Capturing limbal epithelial stem cell population dynamics, signature, and their niche · 2020. 6....

1

Capturing limbal epithelial stem cell population dynamics, signature, and their niche

Anna Altshuler1*, Aya Amitai-Lange1*, Noam Tarazi1, Sunanda Dey1, Lior Strinkovsky2, Swarnabh

Bhattacharya1, Shira Hadad-Porat1, Waseem Nasser1, Jusuf Imeri1, Gil Ben-David1, Beatrice Tiosano3, Eran

Berkowitz3, Nathan Karin4, Yonatan Savir2, 5** and Ruby Shalom-Feuerstein1,5 **

1Department of Genetics & Developmental Biology, The Rappaport Faculty of Medicine & Research

Institute, Technion Integrated Cancer Center, Technion – Israel Institute of Technology, Haifa, Israel; 2Department of Physiology, Biophysics & Systems Biology, The Rappaport Faculty of Medicine & Research

Institute, Technion – Israel Institute of Technology, Haifa, Israel; 3Department of Ophthalmology, Hillel

Yaffe Medical Center, Hadera, Israel; 4Department of Immunology, The Rappaport Faculty of Medicine &

Research Institute, Technion – Israel Institute of Technology, Haifa, Israel; 5Correspondence to Ruby

Shalom-Feuerstein ([email protected]) or Yonatan Savir ([email protected])

*Equal contribution; **Equal contribution

Abstract

Stem cells (SCs) are traditionally viewed as rare, slow-cycling cells that follow deterministic rules dictating

their self-renewal or differentiation. It was several decades ago, when limbal epithelial SCs (LSCs) that

regenerate the corneal epithelium were one of the first sporadic, quiescent SCs ever discovered. However,

LSC dynamics, heterogeneity and genetic signature are largely unknown. Moreover, recent accumulating

evidence strongly suggested that epithelial SCs are actually abundant, frequently dividing cells that display

stochastic behavior.

In this work, we performed an in-depth analysis of the murine limbal epithelium by single-cell RNA

sequencing and quantitative lineage tracing. The generated data provided an atlas of cell states of the

corneal epithelial lineage, and particularly, revealed the co-existence of two novel LSC populations that

reside in separate and well-defined sub-compartments. In the “outer” limbus, we identified a primitive

widespread population of quiescent LSCs (qLSCs) that uniformly express Krt15/Gpha2/Ifitm3/Cd63

proteins, while the “inner” limbus host prevalent active LSCs (aLSCs) co-expressing Krt15-GFP/Atf3/Mt1-

2/Socs3. Analysis of LSC population dynamics suggests that while qLSCs and aLSCs possess different

proliferation rates, they both follow similar stochastic rules that dictate their self-renewal and

differentiation. Finally, T cells were distributed in close proximity to qLSCs. Indeed, their absence or

inhibition resulted in the loss of quiescence and delayed wound healing. Taken together, we propose that

divergent regenerative strategies are tailored to properly support tissue-specific physiological constraints.

The present study suggests that in the case of the cornea, quiescent epithelial SCs are abundant, follow

stochastic rules and neutral drift dynamics.

Introduction

Stem cells (SCs) differ from any other cells by their substantial ability to retain in an undifferentiated state,

self-duplicate or enter differentiation program, depending on tissue demand1 2. SCs have been

successfully applied in clinical trials to reconstitute the bone marrow, treat skin burn, and restore corneal

blindness3. However, various fundamental features of SCs are still under debate or remain unknown. For

example, SC prevalence in the niche, SC heterogeneity and self-renewal mechanisms are not well

was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted July 1, 2020. ; https://doi.org/10.1101/2020.06.30.179754doi: bioRxiv preprint

mailto:[email protected]

https://doi.org/10.1101/2020.06.30.179754

2

understood, and consequently, they remain enigmatic cells4 5. These key challenges hamper the

progression towards advanced application of SCs for regenerative medicine.

Seminal studies supported a deterministic and hierarchical model in which SCs were viewed as slow-

cycling cells that are located in a specialized microenvironment known as the niche6 7 8. Such quiescent

SCs (qSCs) are commonly believed to be rare cells that are surrounded by their progeny, of abundant, fast

cycling but short-lived progenitor cells9. Key evidence for the quiescence and scarcity of SCs came from

indirect observations in vivo and in vitro. Sporadic slow-cycling cells were identified in different tissues as

nucleotide-label retaining cells in pulse-chase experiments performed in various tissues including the

cornea10, bone marrow11, brain12, skin13, gut14 and skeletal muscle15. Clonal survival/growth dynamics in

vivo (i.e. by genetic lineage tracing of single cells at the SC compartment) or ex vivo (i.e. by colony

formation assay), typically result in the detection of a low number of clones that survive for long-periods

of time. This evidence shaped the traditional deterministic model that considered qSCs as very potent

cells that are also very scarce. The benefits of quiescence may be paramount and include reduced

biochemical damage associated with the production of toxic agents or biosynthesis of macromolecules,

and minimalized accumulation of disease-causing mutations16 17.

Despite much effort in the field, markers that reliably identify genuine and scarce qSCs were usually not

found. Proposed markers, typically labeled a contiguous widespread cell population in the SC

compartment5. Nevertheless, the co-existence of qSCs and actively dividing SCs (aSCs) in specific tissues

including the bone marrow, brain, hair follicle and muscle has been shown18 19 20. These tissues differ from

traditional epithelial SC models by their significantly slower turnover (or resting phase)21. In recent years,

however, frequently dividing SCs were identified in epithelial tissues including the gut22, epidermis23 and

esophagus24. These studies proposed an alternative, virtually opposing, stochastic model that attributes

SCs with entirely contrary properties including short cell cycle, abundance in the niche and unpredictable

survival rate18 1 25 26. One of the common models that is used to capture this phenomena is that of

asymmetric self-renewal with neural drift dynamics23 27. These findings challenged the conventional

paradigm that considered quiescence as an integral feature of SCs.

It is likely that the appropriate regenerative strategy is tailored for each tissue depending on the

physiological necessities and challenges (e.g. irradiation, toxicity, cellular turn over or lineage diversity).

In this sense, the corneal epithelium is an interesting study case, whereas SCs and their progeny must

support tissue transparency and protection from sun irradiation, toxicants, physical injury and invading

microorganisms28. Indeed, most ocular surface epithelial cancers are restricted to the corneal SC

compartment of the limbus. However, the rareness of limbal tumors suggests the existence of specialized

mechanisms that may provide protection against neoplastic cell transformation.

The cornea is an excellent model for SC research hallmarked by segregation of SCs, short-lived progenitors

and differentiated cells into distinct anatomical compartments. The clarity and high accessibility of the

cornea, allows multi-color (“Confetti”) fluorescent lineage tracing29 30 31, assessing different SC

hypotheses32, as well as SC or progenitor cell depletion using vital microscopy33 34. Corneal epithelial SCs

reside in the limbus, a ring-shaped region at the corneal-conjunctival boundary. The limbal

microenvironment (niche) markedly differs from that of the cornea. It contains blood and lymph

vasculature whereas the cornea is avascular, it is hallmarked by a unique extracellular matrix with soft

biochemical properties while it hosts specialized niche cells35 36 37.


https://doi.org/10.1101/2020.06.30.179754

3

Rare label retaining cells were confined to the limbus10 38. In line, colony formation tests revealed that

only a low percentage of limbal cells could form large clones (“holoclones”) in vitro, a feature that is

commonly attributed to bona fide limbal SCs (LSCs)39 40. Based on these observations, it is widely believed

that true LSCs are scarce limbal epithelial cells kept most of the time in quiescence state and are

surrounded by their early progeny which are abundant, fast dividing but short-lived progenitor cells.

Tremendous efforts have been made by many research groups to discover markers for the identification

of LSCs. Keratin 15 (Krt15) 33 41, C/EBPdelta and BMI142, ABCB543, ABCG244 and P6345 represent a partial

list of genes proposed to identify LSCs. Recently, we have shown that the Krt15-GFP transgene (green

fluorescent protein coding gene under the promoter of Krt15) labeled a discrete population of murine

LSCs. Krt15-GFP+ basal limbal epithelial cells were located at close proximity to the site of corneal

regeneration origin, as evident by lineage tracing of Krt14+ cells33.

However, neither Krt15-GFP, nor any of the proposed markers could faithfully mark a hypothetical rare,

slow-cycling SC population in the limbus, suggesting that the current model may be inaccurate.

Consequently, the prevalence of LSCs, their genetic signature, and regulation by niche cells remain poorly

defined. Here we combined single-cell transcriptomics and quantitative lineage tracing to capture LSC

populations and their signature. This work provides a useful atlas of the entire murine corneal epithelial

lineage, including the signature of a slow cycling quiescent LSC (qLSC) state, and finally, unravels an

apparently tight interaction and regulation of LSCs by T cells.

Results

Careful inspection of the limbus of Krt15-GFP transgene bearing mice showed that Krt15-GFP+ cells are

confined to an “inner” limbal zone, suggesting that the “outer” limbal region (the space between Krt15-

GFP+ cells and the Krt8+ conjunctiva) contains a different LSC population (Fig. 1a, S1a). To clarify the

molecular nature and heterogeneity of LSC populations, we performed a single-cell transcriptomic

analysis. In order to facilitate the detection of rare cell populations, reduce variability and gain robust

statistical data, we preferentially isolated epithelial cells from the limbus of 5 individual adult mice (2.5

months old, n=10 eyes). The limbus together with marginal conjunctiva and corneal periphery were

carefully dissected (Fig. 1a), a protocol for isolating mainly epithelial cells was applied (see Methods), and

suspended cells were subjected to 10x Chromium Single-Cell RNA sequencing (scRNA-seq). Initial raw data

analysis and quality controls were performed with Cell Ranger software and a large number of 4,787 high

quality cells passed rigorous quality tests exhibiting significant mean reads (98,763 per cell) as well as a

substantial median number of 2,479 detected genes per cell.

In silico analysis revealed discrete cell states in the corneal epithelial lineage

Cell filtering and unbiased clustering were performed with R package Seurat46 revealing 11 cell

populations displaying a markedly distinct signature of gene expression (Fig. 1b, S1b). Analysis of lineage-

specific markers suggested that >99% of the cells are ocular epithelial cells (see Methods). Next, we

performed in silico analysis of putative markers for each epithelial tissue (i.e. conjunctiva, limbus, and

cornea) and cell layer (i.e. basal or supra basal layer) (Fig. 1c-j, S1c-d).

Conjunctival cells: Clusters 1-2 were identified as conjunctival cells based on the positive expression of

putative conjunctival cytokeratins (Krt17, Krt4, Krt19 (Fig. 1c) and Krt6a, Krt13, Krt8 (Fig. S1c)47), and the

lack or comparatively low expression of corneal markers Krt12 and Slurp148 49 and of the protein


https://doi.org/10.1101/2020.06.30.179754

4

phosphatase 1 (Ppp1r3c) (Fig. 1d). Further analysis of putative markers of basal (Itgb1, Itgb4, Ccnd1 (Cyclin

D1)50 51) and supra basal (Cld4, Dsg1a, Cdkn1a (P21)52 53 54) cells indicated that cluster 1 represents a

population of basal conjunctival cells while cluster 2 denotes supra-basal conjunctival cells (Fig. 1g-h).

Krt15 was highly expressed by conjunctival basal cells (cluster 1) and even higher in conjunctival supra-

basal cells (cluster 2), whereas Krt14 displayed basal cell enrichment in conjunctival cells (Fig. 1i).

Limbal cells: Clusters 3-5 were identified as limbal cells based on the lack or lower expression of

conjunctival (Fig. 1c, S1c) and corneal (Fig. 1d) markers. While cluster 5 displayed supra-basal cell

phenotype, cluster 3-4 were identified as limbal basal cells (Fig. 1g-h) expressing a set of new limbal

specific markers (Fig. 1e-f). As compared to cluster 4, cluster 3 was hallmarked by much higher levels of

Krt15 and Krt14 (Fig. 1i) and lower Krt12 (Fig. 1d), suggesting that it represents the most primitive

undifferentiated limbal cell population.

Corneal cells: Although a minimal basal expression levels of corneal specific Krt12 mRNA was found in all

groups, clusters 6-9 expressed much higher levels of Krt12 (Krt12hi) (Fig. 1d). Clusters 6-7 were basal

corneal epithelial markers although cluster 7 appeared to include cells that seemingly initiated

differentiation, as evident by attenuation of basal epithelial cell markers on the expense of supra-basal

cell markers (Fig. 1g-h). Likewise, analysis of basal/supra-basal cell markers suggested that cluster 8

represents partially differentiated cells, most likely corneal wing cells, whereas cluster 9 represents

terminally differentiated superficial cells (Fig. 1g-h). In line with previous reports33 41, while Krt15 and

Krt15-GFP labeled basal conjunctival/limbal epithelial cells, they also marked supra-basal cells of the

conjunctiva, limbus and marginal cornea periphery (Fig. 1i). Interestingly, the signal of endogenous Krt15

did not overlap with that of Krt15-GFP (Fig. 1l), in line with previous reports on epidermis55. This suggests

that the genomic insertion site of K15-GFP transgene, the fractional Krt15 promoter cloned, lack of Krt15

coding sequence or presence of GFP sequence, may have deviated the transcriptional regulation of the

Krt15-GFP transgene away from that of endogenous Krt15.

Cells in mitosis: Interestingly, clusters 10-11 were found to represent cells from all 3 tissues (conjunctiva,

limbus, cornea (Figs. 1c-f)) that were hallmarked by various cell cycle genes including Mki67, Top2a, Ccna2

(Cyclin A2) (Fig. 1j). The grouping of this cell population of mixed lineages into discrete clusters indicated

that the changes in expression of genes related to mitosis were profound and dominated the differential

expression of tissue-specific genes. Further analysis of cell cycle genes, suggested that cluster 10

represents cells that were captured at early stage of mitosis (late G1-S) while cells of cluster 11 were

netted at relatively more advanced stages (S, G2 and M) of the cell cycle (Fig. S1d).

Two novel limbal sub-compartments: To certify the cluster identification in vivo, we performed in situ

hybridization (ISH) on tissue sections to assess the anatomical localization of selected clusters. Eyes of 2-

3 months old C57BL/6 mice were enucleated and tissue sections were stained as detailed in Methods. The

conjunctiva and cornea were labeled using ISH probes for Keratin 4 (Krt4) and Krt12, respectively. In order

to identify the location of the limbal clusters 3-4, we focused on Gpha2 and Atf3 that displayed relatively

high mRNA copies. Interestingly, this analysis revealed 2 novel well-demarcated sub-compartments in the

limbus. The “outer limbus” was occupied by thin epithelium comprised of small basal epithelial cells with

flattened morphology that expressed Gpha2 mRNA. The basal layer cells of the “inner limbus” expressed

Atf3 mRNA and displayed flattened cell morphology that gradually became cuboidal towards the corneal

periphery (Fig. 1k). In agreement, immunostaining showed that the outer limbal basal epithelial cells were

Krt15+/Ifitm3+/Cd63+ whereas inner limbal epithelial cells were Krt15-GFP+/Atf3+/Mt1-2+ (Fig. 1l).


https://doi.org/10.1101/2020.06.30.179754

5

It was noticeable that the two limbal sub-compartments are thin. Moreover, the outer limbus tissue was

occasionally absent or truncated in tissue sections. Therefore, to keep the tissue intact and facilitate

efficient analysis, we established wholemount immunostaining for antibodies that were found suitable.

Figure 1m-o, shows that antibodies against Gpha2, Ifitm3 and Cd63 specifically labeled the outer limbus

while Krt15-GFP and Mt1 labeled the inner limbus by wholemount immunostaining.

For consistency and further analyses, we defined conventions for the identification of the outer and inner

limbus. The outer limbus markers (Gpha2, Ifitm3 or Cd63) displayed uniform and sharp signal and were

well-correlated with slow proliferation and clonal growth dynamics (Figs 2-3). Hence, these markers

hereafter were chosen to define the outer limbus, as illustrated in Fig. 1o. Next, the inner limbus was

defined as the limbal zone that was negative to outer limbal markers, and its boundary with the peripheral

cornea was demarcated by inner limbus markers (e.g. Krt15-GFP in Fig. 1o). Accordingly, quantitative

analysis showed that the average width of the outer limbus was ~100m while the inner limbus was much

wider (~240m) (Fig. 1p). Interestingly, the pattern of Krt15-GFP signal was often continuous, or nearly

continuous with outer limbus markers like Gpha2, but never overlapped with the labeling of the outer

limbus (Fig. 1n-o). Interestingly, by microscopic analysis of wholemount tissues, it was noticed that

flattened basal cells found in both sub-compartments were hallmarked by a unique pattern of nuclei

staining that differed from that of the cuboidal basal cells that were detected in the marginal inner limbus

and corneal periphery (Fig. S1e-f). Finally, analysis of selected keratin coding genes confirmed that basal

outer limbal epithelial cells were Krt15hi/Krt14hi/Krt17med/Krt12neg, basal inner limbal epithelial cells were

Krt15neg/Krt14med/Krt17neg/Krt12low, while conjunctival cells were Krt19hi/Krt17hi/Krt6hi/Krt8med/Krt12neg

(Fig. S1c, g-h).

In silico analysis of clusters: Next, pathway enrichment analysis using WebGestalt56 was performed with

the ORA method using KEGG as the functional database in order to identify potential pathways that were

enriched in clusters 3 or 4 in comparison to all other clusters. Interestingly, SC and cancer pathways

including Pi3K and P53 were enriched in cluster 3 while cluster 4 was enriched with TNF pathways and

multiple annotations for cancer (Fig. S2). Additional analysis revealed a list of differentially expressed

genes expressed by clusters 3 or 4 (Fig. S3a-b). Expectedly, genes related to hemi-desmosomes increased

in clusters of basal cells (clusters 1, 3-4, 6-7), and desmosome-related and gap junction associated genes

increased in clustered supra-basal cells (clusters 2, 5, 8-9) (Fig. S3c). Interestingly, high levels of the

extracellular matrix (ECM) components Lamb3 and Crim1 (Cysteine-Rich Motor Neuron 1), that regulates

BMP and inhibits cell proliferation57, were found in the outer limbus cluster 3, whereas Col17a1 was higher

in the inner limbus cluster 4. Taken together, this data illuminates the genetic signature of diverse cell

states across the corneal epithelial lineage, and in particular, reveals the co-existence of two discrete

limbal sub-compartments consisting of two distinct limbal epithelial cell populations.

Quantitative lineage tracing suggested distinct clonal dynamics and lineage hierarchy for outer and

inner limbal epithelial cells

To further uncover the nature of outer and inner limbal epithelial cells, functional enrichment analysis

(WebGestalt with ORA and KEGG) shed light on differences between clusters 3 and 4. Interestingly, among

the top 10 functional categories, 4 identifiers involved cell proliferation while 3 involved cell movement

(Fig. S4a), suggesting that a central difference between the limbal clusters 3 and 4 lies in their cell cycle

and motility characteristics. We thus aimed to gain insights regarding proliferation, clonal dynamics,


https://doi.org/10.1101/2020.06.30.179754

6

centripetal movement, and discover the potential hierarchy between all clusters and within each limbal

zone. For that purpose, we designed a quantitative genetic lineage tracing experiment for tracking all cell

populations including potentially rare LSC populations, in a clonal and inducible manner. We established

double transgenic UBC-CreERT2; Brainbow2.1 mice that facilitated the tamoxifen inducible activation of Cre

recombinase in all cell types in an efficient and unbiased manner under the control of the ubiquitin C

(UBC) promoter (Fig. S4b). In the absence of tamoxifen, Cre is expressed at the cytoplasm of all cell types

of this mouse, thus unable to access the DNA. However, upon transient exposure to tamoxifen, Cre

recombinase translocates into the nucleus where it can randomly induce DNA excision and/or inversion

of the loxP sites in the brainbow2.1 cassette, thus, allowing stochastic and irreversible expression of one

out of four “confetti” fluorescent proteins (namely, nuclear green (GFP), cytoplasmic red (RFP),

cytoplasmic yellow (YFP) or membrane cyan (CFP) fluorescent protein) (Fig. S4c)58.

Two-month-old mice were treated with tamoxifen for 3-4 consecutive days to induce efficient “Confetti”

labeling in all cell populations. For quantitative analysis of the limbal sub-compartments, wholemount

staining of Gpha2 was performed to identify the outer limbus (647nm to avoid overlap with 4 Confetti

colors and DAPI) while the contiguous 100m Gpha2-negative limbus was considered as inner limbus for

calculations (Fig. S4d).

Interestingly, at all time-points, the distribution of clones size (i.e., the number of basal cells in a clone) in

the outer limbal epithelial zone was significantly lower compared to those found in the inner limbus and

the peripheral cornea. Moreover, the average clonal size in the inner limbus was smaller than the size of

clones in the corneal periphery (Fig. 2a-d, e). Two months post induction, a pattern of radial stripes

emerged already in clones that held a “foot” in the inner limbus (Fig. 2b). Four-months post induction,

when the pattern of fully developed, radial stripes appeared. Most stripes extended from the inner limbus

and only a few confetti stripes were sourced from the outer limbus (Fig. 2d, j). The detection of stripes

starting from both outer and inner limbal zones after very long-term tracing, suggests that both limbal

zones contain LSCs.

The uniform expression pattern of markers and clonal growth dynamics implied that the outer limbal

epithelial cells might follow stochastic rules and neutral drift59. A main prediction of this approach is that

the size of the clone would grow linearly with time60.In this case, the slope of this linear trend is

proportional to the product of doubling rate and the probability of symmetric division in the epithelial

plane (Methods). Our results suggest that clone size dynamics in all regimes can be captured by a linear

growth and that the slopes are significantly different and ordered centripetally– each regime has a slope

which is about twice higher than its neighboring zone (Fig. 2f-g). Another prediction of the neutral drift

model, is that the clonal size distributions scale with their averages. That is, the size distribution of the

clone size normalized by their mean should be similar. Fig. 2h shows the probability of having a clone that

is larger than some value (one minus the cumulative probability distribution) for the normalized size

distributions. All regimes show clear scaling of their clone size for all time points. Furthermore, the neutral

drift model predicts that the number of clones should decrease inversely with the clone size (Fig. 2i). In

our case, there is a clear difference between the three different zones tested. While in the periphery the

expected inverse relationship between size and number is similar to that of neutral drift, in the outer and

inner regimes after four months the reduction in the number of clones is smaller than expected by that

model. Taken together, this data suggests that the outer limbus and inner limbus contain a population of

SCs that have similar stochastic dynamics but different doubling times.


https://doi.org/10.1101/2020.06.30.179754

7

If the outer LSCs are the most primitive undifferentiated cells positioned at the tip of the cellular hierarchy,

the inner limbus may host slightly committed LSCs. To further assess the hierarchical relations between

clusters in the corneal epithelial lineage, we plotted the clusters using linear dimensional reduction using

the Seurat algorithm for limbal/corneal epithelial clusters (clusters 3-9). This algorithm infers the

sequential changes of gene expression between clusters and thereby provides insights for the dynamics

of biological processes, in this case cell differentiation. In line with lineage tracing data, this analysis

suggested that cluster 3 (outer limbal basal cells) gives rise to cluster 4 (inner limbal basal cells) that derive

clusters 6-7 (corneal basal cells) and clusters 8-9 (corneal wing and superficial cells), while cluster 5 cells

(limbal superficial) that are indeed very similar to corneal superficial cells were positioned last (Fig. 2k).

Taken together, the combined quantitative lineage tracing and in silico analysis illuminates the dynamics

and hierarchy between corneal epithelial cell populations.

Outer and inner limbus represent segregated sub-compartments for quiescent and activated LSCs

To rigorously test LSC growth dynamics by an alternative and direct approach, we next examined the

cycling properties of outer and inner basal limbal epithelial cells by staining of Ki67 which labels cells that

are at different stages of cell division (late G1, S, G2, M). In agreement, only 5.7±3.0% of outer limbal basal

cells were Ki67+, while 16.5±3.9% of inner limbal basal cells and 19.8±4.0% of corneal peripheral basal

cells were Ki67+ (Fig. 3a-b). To corroborate this data, we performed 5-Ethynyl-2´-deoxyuridine (EdU)

nucleotide analogue incorporation assay to identify undergoing DNA replication (S-phase). As illustrated

in Fig. 3c, 2-month-old mice were intra-peritoneal injected with EdU, six hours later mice were sacrificed

and cells that were in the S-phase of cell division during the interval were identified as EdU+ cells by whole

mount staining. Expectedly, EdU incorporation by outer limbal cells was much less frequent, as compared

to that of basal epithelial cells at the inner limbus or peripheral cornea (Fig. 3d). To examine the ability of

outer limbal cells to enter active cell cycle in response to corneal injury, we performed large (2.5mm)

corneal epithelial debridement following EdU injection. Evidently, 24-hours post injury, numerous outer

(and inner) limbal cells entered cell cycle and were EdU positive. Taken together, this set of experiments

suggests that the outer LSCs are slow-cycling cells, but they can quickly enter cell cycle and participate in

corneal healing. To further examine the presence of slow cycling cells in the outer limbus, we performed

an EdU pulse-chase experiment. As described in Fig. 3e, mice were injected with EdU twice a day for 15-

days (“pulse”) followed by a “chase” period of 30-days at the absence of EdU. During the chase period the

label declines by 50% within every cell division and the label becomes undetectable after few successive

division rounds (~4), depending on assay type and sensitivity61 38. As expected, EdU+ label retaining cells

were predominantly found in the outer limbus, whereas rare cells were occasionally found in the inner

limbus (Fig. 3f), suggesting that during the 30-day chase period most quiescent outer LSCs exceeded

sufficient division rounds and lost labeling and only few which underwent fewer replications could be

detected. To validate that label retaining cells were epithelial cells, we performed co-staining of EdU+ label

retaining cells with Krt17 antibody (Fig. S1h).

The relative homogeneity in the expression of Gpha2/Ifitm3/Cd63 by the outer LSCs, together with the

absence of Ki67 associated with broad slow growth of clones in the outer limbus, implied that the vast

majority, perhaps entire, basal cell population in the outer limbal zone divides infrequently. To gain direct

evidence on cell cycle of each population and evaluate the rate of cell division in each zone we performed

a double nucleotide-analogue injection. As depicted in Fig. 3g, 1.5 hours following injection of

iododeoxyuridine (IdU, red), EdU (green) was injected, and 30 minutes later tissues were harvested,


https://doi.org/10.1101/2020.06.30.179754

8

stained and analyzed (Fig. 3h-i). As detailed in Methods, S-phase length was first calculated as the ratio

between the number of cells that were IdU+/EdU+ (cells that were engaged with, but have not completed,

DNA replication) and the number of cells that were IdU+/EdU- (cells that were in S-phase after IdU injection

but have completed DNA replication already before EdU injection), multiplied by the interval length (1.5

hours). The estimated division frequency was calculated as the ratio between the total number of cells

divided by the number of cells in S-phase, multiplied by the S-phase length62. This analysis suggests that

outer limbal basal cells divide on average every ~8 days, inner limbal basal cells divide every ~4 days while

corneal peripheral basal cells divide every ~3.5 days (Fig. 3i). Taken together, this data strongly suggests

that the outer limbus contains a predominant equipotent Krt15+/Gpha2+/Ifitm3+/Cd63+ cell population of

qLSCs while the inner limbus is occupied by a widespreas equipotent aLSCs.

Cellular quiescence is linked with reduced biochemical activity including transcription activity 16 17. Indeed,

the cells in cluster 3 (qLSCs) displayed the lowest value of RNA reads per cell (Fig. 3j). Previously, BMP was

linked with epithelial SC quiescence while WNT repressed BMP pathway and induced SC activation63 64 65 66. In agreement, cells of cluster 3 (qLSCs) preferentially expressed the BMP-regulated transcription

factors Id1/Id3 and the Wnt inhibitor, Sfrp167, while Wnt3a was higher in cluster 4 of aLSCs (Fig. 3k).

Interestingly, cluster 3 expressed Cyclin D268 69and the tumor suppressor Trp5370, both of which were

linked with growth arrest induced by various stimuli.

IFITM3 and GPHA2 marked KRT15+ human LSCs and IFITM3 supported undifferentiated state

The relevance of qLSC to cell therapy is significant, therefore, we next explored the usefulness of the newly

identified markers of murine qLSCs to human. Immunofluorescent staining revealed that KRT15, IFITM3

and GPHA2 are expressed by basal limbal epithelial cells (Fig. 4a). Similar to staining of murine epithelium

(Fig. 1-3), the labeling pattern of qLSC markers was not sporadic but rather wide, marking a large

population of basal limbal epithelial cells. Interestingly, however, GPHA2 expression was drastically down

regulated to hardly detectable levels upon cultivation of LSCs. Repression of GPHA2 (esiGPHA2) resulted

in total inhibition of GPHA2 expression (Fig 4b). This implies that GPHA2 expression depends on niche

specific signal that was absent in vitro, and that GPHA2 is tightly associated with a slow cycling feature

that is not maintained in vitro. Nevertheless, KRT15 and IFITM3 were highly expressed by undifferentiated

limbal epithelial cells in vivo and in vitro (Fig. 4c). In addition, calcium induced differentiation enhanced

KRT12 and reduced KRT15, IFITM3 and P63 (Fig. 4c). In a previous report, IFITM3 was linked with

localization to endo-membranes where it protected embryonic SCs from viral infection71. In line, IFITM3

signal was confined to cellular vesicle structures in the cytoplasm of cultivated limbal cells (Fig. 4d).

To test whether IFITM3 influences stemness and differentiation, we performed a knock down experiment.

To achieve efficient and specific knockdown, we used endoribonuclease-prepared silencing RNA (esiRNA)

where enzymatic digestion of long double stranded RNAs produces a mixture of multiple short fragments

of silencing sequences, thereby, enhancing specificity and efficiency. Efficient knock down of IFITM3 was

evident by RNA and protein levels (Fig. 4e-f). Moreover, repression of IFITM3 resulted in a significant

reduction in KRT15, and an increase in the expression of the differentiation associated corneal keratin

KRT12 (Fig. 4e-f). Taken together, this set of experiments suggests that IFITM3 positively controls the

undifferentiated state of human qLSCs, and that the newly identified qLSC markers (IFITM3, GPHA2) can

be used to identify human qLSCs.

T cells serve as niche cells for qLSC regulating cell proliferation and wound closure


https://doi.org/10.1101/2020.06.30.179754

9

The striking segregation of qLSCs to the outer limbus suggests that this cell state must be regulated by the

defined local microenvironment (niche). Interestingly, the outer limbus was clearly demarcated by well-

structured blood/lymph vasculature (Fig 5a). Thin well-organized blood vessels typically penetrated the

marginal inner limbus but never reached the corneal periphery. Lymph vessels were characteristically

present in the outer but not the inner limbus. Additionally, the limbus was highly populated with Cd45+

immune cells, amongst them, many Cd45+ that displayed dendritic cell morphology, both in the stroma

and in the epithelium (Fig. S5a). Interestingly, we have identified a population of T cells in the outer limbus,

many of which expressed the regulatory T cell markers, Cd4 and Foxp3 (Fig. 5b, S5a) and others expressed

the cytotoxic T cell marker Cd8 (Fig. S5b), suggesting that qLSCs may be regulated by T cells.

Next, we explored the limbus of two laboratory mouse strains that fail to maturate T and B lymphocytes,

namely, severe combined immunodeficiency (SCID) and non-obese diabetic SCID (NOD/SCID), and BALB/c

mice served as a control group. Similar to C57BL/6 genetic background (Fig 1-3), the outer limbus of

BALB/c mice was hallmarked by Gpha2+/Cd63+/Ifitm3+ that infrequently expressed Ki67 (Fig. 5b-d, S5a-c,

S5e). Curiously, an extensive reduction of Gpha2 and Cd63 proteins to levels that became barely

detectable was found in SCID mice (Fig. 5b-c) as well as in NOD/SCID mice (Fig. S5c), while other qLSC

markers (e.g. Ifitm3) were unaffected (Fig. S5b). Moreover, higher index of Ki67 labeling was found in the

outer limbus (as well as inner limbus) of SCID mice (Fig. 5c-d) that displayed mild epithelial thickening (Fig.

S5d). In agreement, similar defects were recapitulated in NOD/SCID mice (Fig. S5c). Since no B cells (Cd19+)

were detected in the limbus (Fig. S5b), we assumed that this phenotype is caused by the absence of T cells

in SCID mice. To further address the involvement of T cells in qLSC regulation, we explored athymic Nude-

Foxn1nu mice that lack T cell development. Here too, qLSC markers Gpha2 and Cd63 were dramatically

attenuated while Ifitm3 was maintained, strengthening the involvement of T cells in qLSC regulation (Fig.

S5e). Finally, we aimed to substantiate the crosstalk of T cells – qLSC in adulthood, and exclude the

possibility of developmental failure. To this end, we repressed the ocular immune system by topically

applying the corticosteroid Dexamethasone (Fig. S5f), or alternatively and more specifically, performed

inhibition of regulatory T cells by sub-conjunctival injection of anti-Cd25 antibody (PC61.5). Intriguingly,

6-days post antibody injection, Cd63 and Gpha2 drastically decreased whereas cell proliferation increased

(Fig. 5e-f), strongly suggesting that T cells directly regulate quiescence in the outer limbus. Similar results

were obtained following Dexamethasone treatment (Fig. S5f). Finally, to link between T cell regulation

and qLSC functionality, we performed corneal epithelial debridement and followed epithelial closure by

fluorescein dye penetration. As shown in Fig. 5g-h, immunodeficient mice displayed delayed wound

closure. Taken together, this set of experiments suggests that T cells, most likely Cd4+/Foxp3+ regulatory

T cells, serve as a niche for qLSCs and play a critical role in quiescence maintenance, control of epithelial

thickness and wound healing.

Discussion

In 1989, Cotsarelis and Lavker reported the identification of rare slow cycling cells in the limbus10. Since

then, over the last 3-decades, much attention has been given for identifying such rare cells, however, no

reliable marker has been found yet. Here we captured the signature of primitive qLSCs and propose that

these cells are more prevalent than previously estimated. We showed evidence that qLSCs, which

populate the basal layer of the outer limbus, quite uniformly express Krt15+/Gpha2+/Ifitm3+/Cd63+. The

~8 days estimated cell cycle length of qLSC fits well with quantitative lineage tracing, double nucleotide

incorporation experiments, and nucleotide pulse-chase label retention assays.


https://doi.org/10.1101/2020.06.30.179754

10

Indeed, the limbal/corneal epithelium becomes uniformly labeled following 2-weeks of nucleotide pulse38 10, i.e., suggesting that the length of cell cycle of both limbal and corneal epithelial cells is shorter than 14

days. Additionally, if assuming ~8 days for qLSCs, the interval of 30-days of chase in the absence of EdU

(Fig. 3e-f) should theoretically allow ~4 division rounds for outer qLSCs, and it is therefore not surprising

that most outer limbal basal cells lost labeling while only few retained low EdU signal. In other words, this

data fits well with abundant qLSCs model. Likewise, this model is supported by the quantitative analysis

of Ki67 staining and EdU incorporation after short pulse (Fig. 3a-d) as in both cases, the outer limbus

showed a widespread negativity for labeling. Our working model that posits abundancy of equipotent

qLSCs fits well with a stochastic SC model that was proposed to describe SC dynamics in the epidermis,

esophagus and gut epithelium23 58 72. In these tissues, abundant equipotent SCs that were shown to be

extremely fast cycling, are at the tip of the cellular hierarchy. Epidermal and esophageal SCs divide every

2-3 days while gut epithelial SCs divide once a day, much faster as compared to qLSCs that divide every 8

days. This suggests that under distinct physiological conditions, tissues display tailored regenerative

strategies for reasons of cost and benefit tradeoff.

The two new LSC populations were well-segregated into well-defined limbal sub-compartments. This

conclusion is supported by the observations that the outer and inner limbal cells differentially express

specific markers and engaged pathways (Fig. 1, S2-4), display distinct clonal growth and proliferation

dynamics (Fig. 2-3), and niche components (Fig 5). The lineage tracing experiments implies that aLSCs play

a key role in cornea replenishment under homeostasis, as most stripes emerged from this region. By

contrast, a key feature of qLSCs is their ability to rapidly exit dormant state and enter the cell cycle in

response to injury73 (Fig. 3).

The cell cycle length of qLSCs is only approximately twice longer than that of aLSCs that were estimated

to divide every ~4 days. However, this frequency of cell division is higher compared to some estimations

for other tissue-specific slow cycling SCs74 75. The reason for such a drastic difference in SC cycling

frequencies and its importance is poorly understood. In this sense, one could not exclude the possibility

that an even slower cell population co-exists in the outer limbus, however, if it does, these cells must be

very rare. Moreover, sub-fractionation of cluster 3 of qLSCs does not provide statistically relevant sub-

clusters, again, suggesting the cells in the cluster were relatively highly homogenous.

The analysis of the clone size distributions showed that they scale with the average number of clones in

all the regions. This suggests that the underlying stochastic dynamics of all the regions are similar. The

clone size dynamics are consistent with the neutral drift dynamics model and suggest that the doubling

time in the inner limbus is twice the doubling time in the outer limbal regime, which is consistent with the

cell cycle length measurements. In all regimes, the number of clones is going down with time, as expected.

However, analyzing the quantitative relation between clone size and clone number reveals a striking

difference between the outer and inner limbal regimes and the periphery. While all zones exhibit clone

size distributions that are consistent with the neutral drift model, the decrease in the inner and outer

regimes is slower than expected by this model. This saturation in clone number decrease rate might

indicate that the clonal neutral competition is limited in these areas. This could be due to the tight spatial

boundary conditions of the limbal regimes.

Our working model (Fig. 6) is in agreement with the hematopoietic, hair follicle18, neural20 and muscle19

lineages, all of which incorporate qSCs that can produce aSCs18. What are the benefits and costs of having

two distinct SC states? What is the mechanism that controls the transition between SC states? Is this


https://doi.org/10.1101/2020.06.30.179754

11

model universal or otherwise only applies for particular tissues? Which physiological constraints influence

SC division rates? Interestingly, epithelial SCs of the gut proliferate once a day76, while epidermal77 and

esophageal78 SCs divide every ~3 days. In this context, it is tempting to hypothesize that the corneal

transparency and location in the front of the eye makes it an extremely hazardous environment for SCs

that must be well guarded especially because they must constantly proliferate to replenish corneal center

with new cells. This must entail fundamental considerations for SC well-being such as localizing the SCs at

the most well-protected zone (outer limbus) and accrediting SCs with infrequent division.

The quiescence state of SCs is believed to be accompanied by reduction in DNA replication, metabolism,

gene transcription and protein translation16. Notably, these processes were associated with molecular

damage due to the production of toxic agents or errors in biosynthesis of macromolecules79 80. In line,

attenuation of these activities by SC dormancy was proposed to delay SC aging17. Moreover, the reduced

cumulating number of cell replications by quiescent SCs, may significantly attenuate the accumulation of

mutations. Surprisingly, however, qSCs employ an error prone mechanism of non-homologous end joining

to repair their DNA81 82. By contrary, frequently dividing SCs engage a non-error prone mechanism of

homologous recombination for repairing DNA breaks83, and frequent division rate was shown to be

required for the activation of repair pathways84. In line, frequently dividing SCs were identified in many

tissues including the gut22 , epidermis85,and esophagus24. These cumulating findings revised the old dogma

that considered quiescence as an integral feature of SCs. It also suggested that epithelial SCs are not

quiescent and that the high turnover of such tissues is associated by a single pool of active SCs. The present

study refines this conclusion and highlight the possibility that qSCs play an important role in corneal

epithelial lineage and potentially in other epithelial tissues that may benefit from qSC reservoir.

The regulation of quiescence is only partly understood, however, it clearly involves interactions with niche

extracellular matrix proteins, secreted factors, and niche resident cells. At the molecular level, cell cycle

inhibitors (e.g. P21, P27 and P57), tumor suppressor genes (e.g. retinoblastoma and P53) and soluble

factors (e.g. BMP4, Dkk-1, sFRP, Wif and Shh) were found to positively regulate quiescence, while

cytokines and Wnt activators (e.g. noggin) were associated with the exit from quiescence state and the

transition into active SC state18 16. The bioinformatic analysis of limbal clusters suggests that qLSC engage

Pi3K pathway, the BMP-regulated transcription factors Id1/363 64 65, the tumor suppressor gene Trp5316,

Cyclin D268 69 and the Wnt inhibitor Srf186, all of which were linked with growth arrest. Of interest, aLSCs

were enriched for TNF, WNT and Ap-1 pathways (Fig. S2-3) that were linked with proliferation or SC

activation. Interestingly, Atf3 which is a structural protein of Ap-1 complex was shown to repress Id1 and

enhance epithelial cell proliferation87. Future studies will address the mechanism by which these genes

are regulated by outer/inner limbus specific ECM factors (Fig. S3), metabolites or vasculature related

factors, or influenced by niche cells (e.g. T cells).

Likewise, future experiments will be needed to illuminate the mechanism that controls the quiescence

and the transition into active state. The maintenance of LSC specific states, and the transition between

them is most likely driven by niche cells (e.g. T cells, keratocytes, vasculature), ECM and/or biomechanical

forces. It is therefore not surprising that quiescence (as well as Gpha2 expression) is lost ex vivo, whereas

culture conditions are sub-optimal and lacking essential components of the niche. The co-localization of

T cells with qLSC strongly implies that these cells may secret cytokines to control LSC quiescence, in line

with previous studies where immune cells were identified as niche cells for epithelial SCs88. In the clinics,

corticosteroids such as dexamethasone are being widely used to prevent uncontrolled corneal


https://doi.org/10.1101/2020.06.30.179754

12

inflammation and neo-vascularisation, as these agents are considered as highly effective drugs for

nonspecific suppression of inflammation. However, it has been shown that anti-inflammatory steroids

must be used for short time as they may have adverse effects including corneal wound healing delay 89.

The awareness and recognition of such adverse effect is of particular importance given the observed

interference of T cells – qLSC crosstalk. Future studies will be needed to illuminate these interactions and

translate this knowledge into optimized treatments. Moreover, this knowledge may facilitate optimal

qLSC cultivation for curing blindness in patients that suffer from “LSC deficiency”90.

We identified a set of markers for detecting qLSCs that may allow identifying and perhaps purifying qLSCs.

What is the functional role of these proteins? Do they control quiescence and/or maintain stemness?

What controls their specific expression by qLSCs? Gpha2 (Glycoprotein hormone alpha-2) was found here

to be uniquely expressed by qLSCs but its role is still unclear. Transgenic overexpression of Gpha2 in mice

showed no gross phenotype91. Interestingly, we report a drastic reduction of Gpha2 levels in cases where

the niche was disturbed, for example, when LSCs were disconnected from the niche and grown in vitro,

or following immune cell repression or absence in vivo. In both cases, quiescence was lost, suggesting that

Gpha2 may be regulated by T cells and controls quiescent cell state. By contrast, the interferon-induced

transmembrane protein 3 (Ifitm3) was still expressed in the absence of immune cells in vivo and in vitro,

suggesting that it is regulated by other niche means, not via a T cell-induced pathway, and that it does not

control cell proliferation. Interestingly, both Ifitm3 and Cd63 reside in cellular endo membranes92.

Moreover, Ifitm3 is known for its antiviral specific functions93, providing protection against entry and

replication of several types of viruses including the COVID-19 virus71. Ifitm3 was shown to be highly

expressed in embryonic, neural and mesenchymal SCs, suggesting that it may confer anti-viral activity to

qLSCs. Interestingly, it was shown that Ifitm3 was involved in B cell related leukemia94 and control

embryonic germ cells95. Such evidence hints that ifitm3 may provide protection and control important

functions of SCs. No major developmental disorder was reported regarding ifitm3 knockout mice,

although the cornea or LSCs have not been investigated in that study96. Emb (Embigin), an adhesion

molecule that marked qLSCs (Fig. S3a), was shown to regulate hematopoietic SC quiescence and

localization97. Furthermore, Emb was linked with quiescence of hair follicle SCs55 while Gpha2 and Ifitm3

were shown to be expressed in epidermal SCs in the G0 state98. Future studies will be needed to illuminate

the role of these genes in SC homeostasis and pathology, and to test whether their manipulation can

contribute to advancing LSC therapy.

In summary, this report provides a useful atlas that uncovers the main corneal epithelial cell populations,

capturing the signature and the niche of quiescent and activated LSC states. These data open new research

avenues for studying the mechanisms of cell proliferation and differentiation as well as the applications

of LSCs in regenerative medicine.

Methods

RNA-seq protocol and analysis: Ten eyes of 2.5 months old Krt15-GFP mice were enucleated, the limbus

(with marginal conjunctiva and peripheral cornea) was dissected (~0.5 mm), tissues were pooled and

incubated in trypsin (X10 Biological Industries) for 10 min 37°C 300 μl. Supernatant was collected into 10

ml (RPMI (Biological Industries) 10% chelated fetal calf serum). Trypsinization was repeated for 10 cycles

adding fresh trypsin in each cycle. Cell suspension was centrifuged (8 min at 300g), re-suspended and

filtered using Cell strainer (Danyel Biotech) to achieve 1200 cells/μL. An RNA library was produced


https://doi.org/10.1101/2020.06.30.179754

13

according to the 10x Genomics protocol (Chromium Single Cell 3’ Library & Gel Bead Kit v2, PN-120237)

using 18000 input cells. Single cell separation was performed using the Chromium Single Cell A Chip

Kit (PN-120236). The RNAseq data was generated on Illumina NextSeq500, 150 bp paired-end reads,

high-output mode (Illumina, FC-404-2005) according to 10X recommendations read 1- 26 bp and read

2- 98bp. Cell ranger (version 2.2.0) was used for primary analysis. Transcripts were mapped to the mm10

reference genome with the addition of the eGFP gene sequence. Downstream analyses including

clustering, classifying single cells and differential expression analyses were performed using R package –

Seurat (version 2.3.4)46. Low-quality cells (>5% mitochondrial UMI counts, or <200 or >8000 expressed

genes99) and genes (detected in <3 cells) were excluded, and eventually 14,941 genes across 4,738 cells

were analyzed.

In silico analysis of non-epithelial cell markers confirmed the absence (>0.1%) of corneal endothelial cells

(Clrn1, Pvrl3, Gpc4, Slc9a7, Slc4a4, Grip1, Hrt1d, Irx2), corneal stromal keratocytes (Vim, Thy1, S1004a4),

goblet cells (Muc2, Muc5ac, Muc5b), melanocytes (Dct, Mitf, Ptgs, Tyrp1, Melana, Tyr), T cells (Cd3d,

Cd3e, Cd4, G2mb), B cells (Cd19, Cd79a, Cd79b). The only non-epithelial cells identified in our dataset

were six cells that expressed MHC II (H2-Ab1+), 4 of them were Cd11c+/Cd207+ or Cd11c+/Cd39+ dendritic-

like cells, 2 others were Cd45+/Adgre+ or Cd45+/Cd64+ macrophage-like. Analysis of pan epithelial genes

(expression of Krt14, Krt12, Cdh1, Epcam and Cldn7) confirmed that most (>99%) cells were ocular

epithelial cells. For pathway analysis, a list of differentially expressed genes between chosen clusters was

analyzed using WebGestalt56. Over-Representation Enrichment Analysis (ORA) was used for pathway

analysis with KEGG functional database.

Animals, tissue preparation and staining: Animal care was according to the ARVO Statement for the Use

of Animals in Ophthalmic and Vision Research. R26R-Brainbow2.1 (#013731), K14-CreERT2 (#005107), Krt15-

GFP (#005244) and UBC-CreERT2 (#008085) were from Jackson Laboratories (Bar Harbor, ME). To induce

Cre recombinase activity, 4 mg/day Tamoxifen (T5648, Sigma, St. Louis, MO) dissolved in corn oil was

intraperitonealy injected (200 μl) for 3-4 consecutive days, as previously reported29 30. NOD/SCID, SCID,

Nude, and BALB/c were from Envigo RMS Ltd (Israel). Dexamethasone (Sigma) was dissolved in PBS (0.5%)

and administered as drops (15 µl) on ocular surface of anesthetized (2% Isoflurane) mice, for 10 minutes

every 12 hours for 4 consecutive days. For wounding, mice were anesthetized (2% Isoflurane) and injected

intramuscular with analgesics Buprenorphine (0.03 mg/ml, 50 µl). Central corneal wounding (2 mm

diameter) was performed using an ophthalmic rotating burr (Algerbrush) under fluorescent binocular. The

wounded corneas were stained (1% fluorescein), and the wounded area was imaged and quantified (NIS-

Elements analysis D). For CD4+FoxP3+ regulatory T cell depletion, subconjunctival injection of 30 µl (250

µg) anti-Cd25 antibody (Clone:PC61, antiCd25 IL-2Rα) or rat IgG (control) (BioCell InVivoMAb)100 was

performed.

Single intraperitoneal injection of 200 μl (7.5 mg/ml) EdU (Sigma) was performed and 6 hours later tissues

were processed. For pulse-chase, EdU was injected every 12 hours for 14 consecutive days and tissues

processed after additional 30-days. Isolated corneas were fixed (2% PFA, 1 hour) and stained (Click-iT,

Invitrogen) according to the manufacturer’s instructions followed by whole mount staining protocol

(described above) for other markers staining. For the calculation of length cycle (Tc) 1.7 mg/ml IdU

(Abcam) was injected and 1.5 hours later, 7.5 mg/ml EdU was injected and tissues harvested 30 minutes

later. The calculation of length cycle (Tc) was calculated according to formula described by62


http://www.envigo.com/products-services/research-models-services/models/research-models/mice/inbred/balb-c-inbred-mice/balb-colahsd/

https://doi.org/10.1101/2020.06.30.179754

14

Ts = Ti/(Lcells

Scells) Tc = Ts/(

Scells

Pcells)

Lcells =IdU +

EdU − Scells =

IdU +

EdU + Pcells = All cells

Staining, imaging and quantifications: For paraffin sections, eyes were fixed (overnight, 4%

formaldehyde), washed briefly with phosphate buffered saline (PBS), incubated in increasing ethanol,

Xylene and paraffin (60°C) and then embedded in paraffin blocks, as previously described33. Sections (5

μm) were prepared, antigen retrival performed with unmasking solution (Vector Laboratories, H3300),

blocked (0.2% Tween20 and 0.2% gelatin, 2 hours), incubated with primary antibody (overnight, 4°C),

secondary antibodies (Invitrogen, 1:500, 2 hours) followed by 4′,6-diamidino-2-phenylindole (DAPI)

staining, and mounting (Thermo Scientific). For H&E (Sigma) staining, sections were rehydrated, incubated

with Hematoxylin (7 minutes), washed (tap water, 15 minutes), stained with Eosin (3 minutes),

dehydrated, incubated with Xylene (15 minutes) and mounted (Thermo Scientific). For frozen sections,

eyes were fixed (4 hours, 4% formaldehyde), washed briefly (PBS), incubated in 30% sucrose (overnight)

and embedded in optimal cutting temperature compound (OCT). Sections (5 μm) were fixed (4%

paraformaldehyde), permeabilized (0.1%, TritonX-100, 20 minutes), blocked (1% BSA, 1% gelatin,2.5%

Normal goat serum, 2.5% Normal donkey serum, 0.3% TritonX-100, 1 hour), incubated with primary

antibody (overnight, 4°C), secondary antibodies (1:500, 1 hour), DAPI and mounting (Thermo Scientific).

For whole mount, corneas were isolated, fixed (2% formaldehyde, 2 hours, room temperature),

permeabilized (0.5% Triton, 5 hours), blocked (0.1% TritonX-100, 2% Normal donkey serum, 2.5% BSA, 1

hour), primary antibody (overnight, 4°C on a shaker), secondary antibodies (1:500, 1 hour), followed by

DAPI, tissue flattening under a dissecting binocular and mounting (Thermo Scientific), as previously

described33. ISH was performed according to the manufacturer’s instructions for frozen tissues (LGC

Biosearch Technologies). All probe sets contained ≥ 28 oligonucleotides each (20-mer). Hybridization

mixture contained 125 nM of each oligonucleotide probe mix (Krt4 (059668, set 48), Gpha2 (024784, set

28), Atf3 (026628, set 48), Krt12 (020912, set 47)).

Staining conditions were adjusted for each antibody used for immunofluerescent staining on paraffin (IF-

P) or frozen section (IF-Fr) or wholemount cornea (IF-Wmt) or cultured cells (IF-C) or Western blot (WB).

We used the following conditions: Krt4 (Abcam ab183329, IF-Fr/IF-P/IF-Wmt 1:100), Krt8 (Abcam

ab53280, IF-Fr/IF-P/IF-Wmt 1:10), Krt6a (BioLegend 905702, IF-P 1:100), Gpha2 (Santa cruz sc-390194, IF-

Wmt 1:1000, IF-P 1:100, IF-Wmt more recommended), Cd63 (Santa cruz sc-5275, IF-P/IF-Wmt 1:100),

Ifitm3 (Abcam ab15592, IF-P/IF-Wmt/ 1:10,000, IF-Fr/IF-C/WB 1:1000), Atf3 (Santa cruz sc-188, IF-P

1:100), Mt1-2 (Abcam ab12228, IF-Wmt 1:100 *permabilization for 2 hours), Krt12 (Abcam ab185627, IF-

Fr/IF-P/IF-C/WB 1:1000), Krt15 (Santa Cruz sc-47697, IF-Fr/IF-P/IF-C/WB 1:1000), Krt17 (Cell signaling

4543S, IF-P 1:100), Krt19 (Abcam ab5265, IF-P 1:100), Krt14 (Millipore CBL197, IF-P 1:1000), P63 (Santa

Cruz sc-8431, IF-C 1:100), Cd31 (Abcam ab231436, IF-Wmt 1:100), Lyve-1 (Abcam ab14917, IF-Wmt

1:100), Cd3e (BioLegend 100311, IF-Wmt 1:100 APC conujugated), Cd8 (BioLegend 100706, IF-Wmt

1:100), Cd45 (BioLegend 103102, IF-Wmt 1:100), Cd19 (BD Pharmingen 553786, IF-Wmt 1:100), GFP

(Abcam ab13970, IF-Fr 1:1000), IdU (Abcam ab187742, IF-Wmt 1:100), Ki67 (Abcam ab16667, IF-Fr/IF-

P/Wmt 1:100), Gapdh (Cell signaling #2118, 1:1000 WB), Krt13(Abcam ab16112, IF-P 1:500)

Images were acquired using 20X/0.8 M27 Plan-Apochromat objective on LSM 880 airyscan laser scanning

confocal system (Zeiss, Oberkochen, Germany) or by Nikon Eclipse NI-E upright Microscope using Plan

Apo λ 20x objective. For computerized quantification analyses we used Nis-elements Analysis D software,


https://www.sciencedirect.com/topics/agricultural-and-biological-sciences/cornea

https://doi.org/10.1101/2020.06.30.179754

15

the outer limbus was marked by Gpha2 or Cd63 staining, the adjacent 100 µm (or entire inner limbus if

K15-GFP used) of the inner limbus was calculated, while 100 µm peripheral cornea was quantified and 5

different field were calculated from each cornea (n=3-5).

In vitro experiments: Human limbal rings from cadaveric corneas were obtained under the approval of

the local ethical committee and declaration of Helsinki. Cells cultivation, differentiation, transfection,

Western blot and real time polymerase chain reaction (qPCR) analyses were performed as previously

described101. We used esiRNA against EGFP (EHUEGFP, Sigma), IFITM3 (EHU222801, Sigma) or GPHA2

(EHU036941, Sigma) and cells were collected 5-6 days after transfection. Primers for qPCR were: GAPDH

(GCCAAGGTCATCCATGACAAC, CTCCACCACCCTGTTGCTGTA), IFITM3 (CTGGGCTTCATAGCATTCGCCT,

AGATGTTCAGGCACTTGGCGGT), KRT15 (GACGGAGATCACAGACCTGAG, CTCCAGCCGTGTCTTTATGTC),

KRT12 (TGAATGGTGAGGTGGTCTCA, TTTCAGAAGGGCAAAAAGGA).

Clone size and number analysis: As described previously27 23 60, one of the main predictions of the neutral

drift dynamics model is that the average number of cells in a given clone as a function of time is given by,

1( ) (1 )n t r t

where is the fraction of basal cells that divide, 2r is the probability for symmetric

division and is the division rate. The number of clones is expected to decrease with time as,

(0)( )

1

SS t

r t

. Thus, the relation between the clone size and clone number is given by

(0)( )

( )

SS t

n t

.

Liner fit of the clone size was performed using Matlab linear regression model. Estimating the clone size

cumulative distribution was done using empirical CDF estimation using Matlab.

Statistical analysis: Data are presented as means +/‐ SD. T-test, ANOVA (analysis of variance) followed by

Bonferroni test, or Kolmogorov-Smirnov test were performed using GraphPad Prism software, as

indicated in legends, to calculate p‐values. Differences were considered to be statistically significant from

a p‐value below 0.05.

Conflict of interest: The authors declare no conflict of interest

Acknowledgement: We thank L. Linde, S. Galili and their team for the scRNA-seq experiment, D. Aberdam

and Y. Bar Onn for critical reading. RSF received funding from European Union’s Horizon 2020 research &

innovation programme (828931), the ISRAEL SCIENCE FOUNDATION (1308/19 and 2830/20), Rappaport

Family Institute for Research in Medical Sciences, NIH-exploratory R21 (800040).

Author Contribution: A.A. and A.A.-L. were involved in conceptual and experimental design, performed

and interpreted the experiments, prepared the figures, analyzed data and participated in the manuscript

writing; N.T., S.D., L.S., S.B. performed experiments, prepared the figures and participated in the

manuscript writing; S.H.-P., W.N, J.I., G.B.-D. performed experiments and provided data; B.T., E.B. and

N.K. provided materials and participated in discussions and manuscript writings; Y.S. and R.S.-F. was

involved in conceptual and experimental design, data interpretation, and manuscript writing. All authors

approved the manuscript.

Figure Legends


https://doi.org/10.1101/2020.06.30.179754

16

Figure 1: scRNA-seq reveals corneal epithelial cell states including 2 distinct limbal epithelial cell

populations. (A-B) The limbus (with marginal conjunctiva and cornea) of 10 corneas of 2.5-month old

Krt15-GFP transgenic mice was dissected, pooled and epithelial cells were sublected to scRNA-seq

analysis. (B) t-SNE plot revealed 11 distinct clusters of cells. (C-J) Violin plots showing the expression of

differentially expressed markers of specific clusters of cells that belong to the conjunctiva (Cj.), limbus,

cornea or cells of mixed lineages that were captured during mitosis (Mito). (K-O) In situ hybridization (ISH)

(K) or immunofluorescent staining (IF) (L) or whole mount staining (M-O) of the indicated markers

performed on cornea tissue sections of 2-month old mice. The conjunctiva (Cj.) limbal compartments

(outer or inner) and corneal periphery (Peri.) are indicated. (P) Size analysis (mean ± standard deviation)

of the different limbal sub-compartments. Scale bars was 50 μm (A-M, O-P) or 300 μm (N). Nuclei were

counter stained by DAPI. Abbreviations: Cj., Conjunctiva; Peri., Periphery.

Fig 2: Quantitative “Confetti” lineage tracing unravels the dynamics of outer and inner LSCs. Lineage

tracing was induced by tamoxifen injection in 2-month-old UBC-Cre; Brainbow2.1 mice. Confetti-positive

clones were analyzed at the indicated time points post-induction. Typical confocal images of the limbal

zones are shown in (A-B) and (D), and an entire cornea is shown in (C). The same pictures shown here in

A-B, are also shown together with Gpha2 staining in Fig. S4D-E. (E) Scatter plot of the clone size

distributions for the outer, inner, and periphery regions at different time points. (F) Clone size evolution

in time for the different colonial regions. Red dots denote the average clone size and the black line

indicates the linear model that fits the data. (G) The clonal effective growth rate, as estimated from the

linear fit. Error bars are 95% confidence interval (CI). Note that the 95% CI does not overlap. (H) One minus

the cumulative distribution function of the clone size divided by the mean clone size. The scaled

distributions collapse onto the same curve (compare to Fig. S4G, which shows the non-scaled

distributions). (I) The normalized number of clones as a function of different time points in different

regions. The dotted line denotes the inverse relation between clone size and clone number as expected

from the neutral drift model. (J) The percentage of stripes that emerged from the outer or inner limbus.

(K) PCA plot predicts the differentiation process across clusters. Scale bars are 100 μm and 50 μm for (C).

Statistical significance was calculated using the Kolmogorov-Smirnov test. (*, p-value < 0.05; ** p-value

<0.005). Abbreviations: Conj., Conjunctiva; Peri., Periphery.

Fig 3: Proliferation analysis of slow cycling and frequently dividing LSCs. Adult 2-3 month old mice were

used for all experiments. The limbal region markers in wholemount corneas were defined by Gpha2/K15-

GFP, nuclei were detected by DAPI counter staining (A, D, F, H) while Ki67+ cells were stained (A) and

quantified (B). Schematic illustration of the wound experiment (C). Corneal epithelial (CE) wound was

performed and 24-hours later, EdU was injected and 6 hours later, cells in S-phase were identified (EdU+)

in wounded or uninjured controls. Typical confocal image of whole mount immunostaining shown in (D).

(E) Schematic illustration of pulse-chase experiments performed to identify slow cycling EdU+ label

retaining cells, and typical confocal image of whole mount staining is shown in (F). (G) Schematic

illustration of double nucleotide labeling experiments performed to estimate division frequency of cell

populations and typical confocal image of whole mount staining is shown in (H), and calculated estimation

of division rates are shown in (I). (J) Violin plot diagram of unique molecular identifiers (UMI) RNA reads

per cell in each cluster. (K) Violin plot showing the expression of the indicated genes. Statistical

significance was calculated using One-way Anova test followed by Bonferroni test (*, p-value<0.05). Data

represent mean ± standard deviation, Abbreviations: Peri., Periphery; CjB, Conjunctival Basal; CjS,


https://www.sciencedirect.com/topics/agricultural-and-biological-sciences/tamoxifen

https://www.sciencedirect.com/topics/immunology-and-microbiology/immunostaining

https://doi.org/10.1101/2020.06.30.179754

17

Conjunctival Suprabasal; qLSC, quiescent limbal stem cell; aLSC, activated limbal stem cell; LS, limbal

superficial; CB1, corneal basal 1; CB2, corneal basal 2; CW, corneal wing; CS, corneal superficial. Scale

bars, 50 μm.

Figure 4: GPHA2 and IFITM3 marked qLSCs while IFITM3 supported undifferentiated state in vitro. (A)

Human cornea frozen sections were subjected to immunofluorescence staining of indicated markers. (B)

Human Limbal epithelial cells were transfected with non-specific control esiCtl and endoribonuclase

prepared small interfering RNA against GPHA2 (esiGPHA2), cells were immunostained for GPHA2. (C) Human

limbal epithelial cells were cultured and maintained at low calcium (Day 0) or induced to differentiate (Day 7)

and stained for the indicated markers. (D) Enlargement of IFITM3 staining shown in (C) (day 0). (E-F)

Undifferentiated cells were transfected with esIFITM3 or esiCtl. The expression of the indicated markers was

examined 4-5 days later, by quantitative real-time polymerase chain reaction (E) and immunofluerscent

staining (F). Nuclei were detected by DAPI counter staining (A-D, F). Scale bars are 50 μm or 10 μm (D).

Statistical significance was calculated using t- test (*, p-value<0.05).

Figure 5: T cells regulate qLSC proliferation and response to wound stimulus. (A) Whole-

mount immunostaining of corneas was performed to label blood (Cd31) and lymph (Lyve-1) vessels of 2-

3 months old Krt15-GFP mice. (B-C) Whole-mount immunostaining of corneas of immunodeficient mice

(SCID) or controls to identify qLSCs (Cd63+ or Gpha2+) or T cell populations (Cde3+ and Cd4+, or FoxP3-GFP+

transgene) or dividing cells (Ki67+). (D) Quantification of Ki67 expression in different limbal zones. (E) Six-

days post subconjunctival injection of anti-Cd25 antibody (inhibits regulatory T cells) to Krt15-GFP mice,

whole mount immunostaining of the indicated qLSC markers was performed. (F) Quantification of EdU

expression in different limbal zones. (G-H) Corneal epithelial debridement was performed in 2-month old

mice and fluorescein dye stain was performed to follow wound closure. Typical images are shown in (G)

and quantification in (H). Nuclei were detected by DAPI counter staining (C, E). Scale bars are 50 μm.

Statistical significance was calculated using t- test (*, p-value<0.05). Abbreviations: Cj., Conjunctiva; Peri.,

Periphery.

Figure 6: Working hypothesis. Schematic illustration of our working model, depicting the anatomy of the

limbal sub-compartments and LSC populations. We propose that the outer limbus is occupied by

widespread qLSCs that play an important role as a SC reservoir for wound repair, barrier maintenance and

corneal replenishment. The inner limbus contains abundant aLSCs that are actively engaged in corneal

replenishment. The maintenance and differentiation of LSC populations is regulated by niche components

including blood and lymph vasculature, stromal cells, and particularly T cells that control qLSC

proliferation.

Figure S1: Exploration and validation of the identity of cell populations. Corneas of adult 2-3 months old

Krt15-GFP mice were used for analysis. (A) Whole-mount immunostaining of Krt8 (upper panel) and bright

field image of the same zone (lower panel). (B) Hierarchical clustering of gene expression data from

scRNA-seq. (C) Violin plots showing the expression of the indicated keratin genes each cluster. (D)

Heatmap presentation showing the average expression of the indicated cell cycle genes by each cluster.

Immunostaining of wholemount cornea (E-F, H) or cornea sections (G) using antibodies against the

indicated markers. The dashed squares shown in (E) are shown (DAPI only) at higher magnification in (F).

(H) EdU pulse/chase experiment described in Fig. 3e-f that was performed to detect slow cycling cells. The

square zone on the right shows enlarged view of the dashed region on the left. Arrow shows






https://doi.org/10.1101/2020.06.30.179754

18

EdU+/Krt17+ limbal epithelial cells at the outer limbus. Scale bars are 50 μm. Abbreviations: Conj.,

Conjunctiva; Peri., Periphery.

Figure S2: Prediction of pathways enriched in clusters 3 or 4. In silico analysis performed to predict

pathways that were enriched in cluster 3 or 4 (in comparison to all other clusters) using the Webgestalt

algorithm.

Figure S3: Differential expression of selected families of genes. Heatmap presentation shows the average

expression of the indicated genes across clusters. Genes enriched in cluster 3 or cluster 4 are shown in A

and B, respectively, and selected family-related genes are shown in (C).

Figure S4: Comparative analysis of proliferation and dynamic limbal epithelial cell populations. (A)

Genes that are differentially expressed between clusters 3 and 4 were identified by WebGestalt/KEGG

enrichment analysis. (B-C) Schematic representation of R26R-Confetti; UBC-CreERT2 double transgenic

mice (B) and the potential outcome of tamoxifen induction of Cre recombinase (C). (D-E) Lineage tracing

was induced by tamoxifen injection in 2-month old UBC-Cre; Brainbow2.1 mice that were sacrificed at the

indicated times post induction, corneas were Immunostaining for Gpha2 and typical confocal pictures are

shown (the same pictures without Gpha2 channel are shown in Fig. 1A-B). (F) The number of clones in the

same area as a function of time for different regions. (G) One minus the cumulative distribution function

of the clone size for different time points in different regions (compare to Fig 2H which shows the scaled

distributions). Scale bars, 50 μm. Abbreviations: Conj., Conjunctiva; Peri., Periphery.

Figure S5: Role of T cells as qLSC niche cells. Whole-mount immunostaining of immunodeficient mice

(SCID (A-B), NOD SCID (C), and Nude (E)) and their controls (BALB/c). Tissues were stained for the indicated

markers and confocal images were purchased. Z-stack confocal pictures of the basal epithelial layer

(epithelium) or anterior stroma (stroma) is shown in (A). (D) H&E staining of the corneal epithelium of

immuneodefficient (SCID) mice and their control showing mild epithelial thickening. (F) The ocular surface

of adult mice was topically treated with dexamethasone (or vehicle as control) for 4 days. Confocal images

of corneas stained with the indicated antibodies are shown. Scale bars are 50 μm. Abbreviations: Peri.,

Periphery.

Reference

1. Clevers, H. & Watt, F. M. Defining Adult Stem Cells by Function, not by Phenotype. Annu. Rev. Biochem. 87, 1015–1027 (2018).

2. Blanpain, C., Horsley, V. & Fuchs, E. Epithelial stem cells: turning over new leaves. Cell 128, 445–458 (2007).

3. De Luca, M. et al. Advances in stem cell research and therapeutic development. Nat. Cell Biol. 21, 801–811 (2019).

4. Goodell, M. A., Nguyen, H. & Shroyer, N. Somatic stem cell heterogeneity: Diversity in the blood, skin and intestinal stem cell compartments. Nat. Rev. Mol. Cell Biol. 16, 299–309 (2015).

5. Post, Y. & Clevers, H. Defining Adult Stem Cell Function at Its Simplest: The Ability to Replace Lost Cells through Mitosis. Cell Stem Cell 25, 174–183 (2019).

6. Morrison, S. J., Uchida, N. & Weissman, I. L. The biology of hematopoietic stem cells. Annu. Rev. Cell Dev. Biol. 11, 35–71 (1995).

7. Orkin, S. H. & Zon, L. I. Hematopoiesis: an evolving paradigm for stem cell biology. Cell 132, 631–644 (2008).


https://www.sciencedirect.com/topics/agricultural-and-biological-sciences/tamoxifen


https://doi.org/10.1101/2020.06.30.179754

19

8. Suda, T., Suda, J. & Ogawa, M. Disparate differentiation in mouse hemopoietic colonies derived from paired progenitors. Proc. Natl. Acad. Sci. U. S. A. 81, 2520–2524 (1984).

9. Weissman, I. L. Stem cells: units of development, units of regeneration, and units in evolution. Cell 100, 157–168 (2000).

10. Cotsarelis, G., Cheng, S. Z., Dong, G., Sun, T. T. & Lavker, R. M. Existence of slow-cycling limbal epithelial basal cells that can be preferentially stimulated to proliferate: Implications on epithelial stem cells. Cell 57, 201–209 (1989).

11. Cheshier, S. H., Morrison, S. J., Liao, X. & Weissman, I. L. In vivo proliferation and cell cycle kinetics of long-term self-renewing hematopoietic stem cells. Proc. Natl. Acad. Sci. U. S. A. 96, 3120–3125 (1999).

12. Suh, H. et al. In Vivo Fate Analysis Reveals the Multipotent and Self-Renewal Capacities of Sox2+ Neural Stem Cells in the Adult Hippocampus. Cell Stem Cell 1, 515–528 (2007).

13. Cotsarelis, G., Sun, T. T. & Lavker, R. M. Label-retaining cells reside in the bulge area of pilosebaceous unit: implications for follicular stem cells, hair cycle, and skin carcinogenesis. Cell 61, 1329–1337 (1990).

14. Potten, C. S., Booth, C. & Pritchard, D. M. The intestinal epithelial stem cell: the mucosal governor. Int. J. Exp. Pathol. 78, 219–243 (1997).

15. Shinin, V., Gayraud-Morel, B., Gomès, D. & Tajbakhsh, S. Asymmetric division and cosegregation of template DNA strands in adult muscle satellite cells. Nat. Cell Biol. 8, 677–687 (2006).

16. Cho, I. J. et al. Mechanisms, Hallmarks, and Implications of Stem Cell Quiescence. Stem cell reports 12, 1190–1200 (2019).

17. Tümpel, S. & Rudolph, K. L. Quiescence: Good and Bad of Stem Cell Aging. Trends Cell Biol. 29, 672–685 (2019).

18. Li, L. & Clevers, H. Coexistence of quiescent and active adult stem cells in mammals. Science 327, 542–545 (2010).

19. Brack, A. S. & Rando, T. A. Tissue-specific stem cells: lessons from the skeletal muscle satellite cell. Cell Stem Cell 10, 504–514 (2012).

20. Wang, Y.-Z., Plane, J. M., Jiang, P., Zhou, C. J. & Deng, W. Concise review: Quiescent and active states of endogenous adult neural stem cells: identification and characterization. Stem Cells 29, 907–912 (2011).

21. Fuchs, E. The tortoise and the hair: slow-cycling cells in the stem cell race. Cell 137, 811–819 (2009).

22. Barker, N. et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature 449, 1003–1007 (2007).

23. Clayton, E. et al. A single type of progenitor cell maintains normal epidermis. Nature 446, 185–189 (2007).

24. DeWard, A. D., Cramer, J. & Lagasse, E. Cellular heterogeneity in the mouse esophagus implicates the presence of a nonquiescent epithelial stem cell population. Cell Rep. 9, 701–711 (2014).

25. Colom, B. & Jones, P. H. Clonal analysis of stem cells in differentiation and disease. Curr. Opin. Cell Biol. 43, 14–21 (2016).

26. Park, S., Greco, V. & Cockburn, K. Live imaging of stem cells: answering old questions and raising new ones. Curr. Opin. Cell Biol. 43, 30–37 (2016).

27. Klein, A. M., Doupé, D. P., Jones, P. H. & Simons, B. D. Kinetics of cell division in epidermal maintenance. Phys. Rev. E. Stat. Nonlin. Soft Matter Phys. 76, 21910 (2007).

28. Secker, G. A. & Daniels, J. T. Corneal epithelial stem cells: deficiency and regulation. Stem Cell Rev. 4, 159–168 (2008).

29. Amitai-Lange, A. et al. Lineage tracing of stem and progenitor cells of the murine corneal epithelium. Stem Cells 33, 230–239 (2015).


https://doi.org/10.1101/2020.06.30.179754

20

30. Amitai-Lange, A. et al. A Method for Lineage Tracing of Corneal Cells Using Multi-color Fluorescent Reporter Mice. J. Vis. Exp. e53370 (2015). doi:10.3791/53370

31. Di Girolamo, N. et al. Tracing the fate of limbal epithelial progenitor cells in the murine cornea. Stem Cells 33, 157–169 (2015).

32. Dorà, N. J., Hill, R. E., Collinson, J. M. & West, J. D. Lineage tracing in the adult mouse corneal epithelium supports the limbal epithelial stem cell hypothesis with intermittent periods of stem cell quiescence. Stem Cell Res. 15, 665–677 (2015).

33. Nasser, W. et al. Corneal-Committed Cells Restore the Stem Cell Pool and Tissue Boundary following Injury. Cell Rep. 22, 323–331 (2018).

34. Park, M. et al. Peripheral (not central) corneal epithelia contribute to the closure of an annular debridement injury. Proc. Natl. Acad. Sci. U. S. A. 116, 26633–26643 (2019).

35. Ordonez, P. & Di Girolamo, N. Limbal epithelial stem cells: role of the niche microenvironment. Stem Cells 30, 100–107 (2012).

36. Dua, H. S., Shanmuganathan, V. A., Powell-Richards, A. O., Tighe, P. J. & Joseph, A. Limbal epithelial crypts: a novel anatomical structure and a putative limbal stem cell niche. Br. J. Ophthalmol. 89, 529–532 (2005).

37. Gouveia, R. M. et al. Assessment of corneal substrate biomechanics and its effect on epithelial stem cell maintenance and differentiation. Nat. Commun. 10, 1496 (2019).

38. Sartaj, R. et al. Characterization of slow cycling corneal limbal epithelial cells identifies putative stem cell markers. Sci. Rep. 7, 3793 (2017).

39. Ebato, B., Friend, J. & Thoft, R. A. Comparison of limbal and peripheral human corneal epithelium in tissue culture. Invest. Ophthalmol. Vis. Sci. 29, 1533–1537 (1988).

40. Pellegrini, G. et al. Location and clonal analysis of stem cells and their differentiated progeny in the human ocular surface. J. Cell Biol. 145, 769–782 (1999).

41. Yoshida, S. et al. Cytokeratin 15 can be used to identify the limbal phenotype in normal and diseased ocular surfaces. Invest. Ophthalmol. Vis. Sci. 47, 4780–4786 (2006).

42. Barbaro, V. et al. C/EBPdelta regulates cell cycle and self-renewal of human limbal stem cells. J. Cell Biol. 177, 1037–1049 (2007).

43. Ksander, B. R. et al. ABCB5 is a limbal stem cell gene required for corneal development and repair. Nature 511, 353–357 (2014).

44. de Paiva, C. S., Chen, Z., Corrales, R. M., Pflugfelder, S. C. & Li, D.-Q. ABCG2 transporter identifies a population of clonogenic human limbal epithelial cells. Stem Cells 23, 63–73 (2005).

45. Pellegrini, G. et al. p63 identifies keratinocyte stem cells. Proc. Natl. Acad. Sci. U. S. A. 98, 3156–3161 (2001).

46. Butler, A., Hoffman, P., Smibert, P., Papalexi, E. & Satija, R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat. Biotechnol. 36, 411–420 (2018).

47. Kivelä, T. & Uusitalo, M. Structure, development and function of cytoskeletal elements in non-neuronal cells of the human eye. Prog. Retin. Eye Res. 17, 385–428 (1998).

48. Kasper, M., Moll, R., Stosiek, P. & Karsten, U. Patterns of cytokeratin and vimentin expression in the human eye. Histochemistry 89, 369–377 (1988).

49. Swamynathan, S. et al. Corneal expression of SLURP-1 by age, sex, genetic strain, and ocular surface health. Investig. Ophthalmol. Vis. Sci. 56, 7888–7896 (2015).

50. Stepp, M. A. Corneal integrins and their functions. Exp. Eye Res. 83, 3–15 (2006). 51. Joyce, N. C., Meklir, B., Joyce, S. J. & Zieske, J. D. Cell cycle protein expression and proliferative

status in human corneal cells. Invest. Ophthalmol. Vis. Sci. 37, 645–655 (1996). 52. Yoshida, Y., Ban, Y. & Kinoshita, S. Tight junction transmembrane protein claudin subtype

expression and distribution in human corneal and conjunctival epithelium. Invest. Ophthalmol. Vis. Sci. 50, 2103–2108 (2009).


https://doi.org/10.1101/2020.06.30.179754

21

53. King, I. A. et al. Hierarchical expression of desmosomal cadherins during stratified epithelial morphogenesis in the mouse. Differentiation. 62, 83–96 (1997).

54. Brandner, J. M. et al. Organization and formation of the tight junction system in human epidermis and cultured keratinocytes. Eur. J. Cell Biol. 81, 253–263 (2002).

55. Morris, R. J. et al. Capturing and profiling adult hair follicle stem cells. Nat. Biotechnol. 22, 411–417 (2004).

56. Zhang, B., Kirov, S. & Snoddy, J. WebGestalt: an integrated system for exploring gene sets in various biological contexts. Nucleic Acids Res. 33, W741-8 (2005).

57. Maurizi, E. et al. A novel role for CRIM1 in the corneal response to UV and pterygium development. Exp. Eye Res. 179, 75–92 (2019).

58. Snippert, H. J. et al. Intestinal crypt homeostasis results from neutral competition between symmetrically dividing Lgr5 stem cells. Cell 143, 134–144 (2010).

59. Klein, A. M. & Simons, B. D. Universal patterns of stem cell fate in cycling adult tissues. Development 138, 3103–3111 (2011).

60. Jones, K. B. et al. Quantitative Clonal Analysis and Single-Cell Transcriptomics Reveal Division Kinetics, Hierarchy, and Fate of Oral Epithelial Progenitor Cells. Cell Stem Cell 24, 183-192.e8 (2019).

61. West, J. D., Mort, R. L., Hill, R. E., Morley, S. D. & Collinson, J. M. Computer simulation of neutral drift among limbal epithelial stem cells of mosaic mice. Stem Cell Res. 30, 1–11 (2018).

62. Martynoga, B., Morrison, H., Price, D. J. & Mason, J. O. Foxg1 is required for specification of ventral telencephalon and region-specific regulation of dorsal telencephalic precursor proliferation and apoptosis. Dev. Biol. 283, 113–127 (2005).

63. Mira, H. et al. Signaling through BMPR-IA regulates quiescence and long-term activity of neural stem cells in the adult hippocampus. Cell Stem Cell 7, 78–89 (2010).

64. Genander, M. et al. BMP signaling and its pSMAD1/5 target genes differentially regulate hair follicle stem cell lineages. Cell Stem Cell 15, 619–633 (2014).

65. Manrique, I. et al. The inhibitor of differentiation isoform Id1b, generated by alternative splicing, maintains cell quiescence and confers self-renewal and cancer stem cell-like properties. Cancer Lett. 356, 899–909 (2015).

66. Kishimoto, J., Burgeson, R. E. & Morgan, B. A. Wnt signaling maintains the hair-inducing activity of the dermal papilla. Genes Dev. 14, 1181–1185 (2000).

67. Lim, X., Tan, S. H., Yu, K. Lou, Lim, S. B. H. & Nusse, R. Axin2 marks quiescent hair follicle bulge stem cells that are maintained by autocrine Wnt/β-catenin signaling. Proc. Natl. Acad. Sci. U. S. A. 113, E1498-505 (2016).

68. Meyyappan, M., Wong, H., Hull, C. & Riabowol, K. T. Increased expression of cyclin D2 during multiple states of growth arrest in primary and established cells. Mol. Cell. Biol. 18, 3163–3172 (1998).

69. Salpeter, S. J. et al. Glucose regulates cyclin D2 expression in quiescent and replicating pancreatic β-cells through glycolysis and calcium channels. Endocrinology 152, 2589–2598 (2011).

70. Liu, Y. et al. p53 regulates hematopoietic stem cell quiescence. Cell Stem Cell 4, 37–48 (2009). 71. Wu, X. et al. Intrinsic Immunity Shapes Viral Resistance of Stem Cells. Cell 172, 423-438.e25

(2018). 72. Giroux, V. et al. Long-lived keratin 15+ esophageal progenitor cells contribute to homeostasis and

regeneration. J. Clin. Invest. 127, 2378–2391 (2017). 73. Gadye, L. et al. Injury Activates Transient Olfactory Stem Cell States with Diverse Lineage

Capacities. Cell Stem Cell 21, 775-790.e9 (2017). 74. Wilson, A. et al. Hematopoietic stem cells reversibly switch from dormancy to self-renewal during

homeostasis and repair. Cell 135, 1118–1129 (2008).


https://doi.org/10.1101/2020.06.30.179754

22

75. Waghmare, S. K. et al. Quantitative proliferation dynamics and random chromosome segregation of hair follicle stem cells. EMBO J. 27, 1309–1320 (2008).

76. Ohlstein, B. & Spradling, A. The adult Drosophila posterior midgut is maintained by pluripotent stem cells. Nature 439, 470–474 (2006).

77. Sada, A. et al. Defining the cellular lineage hierarchy in the interfollicular epidermis of adult skin. Nat. Cell Biol. 18, 619–631 (2016).

78. Croagh, D., Thomas, R. J. S., Phillips, W. A. & Kaur, P. Esophageal stem cells--a review of their identification and characterization. Stem Cell Rev. 4, 261–268 (2008).

79. Jackson, S. P. & Bartek, J. The DNA-damage response in human biology and disease. Nature 461, 1071–1078 (2009).

80. Vitale, I., Manic, G., De Maria, R., Kroemer, G. & Galluzzi, L. DNA Damage in Stem Cells. Mol. Cell 66, 306–319 (2017).

81. Mohrin, M. et al. Hematopoietic stem cell quiescence promotes error-prone DNA repair and mutagenesis. Cell Stem Cell 7, 174–185 (2010).

82. Sotiropoulou, P. A. et al. Bcl-2 and accelerated DNA repair mediates resistance of hair follicle bulge stem cells to DNA-damage-induced cell death. Nat. Cell Biol. 12, 572–582 (2010).

83. Cheung, T. H. & Rando, T. A. Molecular regulation of stem cell quiescence. Nat. Rev. Mol. Cell Biol. 14, 329–340 (2013).

84. Iyama, T. & Wilson, D. M. 3rd. DNA repair mechanisms in dividing and non-dividing cells. DNA Repair (Amst). 12, 620–636 (2013).

85. Blanpain, C. & Fuchs, E. Epidermal homeostasis: a balancing act of stem cells in the skin. Nat. Rev. Mol. Cell Biol. 10, 207–217 (2009).

86. Tumbar, T. et al. Defining the epithelial stem cell niche in skin. Science 303, 359–363 (2004). 87. Kang, Y., Chen, C.-R. & Massagué, J. A self-enabling TGFbeta response coupled to stress signaling:

Smad engages stress response factor ATF3 for Id1 repression in epithelial cells. Mol. Cell 11, 915–926 (2003).

88. Naik, S., Larsen, S. B., Cowley, C. J. & Fuchs, E. Two to Tango: Dialog between Immunity and Stem Cells in Health and Disease. Cell 175, 908–920 (2018).

89. Petroutsos, G., Guimaraes, R., Giraud, J. P. & Pouliquen, Y. Corticosteroids and corneal epithelial wound healing. Br. J. Ophthalmol. 66, 705–708 (1982).

90. Pellegrini, G. & De Luca, M. Eyes on the prize: limbal stem cells and corneal restoration. Cell Stem Cell 15, 121–122 (2014).

91. Okada, S. L. et al. A glycoprotein hormone expressed in corticotrophs exhibits unique binding properties on thyroid-stimulating hormone receptor. Mol. Endocrinol. 20, 414–425 (2006).

92. Muñoz-Moreno, R. et al. Antiviral Role of IFITM Proteins in African Swine Fever Virus Infection. PLoS One 11, e0154366 (2016).

93. Diamond, M. S. & Farzan, M. The broad-spectrum antiviral functions of IFIT and IFITM proteins. Nat. Rev. Immunol. 13, 46–57 (2013).

94. Evans, S. S., Lee, D. B., Han, T., Tomasi, T. B. & Evans, R. L. Monoclonal antibody to the interferon-inducible protein Leu-13 triggers aggregation and inhibits proliferation of leukemic B cells. Blood 76, 2583–2593 (1990).

95. Kolasa, A., Misiakiewicz, K., Marchlewicz, M. & Wiszniewska, B. The generation of spermatogonial stem cells and spermatogonia in mammals. Reprod. Biol. 12, 5–23 (2012).

96. Lange, U. C. et al. Normal germ line establishment in mice carrying a deletion of the Ifitm/Fragilis gene family cluster. Mol. Cell. Biol. 28, 4688–4696 (2008).

97. Silberstein, L. et al. Embigin Regulates HSPC Homing and Quiescence and Acts As a Cell Surface Marker for a Niche Factor-Enriched Subset of Osteolineage Cells. Blood 126, 663 (2015).

98. Dekoninck, S. et al. Defining the Design Principles of Skin Epidermis Postnatal Growth. Cell 181,


https://doi.org/10.1101/2020.06.30.179754

23

604-620.e22 (2020). 99. Ilicic, T. et al. Classification of low quality cells from single-cell RNA-seq data. Genome Biol. 17, 29

(2016). 100. Setiady, Y. Y., Coccia, J. A. & Park, P. U. In vivo depletion of CD4+FOXP3+ Treg cells by the PC61

anti-CD25 monoclonal antibody is mediated by FcgammaRIII+ phagocytes. Eur. J. Immunol. 40, 780–786 (2010).

101. Bhattacharya, S. et al. SOX2 Regulates P63 and Stem/Progenitor Cell State in the Corneal Epithelium. Stem Cells 37, 417–429 (2019).


https://doi.org/10.1101/2020.06.30.179754

3

2

1

4

8

9

5

67

10

11

Cj. Limbus Peri.

Cells

Fig 1: scRNA-seq reveals corneal epithelial cell states including 2 distinct limbal epithelial cell populations

A

Cj. Outer Inner Peri.

K4

Atf3

Krt12

Krt15-GFP

Krt15

Mt1-2

Atf3

Krt4

Krt12

Ifitm3

Cd63

Krt8

Krt4

Gpha2

Krt1

9Kr

t4Kr

t17

Atf

3So

cs3

Mt1

Cd

63

Ifit

m3

Gp

ha2

B C

E

G

K M

N

1 2 3 4 5 6 7 8 9 1011

1 2 3 4 5 6 7 8 9 1011 1 2 3 4 5 6 7 8 9 1011

L

ISH on sections

IF on sections

IF on wholemount



Krt8

K15-GFP

Mt1-2

K12

Gpha2

Krt4

Cd63

Krt15GFP

Ifitm3

H

Slu

rp1

1 2 3 4 5 6 7 8 9 1011

O

D

F

Cld

n4

Cd

kn1

a (p

21

)D

sg1

a

Supra-basal cell markers

Ccn

d1

(C

yclin

D1

)

Basal cell markers

Itgb

1It

gb4

1 2 3 4 5 6 7 8 9 10111 2 3 4 5 6 7 8 9 1011

Putative SC markers

Krt1

5Kr

t14

K1

5-G

FP

I

1 2 3 4 5 6 7 8 9 1011

J

Ccn

a2

(Cyc

lin A

2)

Top

2a

Mki

67

Mitosis markers

1 2 3 4 5 6 7 8 9 1011

InnerOuter Peri.Outer Inner Peri.

IF on wholemount

Outer limbus Inner limbus Krt15-GFP- region Krt15-GFP+ region

106 ± 81 µm 60 ± 8 µm 179 ± 61 µm

P

Gpha2Krt15-GFP

Gp

ha2

Krt

15

-GFP

Cornea Cj. Limbus Mito.Cornea Cj. Limbus Mito.



Inner limbus markersOuter limbus markers

Cornea markersConjunctiva (Cj.) markers


Pp

p1

r3c

Krt1

2


https://doi.org/10.1101/2020.06.30.179754

Outer Inner Peri.

50

100

150

200

250

3

4

67

89

5

Fig 2: Quantitative “Confetti” lineage tracing unravels the dynamics of outer and inner LSCs

A

J

K

B

1 m

on

th

Outer Inner Peri.

RFP YFP CFP

2 m

on

ths

RFP YFP CFP

Outer Inner Peri.

Outer limbus origin Inner limbus origin

3.4 ± 1.5 96.6 ± 1.4

4 m

on

ths

RFP YFP CFP

C

Clo

ne

gro

wth

rat

e [c

ells

/mo

nth

]

1 -

CD

F

Clone size / <clone size>

No

rmal

ized

# o

f cl

on

es

RFPK15-GFP

4 m

on

ths

4 m

on

ths

4 m

on

ths

Outer Inner Peri.

RFPGpha2

RFPGpha2 YFP

Inner Peri.

Outer Inner Peri.

Outer

Time post-label (months)

**

**

E

G1 2 4

50

100

150

200

250

**

***

**

***

Nu

mb

er o

f ce

lls p

er c

lon

e

F

1 2 4 1 2 4 1 2 4Time post-label (months)

Outer Inner Peri.

Outer

Inner

Peri.

1 Month

2 Month

4 Month

OuterInnerPeri.

Peri.InnerOuter

Outer Inner Peri.

Nu

mb

er o

f ce

lls p

er c

lon

e

Time post-label (months)

D

H I


https://doi.org/10.1101/2020.06.30.179754

0 15 Weeks45

AnalysisEdU

0 6 hours

AnalysisEdU

-24

CE wound

Peri.Outer Inner K

rt1

5-G

FPK

i67

Gp

ha2

Krt

15

-GFP

EdU

Peri.Outer Inner

EdU

Gp

ha2

Krt

15

-GFP

EdU

EdU

Gp

ha2

Wo

un

dC

on

tro

l

Peri.Outer Inner

C

D

Outer Inner Peri.

% of Ki67+ 5.7±3.0 16.5±3.9 19.8±4.0

UM

I RN

A r

ead

s p

er c

ell

10.712.7 12.8 8.1 10.7 10.1 10.2 13.213.1 12.5 14.4

Fig 3: Proliferation analysis of slow cycling and frequently dividing LSCs

A

B

F

I Outer Inner Peri.

Division rate (days) 8.1±0.7 4.2±1.0 3.4±0.2

0 Hours

IdU EdU

1.5 2

analysis

E

H

J

Id3

Id1

Wn

t3a

Sfrp

1

Trp

53

Ccn

d2

(Cyc

lin D

2)

Peri.Outer Inner

IdU

EdU

G

K

Gp

ha2

Krt

15

-GFP


https://doi.org/10.1101/2020.06.30.179754

Figure 4: Gpha2 and Ifitm3 marked qLSCs while Ifitm3 supported undifferentiated state in vitro

IFIT

M3

D

KR

T12

KR

T15

IFIT

M3

Limbus Center

GP

HA

2

A

C

KR

T12

Day 7Day 0

IFIT

M3

50µl

P6

3K

RT1

5

esiCtl esiIFITM3

IFIT

M3

KR

T15

KR

T12

E

0

1

2

Rel

ativ

e ex

pre

ssio

n

IFITM3 KRT15 KRT12

*

*

esiCtl

esiIFITM3

*

esiCtl esiGPHA2B

GP

HA

2

F


https://doi.org/10.1101/2020.06.30.179754

Figure 5: T cells regulate qLSC proliferation and response to wound stimulus

*

*

Outer Inner Peri.

% o

f K

i67

+ ce

lls

BALB/c SCID

0

5

10

15

20

D

D0 D1 D3

SCID

BA

LB/c

G

% o

f w

ou

nd

clo

sure

d a

rea

D0 D1 D3

0

20

40

80

100

60

H

*

AOuter InnerCj. Peri.

Ctl CD25 inhibition

Gp

ha2

Cd

3e

Cd

63

Cd

63

Cd

4

Ctl SCIDOuter Inner Outer Inner

BPeri. Peri.

Foxp

3-G

FPC

d6

3

Gp

ha2

Ki6

7

Outer Inner Peri.

Lyve

-1C

d3

1K

15

-GFP

K1

5-G

FP

Outer Inner Peri.

Outer Inner Peri.

C

BALB/cSCID

BALB/c SCID

E

*

% o

f Ed

u+

cells

0

5

10

Ctl Cd25 inhibition

Outer Inner Peri.

Outer Inner Peri.

D F

Cd

63

Edu


https://doi.org/10.1101/2020.06.30.179754

Figure 6: Working hypothesis

A


https://doi.org/10.1101/2020.06.30.179754

Capturing limbal epithelial stem cell population dynamics, signature, and their niche · 2020. 6....

Documents

Transcript of Capturing limbal epithelial stem cell population dynamics, signature, and their niche · 2020. 6....