wetzlar, Germany

27

RESULTS

From 125 animals received during the time of the study, 26 (20.8%) were positive to

eggs and/or larvae of Rhabdias sp. at the coproparasitological survey. They belong to the

following species: Spilotes pullatus (Linnaues, 1758)(Colubridae), Taeniophallus occipitalis

(Jan, 1863), Oxyrhopus guibei (Hoge – Romano, 1978), Philodryas patagoniensis (Girardi,

1858), Sibynomorphus mikanii (Scleglel, 1837), Xenodon merremii (Wagler, 1824)autor, ano

(Dipsadidae), Bothrops jararaca (Wied, 1824), Bothrops neuwiedii (Wagler, 1824), Crotalus

durissus terrificus (Laurenti, 1768)(Viperidae), and Boa constrictor amarali

(Linnaeus,1758)(Boidae).

During captivity, 5 of the 26 animals with positive results at the coproparasitological

exam died and were submitted to necropsy, and we were able to recover parthenogenetic

females from their lungs. Infected animals belonged to the species: B. constrictor amarali, B.

neuwiedii, B. jararaca, C. durissus terificus and O. guibei. The numbers of parasites

recovered were, 15 in B. jararaca, 94 in B. neuwiedii, 234 in B. constrictor amarali, 47 in C.

durissus terrificus and 296 in O. guibei, with females in different stages of maturity in all

samples.

Morphology and morphometric analysis (Table 1) of the specimens were consistent

with R. filicaudalis. With these results we can set new morphometrical parameters for species

characteization.

DISCUSSION

Prevalence of infection by R. filicaudalis was 20.8%, what suggests that this parasite

has a wide distribution and is present in many types of habitats, and the fact that snakes from

different families were infected shows that this parasites have no specific preference for a

type of host. Prevalence of 44% of infection by Rhabdias sp. in Crotalus durissus terrificus

naturally infected, was reported by Silva et al. (2007), showing that parasites of this genus

have a natural high prevalence among snakes.

We were able to identify the parasite species of only 5 snakes, all infected by R.

filicaudalis, being this the first report of this species in B. constrictor amarali, B. neuwiedii,

B. jararaca, C. durissus terificus and O. guibei. It’s interesting to note that none of the

animals examined presented any other species of the genus Rhabdias, considering that

previous works in the same area had registered the infection by Rhabdias labiata (Pereira,

28

1927), and other papers in Brazil had reported only R. vellardi (Araujo et al. 1999; Grego et

al., 2004; Santos et al. 2008; Silva et al., 2001; Silva et al., 2007), leading us to believe that

either, they were misidentified due to the lack of information on species of the genus

Rhabdias in Brazil or our sample number was too small and did not represents the real

diversity of this parasites in the studied region. Re-evalution of already identified species

would be helpful to correct possible misidentifications and to provide more data for a better

description of R. vellardi.

The morphological analysis has increased the data for R. filicaudalis, contributing for

a more detailed description and characterization of this species. The presence of R.

filicaudalis in hosts of different groups, Colubridae, Dipsadidae, Boidae and Viperidae, shows

that it has no preference for a specific group of snakes, and, having these hosts different habits

and habitats, it’s reasonable to consider that this parasite may have a wide distribution with

flexibility to survive in different environmental conditions, suggesting that more new hosts

may be reported on a near future.

REFERENCES

Araújo, T., Moro, L., Lúcia, M., Golloubeff, B.. & Vasconcelos, A.C. (1999) Ocorrência

de alguns endo e ectoparasitos no serpentário da UNIFENAS – Universidade de Alfenas -

MG. Brazilian Journal of Veterinary Research and Animal Science 36, 19- 22.

Baer, J.G. (1930) Deux helminthes nouveaux, parasites de Uraeotyphlus oxyurus,

gymnophyone de l'Inde meridionale. Revue Suisse Zoologie 37, 43-52.

Baker, M.R. (1983) Nematode parasitism in amphibians and reptiles. Canadian Journal of

Zoology 6, 747-757.

Barrella, T. H., Santos, K. R., Silva, R. J. (2009) Rhabdias filicaudalis n. sp. (Nematoda,

Rhabdiasidae) from the snake Spilotes pullatus (Linaeus, 1758) (Serpentes Colubridae).

Journal of Helmitology, submitted to publication.

Bursey, C.R. & Goldberg, S.R. (2005) New species of Oswaldocruzia (Nematoda:

Molineoidae), new species of Rhabdias (Nematoda: Rhabdiasidae), and other helminths in

Rana cf. forreri (Anura: Ranidae) from Costa Rica. Journal of Parasitology 91, 600–605.

29

Bursey, C.R., Goldberg, S.R. & Telford Jr, S.R. (2003) Rhabdias anolis n. sp. (Nematoda:

Rhabdiasidae) from the lizard, Anolis frenatus (Sauria: Polychrotidae), from Panama. Journal

of Parasitology 89, 113–117.

Kuzmin, Y. (2003) Rhabdias japalurae sp. nov. (Nematoda, Rhabdiasidae) from the

japalures (Reptilia, Agamidae) and some notes on other Rhabdias spp. from lizards. Acta

Parasitologica 48, 6-11.

Kuzmin,Y., Tkach, V.V. & Vaughan, J.A. (2005) Rhabdias kongmongthaensis sp. n.


in Thailand. Folia Parasitologica 52, 339–342.

Lhermitte-Vallarino, N. & Bain, O. (2004) Morphological and biological study of Rhabdias

spp. (Nematoda) from African chameleons with description of a new species. Parasite 11, 15-

31.

Mader, M. R. (1996) Reptile medicine and surgery. Philadelphia, W. B. Saunders Co.

Martínez-Salazar, E.A. (2006) A new rhabdiasid species from Norops megapholidotus

(Sauria: Polychrotidae) from Mexico. Journal of Parasitology 92, 1325–1329.

Martinez-Salazar, E.A. & León-Règagnon, V. (2006) Rhabdias lamothei n. sp. (Nematoda:

Rhabdiasidae) from Leptodeira maculata (Colubridae) in Mexico, including new records of R.

fuscovenosa (Railliet, 1899) Goodey, 1924. Zootaxa 1257, 27–48.

Pereira, C. (1928) Fauna helminthologica dos ophideos Brasileiros. Boletim Biologico de São

Paulo 11, 13-22.

Santos, K.R., Takahira, R.K., Rall, V.L.M., Calderón, C., Sequeira, J.L & Silva, R.J.

(2008) Pulmonary, microbiological and hematological changes in Crotalus durissus terrificus

(Serpentes, Viperidae) parasitized by nematodes of the genus Rhabdias (Nematoda,

Rhabdiasidae). Arquivo Brasileiro de Medicina Veterinária e Zootecnia 60, 667-674.

Sarkar, M. & Manna, B. (2004) On a new species of the genus Rhabdias Stiles and Hassall,

1905 (Nematoda: Rhabditida) from Bufo melanostictus Schneider, 1799 from Belur and

30

Habra,West Bengal, India, with a Host-Parasite List. Philippine Journal of Science 133, 53 –

64

Silva, R.J., Barella, T.H., Nogueira, M.F. & O’Dwyer, L.H. (2001) Frequency of helminths

in Crotalus durissus terrificus (Serpentes, Viperidae) in captivity. Revista Brasileira de

Parasitologia Veterinária 10, 91-93


rhabdiasid nematodes in wild Crotalus durissus terrificus (serpentes, viperidae) from



Tkach, V.V., Kuzmin,Y. & Pulis, E. E. (2006) A new species of Rhabdias from lungs of

the wood frog, Rana sylvatica, in North America: the last sibling of Rhabdias ranae?

Journal of Parasitology 92, 631–636.

Vicente, J.J., Rodrigues, H.O., Gomes, D.C. & Pinto, R.M.(1993) Nematódeos do Brasil.

Nematódeos de répteis. Parte III. Revista Brasileira de Zoologia 10, 1-183.

Yuen, P.H. (1965) Some studies on the taxonomy and development of some rhabdiasoid and

cosmocercoid nematodes from Malayan amphibians. Zoologischer Anzeiger 174, 275-298

31

Table 1. Morphometric analysis of Rhabdias filicaudalis from new hosts and type host, and combination of all valus stabilishing new parameters for the species.

Measures presented as: average ± standard derivation (minimum – maximum), measures in µm and proportions in %.

VariablesHost snakes

New morphometric parameters

Oxyrhopus guibei Bothrops jararaca Bothrops neuwiediiCrotalus durissus terrificus

Boa constrictor amarali

Spilotes pullatus(original description)

Rhabdias filicaudalis

Total Body length3476.2 ± 1017.4

(2553.0 – 5199.0)4379.5±876.7

(3298.5 – 5166.9)4910.7 ± 723.6

(4278.0 – 6288.0)5685.8 ± 472.7

(4917.0 – 6316.0)6637.3 ± 289.4

(6316.0 – 6989.0)4740.0 ± 550.0

(3890.0 – 5340.0)5145.1 ± 1197.9

(2553.0 – 6989.0)

Body width144.6 ± 43.7

(104.4 – 218.4)348.4±40.5

(316.0 – 400.0)252.2 ± 32.4

(202.3 – 291.8)284.2 ± 17.6

(265.4 – 314.9)259.1 ± 9.3

(250.8 – 271.7)170.8 ± 25.4

(129.7 – 197.0)194.2 ± 57.1

(104.4 – 271.7)Buccal capsule width

14.3 ± 2.9(11.0 – 19.0)

12.9±1.3(11.5 – 14.6)

14.8 ± 2.0(12.5 – 17.3)

16.6 ± 2.3(13.8 – 19.5)

16.2 ± 2.4(12.1 – 18.8)

12.6 ± 1.1(10.6 – 14.2)

14.9 ± 2.6(10.6 – 19.0)

Buccal capsule depth

12.3 ± 1.5(10.5 – 13.9)

10.5±1.6(8.2 – 11.6)

11.9 ± 1.4(10.3 – 13.6)

13.2 ± 1.8(11.2 – 15.9)

15.7 ± 1.9(12.1 – 17.4)

9.7 ± 1.1(8.3 – 11.2)

13.7 ± 3.0(8.3 – 17.4)

Esophagus length294.9 ± 10.3

(284.7 – 312.3)268.4±16.8

(247.8 – 288.2)300.1 ± 8.0

(290.8 – 312.5)286.9 ± 19.8

(267.4 – 319.3)307.1 ± 11.9

(295.2 – 326.3)287.4 ± 10.3

(271.7 – 301.0)300.6 ± 13.3

(271.7 – 326.3)Esophagus width -beginning

34.8 ± 7.9(28.1 – 48.4)

43.9±6.3(36.1 – 51.2)

36.0 ± 3.9(30.9 – 41.9)

40.4 ± 2.3(36.8 – 43.2)

43.9 ± 1.2(42.2 – 45.7)

32.9 ±2.6(28.6 – 35.9)

39.5 ± 6.6(28.1 – 48.4)

Esophagus width-middle

35.8 ± 10.1(29.6 – 53.6)

41.1±6.5(31.8 – 45.7)

41.1 ± 2.9(36.4 – 45.4)

47.1 ± 1.9(44.5 – 49.1)

46.5 ± 2.3(43.2 – 49.4)

38.3 ± 2.2(35.4 – 40.3)

40.8 ± 7.8(29.6 – 53.6)

Esophagus width –end

50.4 ± 8.8(41.3 – 64.6)

53.1±4.6(46.8 – 56.9)

62.5 ± 3.9(56.6 – 68.3)

63.2 ± 4.5(58.1 – 69.0)

59.6 ± 5.7(50.1 – 67.9)

51.4 ± 2.8(47.8 – 54.9)

54.9 ± 7.1(41.3 – 67.9)

Nerve ring to anterior end distance

158.6 ± 16.4(133.9 – 179.4)

135.5±17.9(110.6 – 150.5)

155.1 ± 7.0(143.8 – 161.9)

144.8 ± 4.4(140.5 – 150.6)

147.7 ± 2.3(145.3 – 151.7)

131.5 ± 24.9(105.6 – 173.4)

151.1 ± 19.8(105.6 – 179.4)

Vulva to anterior end distance

1783.5 ± 414.4(1500.8 – 2494.8)

2107.3±491.9(1412.4 – 2479.2)

2331.1 ± 329.6(2058.0 – 2914.0)

2527.5 ± 249.6(2193.3 – 2818.9)

2980.0 ± 276.0(2687.0 – 3414.0)

2110.9 ± 318.9(1639.0 – 2534.9)

2319.1 ± 597.4(1500.8 – 3414.0)

Tail165.3 ± 26.3

(141.4 – 205.3)229.5±62.0

(165.5 – 314.4)172.6 ± 24.7

(149.6 – 206.5)172.6 ± 24.7

(149.6 – 206.5)182.3 ± 22.2

(157.2 – 221.3)176.1 ± 22.6

(145.2 – 197.4)172.1 ± 23.1

(141.4 – 221.3)Esophagus to total body length proportion

8.9 ± 1.9(6.0 – 11.4)

6.3±1.4(5.3 – 8.3)

6.1 ± 0.7(5.0 – 7.0)

5.0 ± 0.4(4.6 – 5.4)

4.6 ± 0.3(4.2 – 5.1)

6.1 ± 0.8(5.1 – 7.5)

6.7 ± 2.1(4.2 – 11.4)

Nerve ring position to total esophagus length proportion

53.8 ± 4.8(45.8 – 57.7)

51.5±5.0(44.6 – 55.2)

51.7 ± 2.7(48.9 – 55.7)

51.6 ± 3.3(47.1 – 56.3)

48.2 ± 1.9(45.4 – 50.5)

45.6 ± 7.8(36.9 – 59.1)

50.4 ± 6.1(36.9 – 59.1)

Tail length to total body length proportion

4.9 ± 0.7(3.9 – 5.6)

5.1±0.9(4.3 – 6.1)

4.2 ± 0.5(3.2 – 4.6)

3.0 ± 0.3(2.7 – 3.5)

2.75 ± 0.4(2.4 – 3.5)

3.7 ± 0.4(3.1 – 4.2)

3.7 ± 1.0(2.4 – 5.6)

Vulva to anterior end distance to total body length proportion

51.8 ± 4.3(47.8 – 59.0)

47.9±3.9(42.8 – 52.1)

47.6 ± 4.3(43.9 – 55.9)

44.5 ± 2,9(40.2 – 48.2)

45.3 ± 3.1(41.6 – 49.1)

44.5 ± 2.7(40.6 – 47.5)

46.6 ± 4.3(40.2 – 59.1)

32

Artigo 3: On the life cycle of Rhabdias filicaudalis (Nematoda, Rhabdiasidae).

(Artigo redigido segundo as normas da revista Journal of Helmintology)

33

On the life cycle of Rhabdias filicaudalis (Nematoda, Rhabdiasidae).

T.H. Barrella1*, K.R. dos Santos2, R.J. da Silva3


Biociências, Universidade Estadual Paulista, Botucatu, São Paulo State, Brazil 2Departament of Veterinary Medicine, Universidade Federal do Piauí, Bom Jesus, Piauí State,

Brazil.3Department of Parasitology, Instituto de Biociências, Universidade Estadual Paulista,


ABSTRACT

The present study describes the free living stages of Rhabdias filicaudalis. All stages

from the cycle were detected and described, and due to the fact that the infective stage (L3)

has emerged before the free living adults, it suggests that this species, as other species from

the same genus parasites of snakes, has homogonic and heterogonic life cycle.

Key words: Rhabdias filicaudalis, Nematoda, Rhabdiasidae, life cycle, snake, Oxyrhopus

guibei

34

INTRODUCTION

Rhabdias filicaudalis (Barrella, Santos & Silva, 2009) was first described in Spilotes

pullatus (Linnaeus, 1758)(Serpentes, Colubridae) and then in Boa constrictor amarali

(Linnaeus, 1758)(Serpentes, Boidae), Bothrops jararaca (Wied, 1824)(Serpentes, Viperidae),

Bothrops neuwiedii (Wagler, 1824)(Serpentes, Viperidae), Crotalus durissus terrificus

Laurenti, 1768 (Serpentes, Viperidae) and Oxyrhopus guibei (Hoge - Romano,

1978)(Serpentes, Dipsadidae)(, with reference only to the parasitic stage of the life cycle,

found in the lungs of the hosts (Barrella et al., 2009a, Barrella et al., 2009b).

Life cycle of parasites from the genus Rhabdias (Stilles & Hassal, 1905) is usually

heterogonic, but it was reported that Rhabdias fuscovenosa (Railliet, 1899), Rhabdias elaphe

(Sharpilo, 1976) and Rhabdias agkistrodonis (Sharpilo, 1976), all snake parasites, present

homogonic and heterogonic development (Kuzmin, 1999; Kuzmin and Miskov, 1999;

Kuzmin, 2000).

The aim of the present study is to describe the morphology of free living stages from

the life cycle of Rhabdias filicaudalis.


A male specimen of O. guibei, captured in January, 16th 2007 at the municipality of

Botucatu, São Paulo State, Brazil was donated to the Centro de Estudos de Venenos e

Animais Peçonhentos at Universidade Estadual Paulista. The animal had feces collected to a

coproparasitological exam, and, after the confirmation of a positive result to eggs of Rhabdias

sp., pictures were taken and coproculture was performed. On a Petri dish, using filter paper as

substrate, a small amount of feces was placed on top and covered with a thin layer of water.

Culture was kept at room temperature (24-28o C) and checked daily, for 7 days, under a

stereomicroscope for the presence of larvae and free living adults. As the different free living

stage forms were found, they were collected, photographed on microscope, drew, with the

help of a drawing tube, and placed on a container with ethanol 70%. Images were analyzed

with computerized system for image analysis (Qwin Lite 3.1, Leica Microsystems, Wetzlar,

Germany), with measures presented in µm as average ± standard deviation.

35

RESULTS

After feces were collected and coproculture made, the animal died. The animal was

sent to necropsy and parasites found and collected in the lung were identified as R.

filicaudalis.

Eggs have an oval shape with a thin double wall, with larvae inside, but some eggs

were found on immature stage. Measures were (n = 24) 40.8 ± 2.7 of width and 68.9 ± 8.8 of

length (Figure 1A).

First larval stages (L1 and L2) were observed from day 1 to day 7. They presented a

rhabditoid form and the only visible difference between the two stages was the total body

length. Measures for L1 were (n = 10): total body length 374.4 ± 42.3, body width 21.7 ± 2.5,

Esophagus length 113.0 ± 7.9, tail 48.2 ± 12.4. Measures for L2 were (n = 10): total body

length 426.0 ± 48.8, body width 21.5 ± 1.7, Esophagus length 115.7 ± 8.9, tail 48.0 ± 7.0

(Figure 1B).

Filarioid larvae (L3), the infective stage, was found from day 4 to day 7. Measures

were (n = 10): total body length 502.1 ± 174.5, body width 21.3 ± 5.4, Esophagus length

134.5 ± 48.5, tail 50.9 ± 17.6 (Figure 1C).

Free living adults appeared on day 5, with more females than males. Females (Figure

1D) showed no more than 6 eggs in the uterus. Males (Figure 1E) were smaller than females

and presented small spicules and absence of gubernacle. Measures for free living females

(n=5): total body length 1113.2 ± 122.9, body width 53.3 ± 16.9, esophagus length 198.5±

13.6, tail 65.9, distance from vulva to anterior end 536.5 ± 1.6. Measures for free living males

(n=5): total body length 585.4 ± 158.6, body width 25.9 ± 7.1, Esophagus length 122.7± 24.0,

tail 57.4,spicules 38.1 ± 9.0.

DISCUSSION

Identification of the free living stages is important to the knowledge of the life cycle

dynamics, especially to the infection process, and for a better characterization of the species

(Chu, 1936; Kuzmin, 1999; Kuzmin and Miskov, 1999; Kuzmin, 2000).

36

Life cycles from species that parasitizes amphibians are mainly heterogonic (e. g.

Rhabdias bufonis (Schrank, 1788), Rhabdias americanus (Baker, 1987), Rhabdias

brachylaimus autor, ano and Rhabdias multiproles (Yuen, 1965), an exception is Rhabdias

ranae (Walton, 1929) that have presented, experimentally, a homogonic development.

Species that parasitizes reptiles, that have been studied so far, presented homogonic or

heterogonic or both types of development on the same life-cycle, being the last one, the case

of R. fuscovenosa, R. elaphe and R. agkistrodontis, all parasites of snakes (Anderson, 2000;

Kuzmin, 1999; Kuzmin & Miskov, 1999).

The presence of infective larvae before the development of free-living adults in the

coproculture suggests that, as other species that parasitizes snakes, R. filicaudalis has

homogonic and heterogonic development, but further studies with experimental infections are

needed to characterize and distinguish larval stages from homogonic and heterogonic origin

and to determin their infective capacity.

REFERENCES

Anderson, R. C. (2000) Nematodes of vertebrates: their development and transmission.

USA, Oxford University Press.

Barrella, T.H., Santos, K. R., Silva, R. J. (2009a) Rhabdias filicaudalis n. sp. (Nematoda,

Rhabdiasidae) from the snake Spilotes Pullatus (Linnaeus, 1758) (Serpentes, Colubridae),

Journal of Helmintology (article submitted).

Barrella, T.H., Santos, K. R., Silva, R. J. (2009b) Morphological analysis of Rhabdias sp.

(Nematode, Rhabdiasidae) parasites of snakes (Reptilia, Serpentes) from the Botucatu region,

São Paulo state, Brasil. (unpublished data)

Chu, T. (1936)Studies on the life history of Rhabdias fuscovenosa var. catanensis

(Rizzo,1902). Journal of. Parasitology, 22(2): 140-160.

Kuzmin, Y.I. (1999) Rhabdias agkistrodonis (Nematoda: Rhabdiasidae): morphology,

distribution and specificity. Folia Parasitologica, 46(1): 59-66.

37

Kuzmin, Y.I. (2000) Morphology of parasitic and free-living adults of Rhabdias rubrovenosa

(Nematoda: Rhabdiasidae). Vestnik zoologii, 34 (1-2): 109-114.

Kuzmin, Y., Miskov, R. (1999) On the life cycle of Rhabdias elaphe Sharpilo, 1976

(Nematoda: Rhabdiasidae). Acta Parasitologica, 44 (2): 119-124.

38

Fig. 1: Rhabdias filicaudalis life cycle: A – Egg, B – Rhabditoid larvae (L1), C - Filarioid larvae (L3), D – Free living female, E – Free living male, (Scale bars: A = 30 µm, B = 100 µm, C = 50 µm, D = 100 µm, E = 100 µm ).

39

Artigo 4: Molecular data of Rhabdias filicaudalis (Nematoda, Rhabdiasidae) from

brazilian snakes.

(Artigo redigido segundo as normas da revista Molecular and Biochemical Parasitology)

40

Molecular data of Rhabdias filicaudalis (Nematoda, Rhabdiasidae) from brazilian

snakes.

Thomaz Henrique Barrella1*, Karina Rodrigues dos Santos2, Reinaldo José da Silva3


Biociências, Universidade Estadual Paulista, Botucatu, São Paulo State, Brazil

2Departament of Veterinary Medicine, Universidade Federal do Piauí, Bom Jesus, Piauí State,

Brazil.

3Department of Parasitology, Instituto de Biociências, Universidade Estadual Paulista,


*corresponding author: address: Rua Dr. Henrique aRouche de Toledo, 2-35, Jd. América

Bauru – SP – Brazil, CEP 17017-320, phone: 55 14 32230463, e-mail: [email protected].

Key words: Rhabdias, snakes, molecular analysis, Brazil.

ABSTRACT

Specimens of Rhabdias filicaudalis found in different hosts, Boa constrictor amarali,

Oxyrhopus guibei, Crotalus durissus terrificus, Bothrops neuwiedii, had the SSUrDNA gene

sequenced. On the electrophoresis gel performed after PCR amplification, the sample from O.

guibei presented a band of 420 bp, differing from all other samples which presented a band of

350 bp. Gene sequences obtained were too small and very variable, making the analysis

inconclusive. This result shows that this gene cannot be used as parameter for characterization

of species of this genus.

41

SHORT COMMUNICATION

Researches on molecular analysis of parasites from the genus Rhabdias has just

started, the first segment sequenced belongs to the 18S rRNA from Rhabdias bufonis

(GenBank: AJ417022, Dorris et al., 2002). Other 7 species, Rhabdias ranae, Rhabdias bakeri,

Rhabdias pseudosphaerocephala, Rhabdias sphaerocephala, Rhabdias sp., Rhabdias cf. hylae

and Rhabdias okunensis, had different fragments analyzed with a total of 86 sequences posted

on GenBank (accessed at April, 20th 2009). Even with all this data, there is no standard

sequence that can be used to characterize different species of this genus, being the

morphological analysis the only reliable tool for identification.

The aim of the present study is to present the sequence of the SSUrDNA gene from

Rhabdias filicaudalis, parasite of snakes from the municipality of Botucatu region, São Paulo

State, Brazil.

During the period from 2004 to 2006, snakes received by the Centro de Estudos de

Venenos e Animais Peçonhentos (CEVAP) of the Universidade Estadual Paulista (UNESP)

were examined for the presence of parasites from the genus Rhabdias. Infected animals which

died during captivity were submitted to necropsy and adult parasites collected and fixed in

ethanol 70%. Specimens from 5 different snakes, i.e. 2 Boa constrictor amarali (Boidae), 1

Oxyrhopus guibei (Colubridae), 1 Bothrops neuwiedii and 1 Crotalus durissus terrificus

(Viperidae) were used for the molecular analysis.

DNA Extraction was performed with Quiamp® DNA extraction kit (Quiagen,GmbH,

Hilden, Germany), using 8 helminthe specimens from each sample. For the PCR it was used

the primers SSUA (Forward 5’- AAA GAT TAA GCC ATG CAT G -3’) and SSU22R

(Reverse 5’- GCC TGCTGCCTT CCT TGG A -3’), according to Dorris et al. (2002).

42

Amplification was performed on a reaction with 10 μl, 10 mM Tris-HCl 1.5 mM MgCl2, 50

mM KCl, pH 8.3, 100 mM of each dNTP, 100 ng of DNA sample and 0.5 units of Taq

polimerase (GE Healthcare, Bucks, U.K.). PCR reaction had 35 cycles, preceeded by 5

minutes at 95ºC. Each cycle had the following steps: 30 seconds at 95ºC, 30 seconds at

58.1ºC, and 30 seconds at 72ºC. After amplification, the samples were purified and an

electrophoresis was performed in 2% agarose gel, impregnated with Ethidium bromide. The

resulting gel (Figure 1) showed a band of 420bp at spot number 2 (from the O. guibei) and

bands of 350bp for the other 4 samples.

Sequencing reaction was performed by a specialized unit at the university that gave

the following sequences that will be deposited at the GenBank:

Host – Rhabdias sp. – Sequence

Boa constrictor amarali (1) – Rhabdias filicaudalis

atgcatgtatccgtacggccaaattatggttaaactgcgaacggctcattataacagtcaaaatcagcatgaagtgttcctagatggatact

tgcagtaattctggagctaatacacgtgtaactttcgagttcattttttagattcactaaccgggaaaccgtaaagtgatgactctgattacct

tgcagaccgcatgcttttgcagcggcgattcattctgattgactgtcctatcaacttgctagtagagtagtggtctactagggtgattacgg

gtaacggaggattagggtttgactccggagaagatgccttagagacggcagctacatccaaggaggggcagcaggc

Boa constrictor amarali (2) – Rhabdias filicaudalis

cctcatgtatccgtacggccaaattatggttaaactgcgaacggctcattataacagtcaaaatcagcatgaagtgttcctagatggatact

tgcagtaattctggagctaatacacgtgtaactttcgagttcattttttagattcactaaccgggaaaccgtaaagtgatgactctgattacct

tgcagaccgcatgcttttgcagcggcgattcattctgattgactgtcctatcaacttgctagtagagtagtggtctactagggtgattacgg

gtaacggaggattagggtttgactccggagaagatgccttagagacggcagctacatccaaggaagggcagcaggc

Bothrops neuwiedii – Rhabdias filicaudalis

43

cagcatgtatccgtacggccaaattatggttaaactgacggctcattataacagtcaaaatcagcatgaagtgttcctagatggatacttgc

agtaattctggagctaatacacgtgtaactttcgagttcattttttagattcactaaccgggaaaccgtaaagtgatgactctgattaccttgc

agaccgcatgcttttgcagcggcgattcattctgattgactgtcctatcaacttgctagtagagtagtggtctactagggtgattacgggta

acggaggattagggtttgactccggagaagatgccttagagacggcagctacatccaaggaagggccagcaggc

Crotalus durissus terrificus – Rhabdias filicaudalis

atgcatgtatccgtncggccaaattatggttacatgcggaccggctcattataacagtcaaaatcagcatgaagtgttccgtagatggata

cttgcagtaattctggagctaatacacgtgtaactttcgagttcattttttagattcactaagccgggaaacggaaagtgcatgactctgatt

accttgcagaccgcatgcttttgcagcggcgattcattctgattgactgtcctatcaacttgctagtagagtagtggtctactagggtgatta

cgggtaacggaggattagggttaatccggagaagatgccttagagaccgctgctacatncaangaaggcagcaggc

Oxyrhopus guibei – Rhabdias filicaudalis

ttaaaagattaaagccatgcatgtctcagtgcacgcctttatacggtgaaaccgcgaatggctcattaaatcagctatggtttattggatcgt

acccgttaaatggataactgtaataactctagagctaatacatgcctcgaagccctgacccttatgcggccgttatgcggtcgtgcaagg

gaatgggtgcacttattagatcagaagccaaccatgtagcacagtcccgctcgtcgagcctgtcgccgcatgttgtcgttctggtgactct

ggataattgttacagatcgcagtcggccttgagtcggcgacgggtccttcaaatgtctgccctatcaactttcgatggtaggtgacctgcc

taccatggtgataacgggtaacggggaatcagggttcgattccggagagggagcctgagaaacggctaccacttccaaggagggca

gcaggca

Unfortunetly, DNA fragments obtained were too small and had much variation

between samples, making impossible to use it to characterize a species. The difference on the

fragment size between all samples and the sample from O. guibei needs further studies, once

that the morphological analysis gave all samples as the same species, Rhabdias filicaudalis.

44

Other sequences must be analyzed in order to find a fragment that can be used to compare and

characterize species from the genus Rhabdias.

REFERENCES

DARE,O.K., NADLER,S.A. AND FORBES,M.R. Nematode lungworms of two species of

anuran amphibians: evidence for co-adaptation. Int. J. Parasitol. v.38(14), 1729-1736, 2008.

DORRIS,M., VINEY,M.E. AND BLAXTER,M.L. Molecular phylogenetic analysis of the

genus Strongyloides and related nematodes. Int. J. Parasitol. v.32(12), 1507-1517, 2002.

DUBEY,S. AND SHINE,R.Origin of the parasites of an invading species, the Australian cane

toad (Bufo marinus): are the lungworms Australian or American? Mol. Ecol. v.17(20), 4418-

4424,2008.

NATIONAL CENTER FOR BIOTECHNOLOGY INFORMATION - ENTREZ

NUCLEOTIDE DATABASE – GenBank - available at

<http://www.ncbi.nlm.nih.gov/sites/entrez?db=nucleotide>, accessed in April, 20th 2009.

KUZMIN,Y., TKACH,V.V. AND BROOKS,D.R. Two new species of Rhabdias (Nematoda:

Rhabdiasidae) from the marine toad, Bufo marinus (L.) (Lissamphibia: Anura: Bufonidae), in

Central America. J. Parasitol. v.93(1), 159-165, 2007.

LHERMITTE-VALLARINO,N., BARBUTO,M., INEICH,I., WANJI,S.,LEBRETON,M.,

CHIRIO,L. AND BAIN,O. First report of Rhabdias (Nematoda, Rhabdiasoidea) from lungs

of montane chameleons in Cameroon: description of two new species and notes on biology.

Parasite v.15, 553-564, 2008.

45

TKACH,V.V., KUZMIN,Y. AND PULIS,E.E. A new species of Rhabdias from lungs of the

wood frog, Rana sylvatica, in North America: the last sibling of Rhabdias ranae? J. Parasitol.

v.92(3), 631-636, 2006.

46

Figure 1. Resulting electrophoresis gel from samples of Rhabdias filicaudalis: 1- Standard

reference, 2 – Sample from host Oxyrhopus guibei, 3 – Sample from host Crotalus durissus

terrificus, 4 – Sample from host Boa constrictor amarali (1), 5 – Sample from host Boa

constrictor amarali (2) and 6 – Sample from host Bothrops neuwiedii.

47

Considerações gerais

48

Considerações gerais

O estudo da helmintofauna de serpentes do Brasil é ainda um campo a ser explorado,

pois, embora muito já tenha sido feito, ainda existe muito a se estudar, a recente descrição de

Rhabdias filicaudalis é um exemplo. Estudos básicos são de extrema importância para o

conhecimento da fauna.

Com relação especificamente ao gênero Rhabdias, este trabalho resultou na descrição

de uma nova espécie, bem como no relato de novos hospedeiros e caracterização do ciclo de

vida, sendo que o estudo foi realizado em uma região aonde previamente outra espécie,

Rhabdias vellardi (Grego et al., 2004), havia sido relatada parasitando serpentes, e que não

foi identificada neste estudo. Isso indica que uma reanálise a respeito dos exemplares do

gênero Rhabdias já existentes em coleções, bem como coletar serpentes nos diferentes biomas

brasileiros deva ser minuciosamente conduzida, afim de se verificar a existência de novas

espécies, novos hospedeiros para espécies já existentes, redescrever e complementar os dados

das espécies do gênero Rhabdias de ocorrência no território brasileiro.

A fauna brasileira possui, relatadas, mais de 750 espécies de anfíbios, e mais de 630

de répteis (SBH, 2009), sendo todos potenciais hospedeiros de parasitas do gênero Rhabdias,

distribuidas em 6 grandes biomas, com características absolutamente distintas, o que nos leva

a acreditar que ainda existam outras espécies do gênero Rhabdias a serem descobertas e

descritas.

Parasitas podem ser utilizados para estudos ecológicos e de evolução, uma vez que

muitas vezes co-evoluem com seus hospedeiros, servindo assim de modelo para os estudos,

cujos resultados poderiam ser extrapolados aos hospedeiro. Esta possibilidade torna-se

especialmente interessante quando a espécie hospedeira é rara ou ameaçada de extinção, pois

em alguns casos, em um único hospedeiro, podemos encontrar grandes quantidades de

parasitas para serem analisados. Sendo assim, o conhecimento da helmintofauna dos animais

silvestres torna-se muito relevante, pois quanto melhor conhecermos os parasitas, melhor

também conheceremos seus hospedeiros e suas histórias de vida.

49

Referências bibliográficas

50

Referências bibliográficas1

ANDERSON, R. C. Nematodes of vertebrates: their development and transmission. USA,

Oxford University Press, 2ed., 750p, 2000.

ARAÚJO, T.; MORO, L.; LÚCIA, M.; GOLLOUBEFF, B.; VASCONCELOS, A.C.

Ocorrência de alguns endo e ectoparasitos no serpentário da UNIFENAS - Universidade de

Alfenas - MG . Braz. J. Vet. Res. Anim. Sci., v. 36, p.19- 22. 1999.

BAER J.G. Deux helminthes nouveaux, parasites de Uraeotyphlus oxyurus, gymnophyone de

l'Inde meridionale. Rev. Suisse Zool., v.37, p.43-52, 1930.

BAKER, M.R. Nematode Parasitism in amphibians and reptiles. Can. J. Zool., v.6, p.747-757,

1983.

BARRELLA, T.H.; SILVA, R.J. Digenetic trematodes infection in a Bothrops moojeni

(Viperidae) population from a fauna rescue in Porto Primavera, São Paulo State. Arq. Bras.

Med. Vet. Zoot. v.55, p.243-245, 2003.

BENTON,M.J. Vertebrate Palaeontology,UK, Blackwell Publishing 3ed, 455p, 2005.

BOQUIAMPI-FREITAS, L.; VRCIBRADIS D.; VICENTE, J.J.; BURSEY, C.R.; ROCHA,

C.F.D.; VAN SLUYS, M. Helminths of the horned leaf frog, Proceratophrys appendiculata,

from southeastern Brazil. J. Helmint., v.75, p.233-236, 2001.

BURSEY, C.R.; GOLDBERG, S.R.; TELFORD JR., S.R. Rhabdias anolis n. sp. (Nematoda:

Rhabdiasidae) from the lizard, Anolis frenatus (Sauria: Polychrotidae), from Panama. J.

Parasitol., v.89(1), p.113–117, 2003.

1 referências formatadas segundo as normas do Manual de Teses 2009 da divisão de biblioteca

da UNESP.

51

BURSEY, C.R.; GOLDBERG, S.R. New species of Oswaldocruzia (Nematoda:

Molineoidae), new species of Rhabdias (Nematoda: Rhabdiasidae), and other helminths

in Rana cf. forreri (Anura: Ranidae) from Costa Rica. J. Parasitol., v.91(3), p.600–605,

2005.

CORREA, A.A.S. Fauna de trematódeos parasitos de ofídios da área geográfica brasileira.

Dissertação (Mestrado). 1980, Instituto de Ciências Biomédicas, Universidade de São Paulo,

São Paulo.

CHU, T. Studies on the life history of Rhabdias fuscovenosa var. catanensis (Rizzo,1902). J.

Parasitol., v.22, p.140-160, 1936.

DORRIS, M.; VINEY, E. M.; BLAXTER, L. M.; Molecular phylogenetic analysis of the

genus Strongyloides and related nematodes. Intern. J. Parasitol. v. 32, p. 1507- 1517, 2002.

FABIO, S. P., TATY – SON ROLAS, F. J. Sobre alguns helmintos parasites de Dryadophis

bifossatus(Raddi). Mem. Inst. Oswaldo Cruz, v.72, p.283-290, 1974.

GOLDBERG, S.R.; BURSEY, C.R.; VITT, L.J. Helminths of the Brown-eared anole, Norops

fuscoauratus (Sauria, Polychrotidae), from Brazil and Ecuador, South America. Phyllomedusa

v.5(1), p.83-86, 2006.

GREGO, K.F., GARDINER, C.H., CATÃO – DIAS, J.L. Comparative pathology of parasitic

infections in free-ranging and captive pit vipers (Bothrops jararaca). Vet. Rec., v.154(18),

p.559,562, 2004.

HOFFMANN, R.P. Diagnóstico de parasitismo veterinário. Porto Alegre: Sulina, 1987. p.33-

39.

KLINGENBERG, R. J. Understanding reptiles parasites. California: Advanced Vivarium

Systems, 1993. 83p.

KUZMIN, Y. I. Rhabdias agkistrodonis (Nematoda, Rhabdiasidae): Morphology,

distribution and specificity, Folia Parasitol., v.46, p.59-66, 1999.

KUZMIN, Y. I., MISKOV, R. O. On the life cycle of Rhabdias elaphe Sharpilo,1976

(Nematoda, Rhabdiasidae). Acta Parasitol. v.44(2), p.119-124, 1999.

52

KUZMIN, Y. Rhabdias japalurae sp. nov. (Nematoda, Rhabdiasidae) from the japalures

(Reptilia, Agamidae) and some notes on other Rhabdias spp. from lizards Acta

Parasitologica, v.48, p.6-11, 2003.

KUZMIN Y.; TEACH V.V.; SNYDER S.D. The nematode genus Rhabdias (Nematoda:

Rhabdiasidae) from amphibians and reptiles of the Nearctic – Comp. Parasitol., v.70(2),

p.101-114, 2003.

KUZMIN Y.; TKACH, V.V.; VAUGHAN, J.A. Rhabdias kongmongthaensis sp. n.


in Thailand. Folia Parasitologica, v.52, p.339–342, 2005.

LHERMITTE-VALLARINO N.; BAIN, O. Morphological and biological study of Rhabdias

spp. (Nematoda) from african chameleons with description of a new species. Parasite,

v.11(1), p.15-31, 2004.

LUQUE J.L.; MARTINS, A.N; TAVARES,L.E.R. Community structure of metazoan

parasites of the yellow Cururu toad, Bufo ictericus (Anura, Bufonidae) from Rio de Janeiro,

Brazil. Acta Parasitol., v.50(3), p.215–220, 2005.

MADER, M. R. Reptile medicine and surgery. Philadelphia: W. B. Saunders Co., 1996.

p.277-281.

MARTÍNEZ-SALAZAR E.A. A new rhabdiasid species from Norops

megapholidotus (Sauria: Polychrotidae) from Mexico. J. Parasitol., v.92(6), p.1325–1329,

2006.

MARTÍNEZ-SALAZAR, E.A.; LEÓN-RÈGAGNON, V. Rhabdias lamothei n. sp.

(Nematoda: Rhabdiasidae) from Leptodeira maculata (Colubridae) in Mexico, including new

records of R. fuscovenosa (Railliet, 1899) Goodey, 1924 – Zootaxa, v.1257, p.27–48, 2006.

PANIZZUTTI, M.H.H.; SANTOS, L.C.,VICENTE; J.J, MUNIZ-PEREIRA, L.C.; PINTO,

R.M. Ophidascaris durissus sp. nov. (Nematoda Ascarididae) parasitizing Crotalus durissus

Linnaeus (Ophidia, Viperidae) in Brazil. Rev. Brasil. Zool. v.20, p.9-11, 2003.

53

PEREIRA, C. Fauna Helminthologica dos Ophideos Brasileiros. Bol. Biol. São Paulo, v. 10,

p.179-185, 1927.

PEREIRA, C. Fauna Helminthologica dos Ophideos Brasileiros. Bol. Biol. São Paulo, v.11, p.

13-22, 1928.

PEREIRA, C. Strongyloides ophidiae. Bol. Biol. São Paulo, v.15, p.16-17, 1929.

REY, L. Parasitologia. Rio de Janeiro: Guanabara Koogan, 2001. 856p.

ROSSELINI, M. Caracterização da helmintofauna de Helicops leopardinus (serpentes,

colubridae) do Pantanal sul, Mato Grosso do Sul. 2007, 56f. Dissertação(Mestrado) Instituto

de Biociências, Universidade Estadual Paulista, Botucatu.

RUPPERT, E.E.; FOX, R.S.; BARNES,R.D., Zoologia dos Invertebrados, São Paulo, Ed.

Roca 7ed., 1145p., 2005.

SANTOS, K.R.; TAKAHIRA, R.K.; RALL, V.L.M.; CALDERÓN, C.; SEQUEIRA, J.L.;

SILVA, R.J. Pulmonary, microbiological and hematological changes in Crotalus durissus

terrificus (Serpentes, Viperidae) parasitized by nematodes of the genus Rhabdias (Nematoda,

Rhabdiasidae). Arq. Bras. Med. Vet. Zootec., v. 60, p.667-674, 2008.

SARKAR,M.D.; MANNA, B. On a New Species of the Genus Rhabdias Stiles and Hassall,

1905(Nematoda: Rhabditida) from Bufo melanostictus Schneider, 1799 from Belur and

Habra,West Bengal, India, With a Host-Parasite List. Philipp. j. sci., v.133(1), 2004.

SBH - SOCIEDADE BRASILEIRA DE HERPETOLOGIA. Brazilian reptiles – List of

species. Disponível em: <www.sbherpetologia.org.br>, 2008.

SCHMIDT, G.D. CRC Handbook of tapeworm identification. Florida: CRC Press,1986.

SILVA, R.J. As Serpentes, Jaboticabal, Funep, 1 ed., 142p., 2000.

SILVA, R.J.;ANDRADE, P.A. DE; SILVA, H.A.M.; ROSSELLINI, M.; BARRELLA, T.H.

Report on the occurrence of Haplometroides buccicola Odhner, 1911 (Trematoda, Digenea,

Plagiorchiidae) infecting Phalotris lativittatus Ferrarezzi, 1993 (Serpentes, Colubridae) in

Brazil. J. Venom. Anim. Toxins Incl. Trop. Dis. v.11, p.372-378, 2005a.

54

SILVA, R.J., BARRELLA, T.H. Micrurus frontalis as a new host recorded for

Haplometroides odhneri (Trematoda, Digenea, Plagiorchiidae). Rev. Bras. Parasitol. Vet.

v.11, p.47-48, 2002.

SILVA, R.J.; BARELLA, T.H.; NOGUEIRA, M.F.; O’DWYER, L.H. Frequency of

helminths in Crotalus durissus terrificus (Serpentes, Viperidae) in captivity. Rev. Bras.

Parasitol. Vet., v.10(2), p. 91-93, 2001.

SILVA, R. J.; BÉDA, A. F.; FERREIRA, V. L.. New record of Haplometroides intercaecalis

(Digenea, Plagiorchiidae) infecting a Brazilian snake. J. Ven. Anim. Toxins Incl. Trop. Dis.,

v.14, p. 161-165, 2008.

SILVA, R.J.; FERREIRA, V.L.; STRUSSMANN, C. New species of Haplometroides

(Digenea, Plagiorchiidae) from Phalotris nasutus (Gomes, 1915) (Serpentes, Colubridae). J.

Parasitol. v.93(4), p.917-921, 2007.

SILVA, R.J., KARASAWA, A.S.M., BARRELLA, T.H., CHERUBINI, A.L., LOPES,

C.A.M., AMARANTE, A.F.T. The occurrence of Crepidobothrium sp. (Cestoda,

Proteocephalidae) in Bothrops moojeni (Hoge) (Serpentes, Viperidae). Rev. Bras. Zool. v.18,

p.375-379, 2001b.

SILVA, R.J., PORTELA, R.C., SANTOS, F.J.M. Corallus caninus (Serpentes, Boidae): a

new host for Ophiotaenia sp. (Cestoda, Proteocephalidae). Arq. Bras. Med. Vet. Zoot. v.98,

p.961-963, 2006.

SILVA, R.J., RODRIGUES, R.R., STEIN, M.F.B., SIPOLI, G.P.M., PINHÃO, R., LOPES,

C.A.M. The detection of Ochetosoma heterocoelium (Travassos, 1921)(Trematoda, Digenea,

Ochetosomatidae) in Chironius exoletus (Linnaeus, 1758) (Serpentes: Colubridae). J. Venom

Anim. Toxins. v.5, p.85-90, 1999.

SILVA, R.J., ZICA, E.O.P., CRUZ, M., O’REILLY, J.C., COSTA, M.C. DA Occurrence of

Haplometroides odhneri (Trematoda, Digenea, Plagiorchiidae) infecting Leptotyphlops

koppesi (Serpentes, Leptotyphlopidae). Arq. Bras. Med. Vet. Zoot. v.57, p.267-269, 2005b.

55

SIQUEIRA, L, R., PANIZZUTTI, M. H. M., MUNIZ-PEREIRA, L. C., PINTO, R. M.

Description of a new ascaridoid parasite of Bothrops jararaca Wied (Reptilia, Ophidia) in

Brazil. Rev. Bras. Zool. v.22, p.587-590, 2005.

SMYTH, J.D. Introduction to animal parasitology, Cambridge: Cambridge University Press,

3 ed.,1994.

THATCHER, V.E. Trematódeos Neotropicais. Manaus, Instituto Nacional de Pesquisas da

Amazônia, 1993.

TKACH V.V.; KUZMIN, Y.; PULIS, E.E. A new species of Rhabdias from lungs of the

wood frog, Rana sylvatica, in North America: the last sibling of Rhabdias ranae? J.

Parasitol. v.92(3), p.631–636, 2006.

TRAVASSOS, L., FREITAS, J.F.T., KOHN, A. Trematódeos do Brasil. Mem. Inst. Oswaldo

Cruz. v.67, p.1-886, 1969.

TROMBETA, A.M. Estudo da helmintofauna de anfíbios das famílias Cerathophryidae,

Leptodactylidae e Leiuperidae do Pantanal sul, Mato Grosso do Sul. 2008, 53f.

Dissertação(Mestrado) Instituto de Biociências, Universidade Estadual Paulista, Botucatu.

VICENTE, J. J.; RODRIGUES, H. O.; GOMES, D. C.; PINTO, R.M. Nematódeos do Brasil.

Nematódeos de répteis. Parte III. Rev. Bras. Zool, v.10, p.1-183, 1993.

YAMAGUTI, S. Systema Helminthum - Cestodes. Vol. II. London, Interscience Publishers,

1959.

YAMAGUTI, S. Systema Helminthum - Nematodes. Vol. III. - Part I e II. London,

Interscience Publishers, 1961.

YAMAGUTI, S Systema Helminthum - Trematodes. Vol. I. London, Interscience Publishers,

1971.

YUEN, P.H. Some studies on the taxonomy and development of some rhabdiasoid and

cosmocercoid nematodes from Malayan amphibians. Zool. Anz., v.174, p.275-298, 1965.

CARACTERIZAÇÃO MORFOLÓGICA E MOLECULAR DE

Documents

Transcript of CARACTERIZAÇÃO MORFOLÓGICA E MOLECULAR DE