Cancer GeneticsChapter 23

http://www.labnews.co.uk/news_archive.php/761/5/visions-of-science-winners-chosen/1 out of 2 men1 out of 3 women

group of diseases characterized by cells that do not respond to the normal controls on cell division

-caused by multiple acquired somatic mutations that occur over time

-separate inherited susceptibility in some cases one mutation already in all cells-tumorlocalized benigninvasive malignant What is cancer?http://science.education.nih.gov/supplements/nih1/cancer/activities/activity2_animations.htm

Lung tumorhttp://science.nationalgeographic.com/science/enlarge/lung-tumor.htmlWhat is cancer?group of diseases characterized by cells that do not respond to the normal controls on cell division

-caused by multiple acquired somatic mutations that occur over time

-separate inherited susceptibility in some cases one mutation already in all cells

-tumorlocalized benigninvasive malignant

Relies uponsignals fromother cellsCancer cellsdisconnect fromnormal regulationas part of multicellularOrganismRenegade CellTapping into earlydevelopmental pathways

http://www.hhmi.org/biointeractive/media/angiogenesis-sm.movhttp://www.hhmi.org/biointeractive/media/angiogenesis-sm.wmv

per child = 10-8 mutation rate35 & 49 new germ-line mutations in 1000 genomes projectProduction of sperm and eggs~23 cell divisions to make each gamete1 fertilized cell to ~1014 somatic cells in body1,586 new mutations in single somatic cells measured in 1000 genomes project

Mutation rate ~1x10-10 per bp per cell division so ~ 0.6 new mutations each time a cell divides in humansGerm-line mutationssomatic mutationsCancer normally results from somatic mutationsif have 1010 cell divisions, some cell has likely mutated one of each base pair in genome

NCIQuickly proliferating cells- e.g. epithelial cellsCells whose growth is controlled by hormonesCells exposed to environmental carcinogens

Clonal Evolution of TumorsCancer begins with a mutation in a single cellleads to abnormal cell replicationextra mutations occur in subsequent cellscells carrying both take over since grow fasternew mutations occur that enhance proliferation furtherCells evolve to grow faster and less impeded by controls

Cancer-related genescontrol the cell cycle

Mutations in these can disrupt normal cell cycle controls

Cell Cycleensure DNA is replicated only once per cycleensure DNA is intact and cell is readyensure equal distribution of DNA to daughter cells

Checkpoints control progress to next stageControlled by cyclins and cyclin-dependent kinases

Cell cycle game:http://www.nobelprize.org/educational/medicine/2001/cellcycle.html

Mutated Genes that contribute to CancerGenes associated with the regulation of the cell cyclestimulate growth and cell divisionmutation makes it hyperactive or active at inappropriate timesusually dominant, so just need one mutationONCOGENES/ PROTOONCOGENES

inhibit growth and cell divisionmutation makes gene inactiveusually recessive, so need two mutationsTUMOR-SUPPRESSOR GENES

Oncogenesmutation stimulates cell growthExist in normal cells as protooncogenewhen mutated to oncogene, stimulates growthCan test by inserting an oncogene into other cells and see growth stimulation

1910 Peyton RousRous sarcoma virusv-src is a viral gene that can cause cancer when added to cells1975 Bishop and Varmusfound cellular proto-oncogenec-src is an unmutated copy that functions normally

SRC- protooncogeneBiochim Biophys Acta 1602(2), M. Frame, Src in Cancer, 114-130, 2002 Oncogene version vSRC loses tail with Y527Loses inhibitory part so always active

http://en.wikipedia.org/wiki/ApoptosisMany proto oncogenes are involved in signaling external stimulatory signal increase in cell growthCell-cell contactStimulatory signalsG1/S

http://en.wikipedia.org/wiki/ApoptosisMany proto oncogenes are involved in signaling external stimulatory signal increase in cell growth mutations - over express protein -stick protein in on positionCell-cell contactG1/S

RAS protein is a GTP/GDP switch like translation factorsMutation that affects ability to hydrolyzed GTP sticks in ON position Dominant acting

http://courses.washington.edu/conj/gprotein/monomericgp.htmMutations can stick signaling protein in an always ON position

Normal Myc functionSignals that regulate MycCell contactGrowth factorsCytokines

Differentiation of cellContact Inhibition

Seminars in Cancer BiologyVolume 16, Issue 4, August 2006, Pages 318-330 Cancerous Growth of CellExample: Myc/Max/Mad

-Activation of MYC by translocationTranslocation of Myc gene at breakpoint onto one of three other chromosomes-fuses to immunoglobin promoter so turns on myc in B-cells

Burkitt B-cell carcinoma http://8e.devbio.com/article.php?ch=5&id=42Ways Myc gene expression can be increased: - Mutations in regulatory proteins and pathways e.g. NFAT - Duplication of myc genec-myc genec-myc genepromoterStrong promoteron in white blood cellsMyc promoterimmunoglobinpromoterpromoter

Tumor Suppressor Genesnormally limit cell growthNormal gene limits progression through cell cycle or checkpoints unless certain conditions are metNormally inhibits cancerous growth

Mutation of the gene removes this control and allows faster or unhindered cell growth

examples p53rbAPCBRCA1

Cell Cycle Regulation CheckpointsG1/S checkpointDNA damageEnvironmental suitabilityexternal growth factorsG2/M checkpointcentrosome/DNA duplication, DNA damageSpindle checkpointChromosome alignment in metaphasehttp://www.cellsalive.com/cell_cycle.htm

http://en.wikipedia.org/wiki/ApoptosisCell-cell contactApoptosiscell death pathway-fail safe if something goeswrongSelfdestructTumor suppressor genes often act as inhibitors that signaling overcomes, or part of error recognition that halts or triggers apoptosis

Familiar risk if inherit one defective allele,then mutation just needs to hit the second allele to start road to cancer

Starts S phaseE2F is transcription factor that turns on growth-related genes

RB binds to E2F to prevent the cell from moving into S unless all of the cellular components are available and the cell is ready for growth.

Mutation of RB allows cell to immediately enter S phase

RB- tumor suppressor gene

RB- tumor suppressor gene

Alfred Knudson (1971)retinoblastoma

UnilateralRetinoblastomaSporadic-not inheritedBilateralRetinoblastomaRuns in familiestumor

two hits in a single cell would happen only rarely; results in a tumor in one eyeSingle eye tumor (Unilateral)No family history

Tumors in both eyes (Bilateral)Usually runs in familiesgenetic predispositionbecause only a single mutation is needed, the likelihood of it occurring in both eyes is increased

Many inherited bilateral retinoblastoma families have deletion on Chromosome 13 13q14- includes RB geneRBRBRB

G1/S checkpointTwo important questions at this checkpoint:IS THE ENVIRONMENT PERFECT FOR CELL DIVISION?IS DNA DAMAGED IN ANY WAY?

BRCA1 & 2 and P53 detect damaged DNA

BRCA1 and BRCA2Associated with breast and ovarian cancer inherited defective BRCA1 allele is associated with only 5% of breast cancer casesHeterozygote female has 80% risk of developing breast cancer by age 80

links detection of DNA damage to control of cell cycle G2/MPart of a DNA repair complexarrest division until damage is fixed

You tube cartoon: http://www.youtube.com/watch?v=G8kFs2lMdfY

Also- bulky blocks to DNA replication or transcription trigger ATMTrends in Molecular MedicineVolume 8, Issue 12, 1 December 2002, Pages 571-576

National Cancer Institute http://www.cancer.gov/cancertopics/pdq/genetics/breast-and-ovarian/HealthProfessional/page1MissenseCys61GlyArg814TrpSer1040AsnMet1775LysMet1775Arg

Deletions185delAG Ashkenazi Jews1294del40 1675delA Norway2800delAA3121delA3888delGA4153delA Russia4184del4 5085del19Insertions943ins10 Africa1135insA Norway3171ins5 Sweden5382insC5438insC5677insASplice site variants330A-G 5 splice exon 5Arg71Gly BCRA1 Mutations linked to familial risk

http://www.nytimes.com/2007/09/16/health/16gene.html?pagewanted=all&_r=0BRCA1 Previvor video: http://video.on.nytimes.com/video/2007/08/31/health/1194817106561/the-story-of-a-previvor.html

http://www.mun.ca/biology/desmid/brian/BIOL2060/BIOL2060-19/1939.jpgP53Guardian (or Tattletale) of the genome

50% of all human cancers are associated with defects in p53

If a cell has incurred DNA damage:-turns on genes to repair the damage-arrest division until damage is fixed-initiate apoptosis (cell death) if not fixed

-P53 mutations in red in DNA-binding residues- makes it actas a dominant-negative . Unusual for a tumor suppressor gene-Mutations in the promoter, frameshift, nonsense mutations eliminate function- those act as typical recessive tumor-suppressor gene.

http://www.mun.ca/biology/desmid/brian/BIOL2060/BIOL2060-19/1939.jpgP53Guardian (or Tattletale) of the genomeIf can not bind, it can nottrigger arrest/apoptosis

Korean J Lab Med. 2008 Dec;28(6):493-497Li-Fraumeni syndromeOne copy of p53 mutated so only inherits one functional copy

Dominant autosomal inheritance of early cancer in many different organs

P53 misense mutation 13203G>A Arg175His

APC - a tumor suppressor gene controls pathway regulating cell-cell adhesion

Trends in Biochem Sci Volume 26, Issue 11,Non-cancerouscancerColon Epithelial cellsClinical Cancer Research July 15, 2006; 12 (14) cadherin-catenin

APC - a tumor suppressor genealso in mitotic spindle checkpoint

checks on spindle attachmentBinds microtubles attached to kinetochore of chromosomes

mutations lead to aneuploidyNature Reviews Cancer 1, 55-67 (October 2001)doi:10.1038/35094067

http://berkeley.edu/news/media/releases/2007/06/26_drugresistance.shtmlKaryotypes

http://www.nature.com/labinvest/journal/v80/n7/full/3780108a.htmlTwo different lung cancer cell lines

Changes in Other Regulatory TypesIncreased chromosomal abnormalitiesAneuploidy, translocations, deletions

Changes in DNA methylationDecreased or increased methylation of CpG e.g. APAF1 (required for apoptosis) is hypermethylated in leukemia

Changes in miRNAs up regulate other protooncogenes or turn off other tumor suppressor genesDatabase: http://www.mir2disease.org/ e.g. mir15.1-16.1 cluster on chrom 13q14- deletion linked to B cell and prostate cancer

Selection for changes that produce faster growth:~Delete or silence more tumor suppressor genes

~Multiply copies or enhance expression of -Oncogenes -Genes for Angiogenesis (blood vessel growth) -Genes for Cell Migration- allows metastasis

Progressive mutations accumulate to allow:

Uncontrolled cell growthGenomic instabilityImmortality (telomerase activated)Angiogenesis- recruiting blood vesselsInvasiveness (metastasis)

Personalized tumor genetics:What genes have changed in MY tumor?

DNA chip- detect genes that are duplicated or lost in tumor cells Transcript DNA chip- measure mRNA transcripts of genes- overexpressed or silencedBreast Cancer in tumor cellsTumors that overexpress Her2 (human epidermal growth factor receptor 2 tyrosine kinase)? Can use drugs trastuzumab (Herceptin) and lapatinib (Tykerb) Her2 & EGFR induce RAS Tumors that overexpress epidermal growth factor receptor (EGFR)? & angiogenesis Can use drugs cetuximab (Erbitux) and erlotinib (Tarceva)

Tumor overexpresses estrogen receptor (ER) ? Progesterone Receptor (PR)? If yes, can use antiestrogens tamoxifen (Valodex) an estrogen antagonist, if no, these will not work

Tumors caused by BRCA mutations? Can use drugs PARP inhibitors (poly ADP ribose polymerase) e.g. Veliparib Relevant Genes in whole body, not just tumor: Mutations in CYP2D6 that reduce activity? Do not prescribe tamoxifen- drug can not be activated in body

Colorectal Cancerarises in cells lining the colon and rectumstatistics~150,000 new cases/yrProgressive mutations

Familial adenomatous polyposis coli-Inherits one defective copy APC autosomal (5q22.2) dominant-hundreds of mini polyps if not removed, one usually becomes malignant

Polyp- benign

Sporadic tumors75% have APC mutated

Familial APC- one copy already mutated70% tumorshave P53 mutated

Environmental Risks of Cancermutagenic conditions increase chance of mutationChemical exposureAir pollution, food, environmental toxins (smoking)Diet - Carcinogens (plant and microbial toxins), fatRadiation exposureSunlight, radonInfectious agentViruses: HPV, SV40, Hepatitis B, Epstein-Barr virus, RetrovirusMedical treatmentsestrogen replacement therapy

http://en.wikipedia.org/wiki/Human_papillomavirusHuman Papilloma VirusVaccine- Gardasil targets 6,11,16 & 18

HeLa cancer cell line from Henrietta Lacks cervical cancer 1951HPV infectionhttp://www.itmhrt.ca/course2.html

Human Papilloma Virus (Cervical Cancer strains)2 genes E6 & E7 interact with tumor suppressors to assure viral take over of cell cyclehttp://www.cancer-therapy.org/CT3B/HTML/46.%20Jo%20and%20Kim,%20419-434.htmlE6- binds to P53E7- binds to RB

Hepatitis BAflatoxin- mutagenAspergillusLiver CancerChina has world caseshttp://www.niehs.nih.gov/health/impacts/aflatoxin.cfm

Burkitt's Lymphoma

Epstein-Barr Virus EBV 95% of US adults have been infected if not infected until adolescent or later- develop mono

In Africa, early EBV infection + recurrent childhood malariaMalarial Infection+

AGCCTGACTGCTAGCCATTGCAATTAGCGTGCATGCATGCATTAGGCACACTAGTGTAGTGGGACACACACACACAGGATTTATCTAGAGGCTGGGAAGGGCTCCTGAACCAGTTGTTTCCGTCTTGTGTTGCTTTTCACCATTGGGTTCTGCTGGGCTCAGTATTCCTCAAATACACAACAAGGACGAACATCTATTGTTCATCTGTTTGAATGGCGATGGGTTGATATTGCTCTTGAATGTGAGCGATATTTAGCTCCCAAGGGATTTGGAGGGGTTCAGGTCTCTCCACCAAATGAAAATGTTGCCATTCACAACCCTTTCAGACCTTGGTGGGAAAGATACCAACCAGTTAGCTATAAATTATGCACAAAACTCGGCACAGTTATTCGCAAGTGGAAATGGGTTGATATTGCTCTTGAATGTGAGCGATATTTAGCTCCCAAGGGATTTGGAGGGGTTCAGGTCTCTCCACCAAATGAAAATGTTGCCATTCACAACCCTTTCAGACCTTGGTGGGAAAGATACCAACCAGTTAGCTATAAATTATGCACAAAACTCGGCACAGTTATTCGCAAGTGGAATGTTTTTTTTCCGTCTTGTCGGTCTGTCAGGGTTGGAAATCGTTATCTACCAGAGCACCGTGGGCTGTTACTTGCCTTGAGTTGGAAGCGGTTCGCATTTATACCGGAATATAAATAGTTTCTGGAAAGGACACTGACAACTTCAAAGCAAAATGAAGCTCTTTTGGTTGCTTTTCACCATTGGGTTCTGCTGGGCTCAGTATTCCTCAAATACACAACAAGGACGAACATCTAAACACACAACTTAGGCACACTAGTGTAGTAGCCTGACTGCTAGCCATTGCAATTAGCGTGCATGCATGCATTAGGCACACTAGTGTAGTGTTGCTTTTCACCATTGGGTTCTGCTGGGCTCAGTATTCCTCAAATACACAACAAGGACGAACATCTATTGTTCATCTGTTTGAATGGCGATGGGTTGATATTGCTCTTGAATGTGAGCGATATTTAGCTCCCAAGGGATTTGGAGGGGTTCAGGTCTCTCCACCAAATGAAAATGTTGCCATTCACAACCCTTTCAGACCTTGGTGGGAAAGATACCAACCAGTTAGCTATAAATTATGCACAAAACTCGGCACAGTTATTCGCAAGTGGAAXu PNAS 2013 vol. 110 no. 26 10759

*This image of a cancer cell moving down a pore in a filter was taken by Anne Weston of cancer research UK. She told Laboratory News: The picture formed part of an ongoing project with Dr John Marshall who has a specific interest in Recessive Dystrophic Epidermolysis Bullosa (RDEB) for which the life threatening aspect of the disease is that many of the patients develop skin cancer.

Visions of science winners chosen

The winners of the 2005 Novartis and The Daily Telegraph photographic awards - visions of science - have been announced The winners of the 2005 Novartis and The Daily Telegraph photographic awards - visions of science - have been announced. The winning images were chosen on their ability to explain scientific phenomena, illustrate scientific data, or simply show the beauty of science. This Culex mosquito is emerging from its pupa. A single female can lay some 400 eggs, which are deposited on the surface of still water. By Dr Christian Laforsch. The winners were selected from over 2,200 entrants, and judging caused fierce debate. Judge and TV presenter, Adam Hart-Davis said: the variety of subjects and styles was splendid and picking the winners was, as ever, extremely difficult, with judges noisily championing a particular favourite photograph. The wide ranging subject matter of the images across the five main categories action, close-up, people, concepts and art included a view of a hatching mosquito, an image of cancer cell weaving its way through a filter, and an artists impression of a migraine attack. The overall winner, and winner of the close-up category, was an image of salt and pepper taken by David McCarthy that he hoped would give an insight into the everyday products we use on our food. This image of a peppercorn and a grain of sea salt by David McCarthy pleased judge Adam Hart-Davis. Delightfully simple - the sort of image that seems obvious when youve seen it, but none of us had, he said. The entrants background and methods also varied greatly. Winners included professors, doctors, researchers, artists and photographers. *Characterized by uncontrolled proliferation of cells (not a familial disease only in 1% of cases a predisposition to)In a way, cancer thought to turn on early developmental pathways like in embryogenesis- earlier developmental stages mimics more dangerous since cells grow undifferentiated and aggressively, later stage mimic are slower growing.http://www.nature.com/onc/journal/v20/n56/full/1205088a.html- microarrays showing same types of genes involved

Mitotic mutation rate= 3x10 e-10 per cell division 10e13 cells in body, some divide frequently- epithelial in intestines replaced each week, skin cells replaced every 60 days, so colon epitheial stem cell may do 5,000 divisions in lifetime.

Cancer results from mutations that overcome the normal limits to the number of cell divisions. These mutations usually occur in somatic cells and full-blown malignant cancer usually requires a number of sequential mutations to get started. Occasionally, a mutation affecting cell-cycle regulation is inherited through the germline and persons who inherit the mutation have a greatly increased risk of developing malignancies due to additional somatic mutations. To understand cancer, we have to go back and talk about the cell cycle *Characterized by uncontrolled proliferation of cells (not a familial disease only in 1% of cases a predisposition to)In a way, cancer thought to turn on early developmental pathways like in embryogenesis- earlier developmental stages mimics more dangerous since cells grow undifferentiated and aggressively, later stage mimic are slower growing.http://www.nature.com/onc/journal/v20/n56/full/1205088a.html- microarrays showing same types of genes involved

Cancer results from mutations that overcome the normal limits to the number of cell divisions. These mutations usually occur in somatic cells and full-blown malignant cancer usually requires a number of sequential mutations to get started. Occasionally, a mutation affecting cell-cycle regulation is inherited through the germline and persons who inherit the mutation have a greatly increased risk of developing malignancies due to additional somatic mutations. To understand cancer, we have to go back and talk about the cell cycle *Autocrine Stimulation Most cells decide whether or not to divide only after receiving signals from neighboring cells, either positive signals that stimulate division or negative signals that prevent proliferation. Many tumor cells, make their own stimulatory signals, in a process known as AUTOCRINE STIMULATIONAn example of an autocrine agent is the cytokine interleukin-1 in monocytes. When this is produced in response to external stimuli, it can bind to cell-surface receptors on the same cell that produced it.Another example occurs in activated T cell lymphocytes, i.e. when a T cell is induced to mature by binding to a peptide:MHC complex on a professional antigen presenting cell and by the B7:CD28 costimulatory signal. Upon activation, "low affinity" IL-2 receptors are replaced by "high affinity" IL-2 receptors consisting of , , and chains. The cell then releases IL-2 which binds to its own new IL-2 receptors, causing self-stimulation and ultimately a monoclonal population of T cells. These T cells can then go on to perform effector functions such as macrophage activation, B cell activation, and cell-mediated cytoxicity.

2.contact inhibition

3.loss of cell death cancer cells tend to be resistant to apoptosis

4.loss of gap junctions. gap junctions permit the transfer of small molecules that may be important in controlling cell growth. Most tumor cells have lost these channels of communication.1000 genomes family sequencing 1x10-8 females lower rate-fewer divisions. 49 and 35 germline mutationshttp://www.nature.com/ng/journal/v43/n7/full/ng.862.html found many more somatic mutations- 1586 somatic mutations in cells or cell lines collected. expect about 10-10 mutations per cell division so 0.6 mutations in each cell division

Get 10^14 cells in 63 cell divisions (Lucas series), but some cells die and other replicate much more as stem cells- like epithelial cellsIntestinal epithelial cells replaced every week*http://apps.nccd.cdc.gov/uscs/toptencancers.aspx**Any genetic defect that allows more mutations to arise will accelerate cancer progression. Genes that regulate DNA repair are often found to have been mutated in the cells of advanced cancers and inherited disorders of DNA repair are usually characterized by increased incidences of cancer.

Mutations in genes that affect chromosome segregation also may contribute to the clonal evolution of tumors. Many cancers cells are aneuploid and it is clear that chromosome mutations contribute to cancer, possibily by duplicating some genes and eliminating others.

Review: http://www.sciencedirect.com/science/article/pii/S0168952512000121http://www.ndsu.edu/pubweb/~mcclean/plsc431/cellcycle/cellcycl7.htm*Cell cycle game- look at cell cycle clock to determine what to do next (cyclins do this), need to satisfy all tests at checkpoints**The mutant alleles that lead to cancer are referred to as "cancer genes"; but the term genes is a misnomer. All cancer genes are MUTANT alleles of normal genes*Bishop and Varmus used probes to viral oncogenes to search for related seguencs in normal cells. They discovered proto-oncogenes which are responsible for basic cellular functions in normal cells but when mutated, they become oncogenes that contribute to the development of cancer. When a virus infects a cell, a proto-oncogene may become incorporated into the viral genome through recombination. Within the viral gneome, the proto-oncogenes may mutate to an oncogene that, when inserted back into a cell, causes rapid cell division and cancer.http://en.wikipedia.org/wiki/Src_(gene)Francis Peyton Rous first proposed that viruses can cause cancer. He proved it in 1911. Chickens grow a tumor called a fibrosarcoma. Rous ground up these sarcomas, centrifuged them to remove the solid material, and injected the remaining liquid into chicks. The chicks developed sarcomas. The causative agent in the liquid was a virus, now called Rous sarcoma virus (RSV).Later work by others showed that RSV was a type of retrovirus. Non-cancer-forming retroviruses contain three genes, called gag, pol, and env. Some tumor-inducing retroviruses (such as RSV), however, also contain a gene called v-src (viral-sarcoma). It was found that the v-src gene in RSV is required for the formation of cancer and that the other genes have no role in oncogenesis.[3]A function for Src tyrosine kinases in normal cell growth was first demonstrated with the binding of family member p56lck to the cytoplasmic tail of the CD4 and CD8 co-receptors on T-cells.[4] Src tyrosine kinases also transmit integrin-dependent signals central to cell movement and proliferation. Hallmarks of v-src induced transformation are rounding of the cell and the formation of actin rich podosomes on the basal surface of the cell. These structures are correlated with increased invasiveness, a process thought to be essential for metastasis.v-src lacks the C-terminal inhibitory phosphorylation site (tyrosine-527), and is therefore constitutively active as opposed to normal src (c-src) which is only activated under certain circumstances where it is required (e.g. growth factor signaling). v-src is therefore an instructive example of an oncogene whereas c-src is a proto-oncogene.

B/c the proto-oncogeneare more likely to undergo mutation or recombination inside the virus, viral infection is often associated with the cancer.*

How Src works The Src protein has three major domains, SH2 (for Src homology 2), SH3, and the kinase catalytic domain (or SH1), as shown above. SH2 and SH3 both play a part in protein-protein interactions, while the kinase catalytic domain contains the kinase active site. Src can be switched from an inactive to an active state through control of its phosphorylation state, or through protein interactions. There are two major phosphorylation sites on Src: one is at Tyr416 (or Y416), the other at Tyr527, as marked in the drawing above for chicken Src. Tyr416 can be auto-phosphorylated, which activates Src by displacing the P-Tyr416 from the binding pocket, allowing the substrate to gain access. A more critical site is Tyr527, which can be phosphorylated and dephosphorylated by various proteins, such as CSK kinase (phosphorylates), or SHP-1 phosphorylase (dephosphorylates). Phosphorylation of Tyr527 inactivates Src through the interaction of P-Tyr527 with the SH2 domain, which effectively folds Src up into a closed, inaccessible bundle. Dephosphorylation of Tyr527 releases this bond, opening up the molecule to an active state. Protein interactions also act to regulate Src by either directly activating Src, or by moving Src to sites of action. Both platelet-derived growth factor and focal adhesion kinase are able to bind to the SH2 domain, causing Src to open up into the active form.Many of the substrates that Src can phosphorylate with its kinase domain form part of signalling cascades. These include Fak and Cas, which are important for integrin signalling, as well as Shc and Stat3, which are involved in growth regulation. Signalling systems often involve a cascade mechanism of sequential phosphorylation and dephosphorylation of proteins in the cascade, as occurs here. Src family membersConsidering the vital role Src seems to play in cell signalling, scientists were surprised to find that mice deficient in Src could survive. The reason for this result is that Src is one of nine members in a closely-related family that can often compensate for one another. Other Src family kinase members are Fyn and Yes, which like Src are widely expressed, and Blk, Fgr, Hck, Lck, Lyn, and Yrk, which are expressed in specific tissues. All these proteins have structurally similar SH2, SH3 and kinase domains and are capable of acting as signalling molecules in a similar manner to Src. When Src goes wrong Under normal circumstances, Src is predominantly inactive in cells, being switched on only at specific times. However, if the fine balance between phosphorylation and dephosphorylation is disrupted, changes can occur in Src activity with drastic results. Several cancers, including colon and breast cancer, have been associated with an increase in Src activity. In fact, Src was first isolated as an oncogene, v-Src, from the transforming virus, Rous Sarcoma Virus. v-Src was found to lack the region of the cellular protein (c-Src) that contains Tyr527, making it continually active. In a similar fashion, c-Src can become abnormally active, either through mutations in c-Src itself, or through mutations in proteins that regulate c-Src. In late stage colon cancers, mutations have been reported in the src gene that cause the loss of the region containing Tyr527, leading to Src over-activity. Proteins that regulate Src have also been found at abnormal levels in cancer cells, including both those that activate and those that inactivate Src. Proteins such as PTPalpha, SHP-1 and PTP1B that activate Src by dephosphorylating Tyr527 have been detected at elevated levels in various cancer cells, including epidermal and breast carcinoma cells. Conversely, proteins such as Csk and Chk that inactivate Src by phosphorylation of Tyr527 have been detected at reduced levels in certain*WNTdiffusible signal in cell-cell signaling in embryogenesisMutations of the wingless gene in the fruit fly were found in wingless flies, while tumors caused by MMTV were found to have copies of the virus integrated into the genome forcing overproduction of one of several Wnt genes. The ensuing effort to understand how similar genes produce such different effects has revealed that Wnts are a major class of secreted morphogenic ligands of profound importance in establishing the pattern of development in the bodies of all multicellular organisms studied. HEDGEHOG:In a growing embryo, cells develop differently in the head or tail end of the embryo, the left or right, and other positions. They also form segments which develop into different body parts. The hedgehog signaling pathway gives cells this information that they need to make the embryo develop properly. Different parts of the embryo have different concentrations of hedgehog signaling proteins. The pathway also has roles in the adult. When the pathway malfunctions, it can result in diseases like basal cell carcinoma. [1]The hedgehog signaling pathway is one of the key regulators of animal development conserved from flies to humans. The pathway takes its name from its polypeptide ligand, an intercellular signaling molecule called Hedgehog (Hh) found in fruit flies of the genus Drosophila. Hh is one of Drosophila's segment polarity gene products, involved in establishing the basis of the fly body plan. The molecule remains important during later stages of embryogenesis and metamorphosis.Mammals have three Hedgehog homologues, of which Sonic hedgehog is the best studied. The pathway is equally important during vertebrate embryonic development. In knockout mice lacking components of the pathway, the brain, skeleton, musculature, gastrointestinal tract and lungs fail to develop correctly. Recent studies point to the role of hedgehog signaling in regulating adult stem cells involved in maintenance and regeneration of adult tissues. The pathway has also been implicated in the development of some cancers. Drugs that specifically target hedgehog signaling to fight this disease are being actively developed by a number of pharmaceutical companies.

Two theories of the direct initiation of apoptotic mechanisms in mammals have been suggested: the TNF-induced (tumour necrosis factor) model and the Fas-Fas ligand-mediated model, both involving receptors of the TNF receptor (TNFR) family[21] coupled to extrinsic signals.TNF is a cytokine produced mainly by activated macrophages, and is the major extrinsic mediator of apoptosis. Most cells in the human body have two receptors for TNF: TNF-R1 and TNF-R2. The binding of TNF to TNF-R1 has been shown to initiate the pathway that leads to caspase activation via the intermediate membrane proteins TNF receptor-associated death domain (TRADD) and Fas-associated death domain protein (FADD).[22] Binding of this receptor can also indirectly lead to the activation of transcription factors involved in cell survival and inflammatory responses.[23] The link between TNF and apoptosis shows why an abnormal production of TNF plays a fundamental role in several human diseases, especially in autoimmune diseases.The Fas receptor (also known as Apo-1 or CD95) binds the Fas ligand (FasL), a transmembrane protein part of the TNF family.[21] The interaction between Fas and FasL results in the formation of the death-inducing signaling complex (DISC), which contains the FADD, caspase-8 and caspase-10. In some types of cells (type I), processed caspase-8 directly activates other members of the caspase family, and triggers the execution of apoptosis. In other types of cells (type II), the Fas-DISC starts a feedback loop that spirals into increasing release of pro-apoptotic factors from mitochondria and the amplified activation of caspase-8.[24]Following TNF-R1 and Fas activation in mammalian cells a balance between pro-apoptotic (BAX,[25] BID, BAK, or BAD) and anti-apoptotic (Bcl-Xl and Bcl-2) members of the Bcl-2 family is established. This balance is the proportion of pro-apoptotic homodimers that form in the outer-membrane of the mitochondrion. The pro-apoptotic homodimers are required to make the mitochondrial membrane permeable for the release of caspase activators such as cytochrome c and SMAC. Control of pro-apoptotic proteins under normal cell conditions of non-apoptotic cells is incompletely understood, but it has been found that a mitochondrial outer-membrane protein, VDAC2, interacts with BAK to keep this potentially-lethal apoptotic effector under control.[26] When the death signal is received, products of the activation cascade displace VDAC2 and BAK is able to be activated.There also exists a caspase-independent apoptotic pathway that is mediated by AIF (apoptosis-inducing factor).[27]

Other genes often mutated in breast cancerCASpase 8TGF-betaEstrogen ReceptorFGFR2- fibroblast growth factor- in 2/5th of breast cancer pateint

*Genes involved in cell growth/division signaling- a Mug shot of potential cancer genesWNTdiffusible signal in cell-cell signaling in embryogenesisMutations of the wingless gene in the fruit fly were found in wingless flies, while tumors caused by MMTV were found to have copies of the virus integrated into the genome forcing overproduction of one of several Wnt genes. The ensuing effort to understand how similar genes produce such different effects has revealed that Wnts are a major class of secreted morphogenic ligands of profound importance in establishing the pattern of development in the bodies of all multicellular organisms studied. HEDGEHOG:In a growing embryo, cells develop differently in the head or tail end of the embryo, the left or right, and other positions. They also form segments which develop into different body parts. The hedgehog signaling pathway gives cells this information that they need to make the embryo develop properly. Different parts of the embryo have different concentrations of hedgehog signaling proteins. The pathway also has roles in the adult. When the pathway malfunctions, it can result in diseases like basal cell carcinoma. [1]The hedgehog signaling pathway is one of the key regulators of animal development conserved from flies to humans. The pathway takes its name from its polypeptide ligand, an intercellular signaling molecule called Hedgehog (Hh) found in fruit flies of the genus Drosophila. Hh is one of Drosophila's segment polarity gene products, involved in establishing the basis of the fly body plan. The molecule remains important during later stages of embryogenesis and metamorphosis.Mammals have three Hedgehog homologues, of which Sonic hedgehog is the best studied. The pathway is equally important during vertebrate embryonic development. In knockout mice lacking components of the pathway, the brain, skeleton, musculature, gastrointestinal tract and lungs fail to develop correctly. Recent studies point to the role of hedgehog signaling in regulating adult stem cells involved in maintenance and regeneration of adult tissues. The pathway has also been implicated in the development of some cancers. Drugs that specifically target hedgehog signaling to fight this disease are being actively developed by a number of pharmaceutical companies.

Two theories of the direct initiation of apoptotic mechanisms in mammals have been suggested: the TNF-induced (tumour necrosis factor) model and the Fas-Fas ligand-mediated model, both involving receptors of the TNF receptor (TNFR) family[21] coupled to extrinsic signals.TNF is a cytokine produced mainly by activated macrophages, and is the major extrinsic mediator of apoptosis. Most cells in the human body have two receptors for TNF: TNF-R1 and TNF-R2. The binding of TNF to TNF-R1 has been shown to initiate the pathway that leads to caspase activation via the intermediate membrane proteins TNF receptor-associated death domain (TRADD) and Fas-associated death domain protein (FADD).[22] Binding of this receptor can also indirectly lead to the activation of transcription factors involved in cell survival and inflammatory responses.[23] The link between TNF and apoptosis shows why an abnormal production of TNF plays a fundamental role in several human diseases, especially in autoimmune diseases.The Fas receptor (also known as Apo-1 or CD95) binds the Fas ligand (FasL), a transmembrane protein part of the TNF family.[21] The interaction between Fas and FasL results in the formation of the death-inducing signaling complex (DISC), which contains the FADD, caspase-8 and caspase-10. In some types of cells (type I), processed caspase-8 directly activates other members of the caspase family, and triggers the execution of apoptosis. In other types of cells (type II), the Fas-DISC starts a feedback loop that spirals into increasing release of pro-apoptotic factors from mitochondria and the amplified activation of caspase-8.[24]Following TNF-R1 and Fas activation in mammalian cells a balance between pro-apoptotic (BAX,[25] BID, BAK, or BAD) and anti-apoptotic (Bcl-Xl and Bcl-2) members of the Bcl-2 family is established. This balance is the proportion of pro-apoptotic homodimers that form in the outer-membrane of the mitochondrion. The pro-apoptotic homodimers are required to make the mitochondrial membrane permeable for the release of caspase activators such as cytochrome c and SMAC. Control of pro-apoptotic proteins under normal cell conditions of non-apoptotic cells is incompletely understood, but it has been found that a mitochondrial outer-membrane protein, VDAC2, interacts with BAK to keep this potentially-lethal apoptotic effector under control.[26] When the death signal is received, products of the activation cascade displace VDAC2 and BAK is able to be activated.There also exists a caspase-independent apoptotic pathway that is mediated by AIF (apoptosis-inducing factor).[27]*Proto-oncogens normally produce factors that stimulate cell division

Mutant alleles (oncogenes) tend to be dominant: one copy of the mutant allele is sufficient to induce excessive cell proliferation*Fig. 1.Cellular processes controlled by Myc during normal conditions and during tumorigenesis. Myc is a key regulator of many biological activities including cell growth and division (regulation of chromatin modification and components of the biosynthetic machinery); cell-cycle progression (modulation of cyclins, cyclin-dependent kinases, cyclin-dependent kinase inhibitors and phosphatases); apoptosis (p53 dependent or independent mechanisms); cell differentiation (downregulation of growth arrest genes); cell metabolism (glycolysis, amino acid biosynthesis and transport, synthesis of macromolecules and DNA metabolism); angiogenesis (upregulation of VEGF); cell adhesion and motility (control of expression of integrins). Deregulation of Myc may result in apoptosis, genomic instability, uncontrolled cell proliferation, escape from immune surveillance, growth factor independence, and immortalization. http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WWY-4KJM016-1&_user=961305&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_acct=C000049425&_version=1&_urlVersion=0&_userid=961305&md5=4e376dc4f00bb4f1232fda73c480bd51*Figure 1 Three chromosomal translocations that independently can give rise to Burkitt lymphoma of B cells. In each case, the c-myc gene (on chromosome 8) is translocated to the enhancer region of an immunoglobin gene on chromosome 2, 14, or 22. C is the heavy chain gene; and C and C are the genes for the two types of immunoglobin light chains. MutationsThe c-myc proto-oncogene encodes a short-lived transcription factor that plays an important role in cell cycle regulation, differentiation and apoptosis. c-myc is often rearranged in tumors resulting in deregulated expression. In addition, mutations in the coding region of c-myc are frequently found in human lymphomas, a hot spot being the Thr58 phosphorylation site, a mutation shown to enhance the transforming capacity of c-Myc. It is, however, still unclear in what way this mutation affects c-Myc activity. Our results show that proteasome-mediated turnover of c-Myc is substantially impaired in Burkitt's lymphoma cells with mutated Thr58 or other mutations that abolish Thr58 phosphorylation, whereas endogenous or ectopically expressed wild type c-Myc proteins turn over at normal rates in these cells. Myc Thr58 mutants expressed ectopically in other cell types also exhibit reduced proteasome-mediated degradation, which correlates with a substantial decrease in their ubiquitination. These results suggest that ubiquitin/proteasome-mediated degradation of c-Myc is triggered by Thr58 phosphorylation revealing a new important level of control of c-Myc activity. Mutation of Thr58 in lymphoma thus escapes this regulation resulting in accumulation of c-Myc protein, likely as part of the tumor progression. *Harder to find these than oncogenes since disfuncion turns on cancer.

B/c the proto-oncogeneare more likely to undergo mutation or recombination inside the virus, viral infection is often associated with the cancer.*Cell cycle have evolved a series of checkpoints fail safe mechanisms that prevent a subsequent event from taking place before the prerequisite event has been completed*Genes involved in cell growth/division signaling- a Mug shot of potential cancer genesNormally difficult for just oncogene to turn on psat tumor-needs mutation of tumor suppressor gene too

WNTdiffusible signal in cell-cell signaling in embryogenesisMutations of the wingless gene in the fruit fly were found in wingless flies, while tumors caused by MMTV were found to have copies of the virus integrated into the genome forcing overproduction of one of several Wnt genes. The ensuing effort to understand how similar genes produce such different effects has revealed that Wnts are a major class of secreted morphogenic ligands of profound importance in establishing the pattern of development in the bodies of all multicellular organisms studied. HEDGEHOG:In a growing embryo, cells develop differently in the head or tail end of the embryo, the left or right, and other positions. They also form segments which develop into different body parts. The hedgehog signaling pathway gives cells this information that they need to make the embryo develop properly. Different parts of the embryo have different concentrations of hedgehog signaling proteins. The pathway also has roles in the adult. When the pathway malfunctions, it can result in diseases like basal cell carcinoma. [1]The hedgehog signaling pathway is one of the key regulators of animal development conserved from flies to humans. The pathway takes its name from its polypeptide ligand, an intercellular signaling molecule called Hedgehog (Hh) found in fruit flies of the genus Drosophila. Hh is one of Drosophila's segment polarity gene products, involved in establishing the basis of the fly body plan. The molecule remains important during later stages of embryogenesis and metamorphosis.Mammals have three Hedgehog homologues, of which Sonic hedgehog is the best studied. The pathway is equally important during vertebrate embryonic development. In knockout mice lacking components of the pathway, the brain, skeleton, musculature, gastrointestinal tract and lungs fail to develop correctly. Recent studies point to the role of hedgehog signaling in regulating adult stem cells involved in maintenance and regeneration of adult tissues. The pathway has also been implicated in the development of some cancers. Drugs that specifically target hedgehog signaling to fight this disease are being actively developed by a number of pharmaceutical companies.

Two theories of the direct initiation of apoptotic mechanisms in mammals have been suggested: the TNF-induced (tumour necrosis factor) model and the Fas-Fas ligand-mediated model, both involving receptors of the TNF receptor (TNFR) family[21] coupled to extrinsic signals.TNF is a cytokine produced mainly by activated macrophages, and is the major extrinsic mediator of apoptosis. Most cells in the human body have two receptors for TNF: TNF-R1 and TNF-R2. The binding of TNF to TNF-R1 has been shown to initiate the pathway that leads to caspase activation via the intermediate membrane proteins TNF receptor-associated death domain (TRADD) and Fas-associated death domain protein (FADD).[22] Binding of this receptor can also indirectly lead to the activation of transcription factors involved in cell survival and inflammatory responses.[23] The link between TNF and apoptosis shows why an abnormal production of TNF plays a fundamental role in several human diseases, especially in autoimmune diseases.The Fas receptor (also known as Apo-1 or CD95) binds the Fas ligand (FasL), a transmembrane protein part of the TNF family.[21] The interaction between Fas and FasL results in the formation of the death-inducing signaling complex (DISC), which contains the FADD, caspase-8 and caspase-10. In some types of cells (type I), processed caspase-8 directly activates other members of the caspase family, and triggers the execution of apoptosis. In other types of cells (type II), the Fas-DISC starts a feedback loop that spirals into increasing release of pro-apoptotic factors from mitochondria and the amplified activation of caspase-8.[24]Following TNF-R1 and Fas activation in mammalian cells a balance between pro-apoptotic (BAX,[25] BID, BAK, or BAD) and anti-apoptotic (Bcl-Xl and Bcl-2) members of the Bcl-2 family is established. This balance is the proportion of pro-apoptotic homodimers that form in the outer-membrane of the mitochondrion. The pro-apoptotic homodimers are required to make the mitochondrial membrane permeable for the release of caspase activators such as cytochrome c and SMAC. Control of pro-apoptotic proteins under normal cell conditions of non-apoptotic cells is incompletely understood, but it has been found that a mitochondrial outer-membrane protein, VDAC2, interacts with BAK to keep this potentially-lethal apoptotic effector under control.[26] When the death signal is received, products of the activation cascade displace VDAC2 and BAK is able to be activated.There also exists a caspase-independent apoptotic pathway that is mediated by AIF (apoptosis-inducing factor).[27]*Tumor suppressor genes normally function to produce factors that inhibit cell division. Mutant alleles are recessive that is, both alleles must be mutated to produce excessive cell proliferation*Does same with Myc- binds and keeps silent until signal comes in.Like GAL80 in yeast galactose genes- binds GAL4.

RB also associates with HDAC on some promoters- actively turns off gene.*tumor sometimes occurs in one eye, sometimes two eyes. Knudson found that when it occurs in both eyes, onset is early AND children usually have a close relative who has retinoblastoma.http://www.daisyseyecancerfund.org/rb/rb/genetics.htmlOver 90% of children who carry a heritable RB1 mutation will develop retinoblastoma. Most will develop a number of tumours in both eyes. Some will have more than one tumour but only in one eye, and a few will develop only one tumour in one eye. A small number of children will not develop retinoblastoma, because the normal copy of RB1 does not become damaged in any retinal cell. All cases of bilateral retinoblastoma are heritable, and approximately 17% of children with unilateral retinoblastoma have a heritable RB1 mutation. Multifocal retinoblastoma is an indicator of a heritable RB1 mutation in unilateral patients, though it is clinically difficult to differentiate between true multifocal tumours and seeds pieces of tumour that have broken away from the original single mass. When a child has unilateral retinoblastoma with no family history, precise molecular genetic testing is the only reliable way to determine their risk for heritable retinoblastoma. Carriers of a heritable RB1 mutation have a 50/50 chance of passing the mutated RB1 gene to their children, but only 10% of heritable mutations are actually inherited from a parent. In most cases, the RB1 mutation occurs spontaneously at or after conception. When the mutation happens after conception, the child will have a mosaic mutation. Mosaicism means that only a fraction of cells in the whole body carry one mutated copy of the RB1 gene. Each of these cells also carries one normal copy of the RB1 gene. The remaining cells carry two normal copies of the RB1 gene. Mosaicism only ever happens at or after the point of conception, so it cannot be inherited. Mosaicism occurs in about 10% of heritable RB1 mutations, and can affect both boys and girls in equal measure. Theoretically, the lower the penetration of the mosaicism (the lower the fraction of affected cells), the lower the chances of developing tumours, but the chance is still there *Knudson's hypothesis suggests that cancer is the result of a multistep process that requires several mutations. If one or more of the required mutations is inherited, fewer additional mutations are required to produce cancer and that cancer is likely to "run" in families*e.g. Retinoblastoma- Many bilateral cases have a deletion in chromosome 13 and are missing band 13q14. *Like other CDK inhibitor, p21 binds to CDK-cyclin complexes and inhibits their activity. Specifically, p21 prevents entry into S by inhibiting the activity of CDK4-cyclinD complexs*BRCA1, a nuclear phosphoprotein, functions as a tumor suppressor in human breast cancer cells. This gene associates with RNA polymerase II holoenzyme. Mutations in BRCA1 could be responsible for approximately 45% of inherited breast cancer and more than 80% of inherited breast and ovarian cancer. BRCA1 is essential for activating the Chk1 kinase that regulates DNA damage-induced G2/M arrest. Therefore, it controls the expression, phosphorylation, and cellular localization of Cdc25C and Cdc2/cyclin B kinase which are crucial proteins for the G2/M transition. BRCA1 may be involved in regulating the onset of mitosis. BRCA1 inhibits the nucleolytic activity of the MRE11/RAD50/NBS1 complex, an enzyme implicated in numerous aspects of double-strand break repair. BRCA1 is part of a large multisubunit protein complex of tumor suppressors, DNA damage sensors, and signal transducers. BRCA1 is implicated in the transcriptional regulation of DNA damage-inducible genes that function in cell cycle arrest. BRCA1 gene product is a component of the RNA polymerase II holoenzyme (polII) by several criteria. BRCA1 was found to copurify with the holoenzyme over multiple chromatographic steps. BRCA1 may also function as a transcriptional regulator, due to an amino terminal DNA-binding ring finger motif, nuclear localization signals, and an acidic carboxy terminal domain. BRCA1 is also a granin-like protein that functions as a secreted growth inhibitory protein. BRCA1 may normally serve as a negative regulator of mammary epithelial cell growth. This function is compromised in breast cancer either by direct mutation or by alterations in gene expression. BRCA1 participates in transcription-coupled repair of oxidative DNA damage. BRCA1 spans an 81-kb region of human chromosome 17, and consists of 24 exons, 22 of which are coding exons. The BRCA1 genomic sequence has an unusually high density of Alu repetitive DNA (41.5%), but a relatively low density (4.8%) of other repetitive sequences. BRCA1 intron lengths ranged in size from 403 bp to 9.2 kb and contain 3 intragenic microsatellite markers located in introns 12, 19, and 20. Other genes have been localized close to BRCA1 on chromosome 17. The order of genes on the chromosome is: centromere-IFP35-VAT1-RHO7-BRCA1-M17S2-telomere. Alternative splicing may play a significant role in modulating the subcellular localization and physiological function of BRCA1. *http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6W7J-47C49FY-7&_user=961305&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_acct=C000049425&_version=1&_urlVersion=0&_userid=961305&md5=00546673873d49590179717b714d2ad8Fig. 1. A model of the DNA-damage signal-transduction cascade mediated by ATM (ataxia telangiectasia mutated) and ATR (ataxia telangiectasia and Rad3 related). ATM and ATR have some distinct and some overlapping roles [4 and 5]. ATM regulates the G1S checkpoint response by increasing the activity of p53 [either by direct phosphorylation (purple circle), or indirectly via phosphorylation of its negative regulator, MDM2, or of the cell-cycle-checkpoint kinases, CHK1 and CHK2]. This causes increased transcription of the cyclin-dependant kinase (CDK) inhibitor p21 and, hence, G1 arrest. Phosphorylation of CHK1 and CHK2 can also influence the S-phase checkpoint. This is mediated via the Cdc25C phosphatase. Arrest of the G2M checkpoint is mediated via p53-activated transcription of 143-3 and GADD45, or via the CHK1 and CHK2 kinases, which inhibit the Cdc25C phosphatase from activating the Cdc2cyclin-B1 complex. ATM and ATR also phosphorylate the breast-cancer-susceptibility protein, BRCA1, which has a role in both DNA double-strand break (DSB) repair by homologous recombination, and in cell-cycle arrest at the G2M checkpoint, possibly via upregulation of GADD45. ATM phosphorylates NBS1, which is involved in DSB repair (when complexed with MRE11 and RAD50) and might be involved at the S-phase-checkpoint. ATM can also phosphorylate the c-ABL kinase, which in turn phosphorylates the homologous-recombination-repair effector, RAD51. c-ABL and the DNA-dependent protein kinase (DNA-PK) also phosphorylate one another, affecting the interaction of DNA-PK with DSB-repair proteins involved in non-homologous end-joining (NHEJ). Modified from Refs [4] and [5].

BRCA1 appears to play a role in two distinct pathways for double strand break repair, non-homologous end joining and homology-directed repair. Non-homologous end joining is an error-prone system for DNA repair that can result in loss of sequence information around the break. Homology-directed repair, in contrast, uses regions of homology to preserve sequence integrity surrounding a double-strand break. Homology directed repair might be as simple as exposing single-stranded DNA on both sides of the break through action of an exonuclease, enabling annealing of exposed complementary sequence. Homology-directed repair may alternatively be more complex, involving homologous recombination proteins in a process that requires resection of single-strands around the break, a search for homologous sequence on an intact molecule, synthesis of new DNA using a homologous sequence as a template, and resolution of the intertwined recombinant DNA strands (Figure 1a). This process results in double-strand break repair with greater fidelity than single-strand annealing or non-homologous end joining. However, the requirement for a homologous template for repair is a limitation of double-strand-break repair by homologous recombination. In mammalian cells, repair by homologous recombination is therefore primarily restricted to late S or G2 phase of the cell cycle, when an identical sister chromatid is available (Rothkamm et al., 2003). Studies examining the role of BRCA1 in DNA repair have yielded seemingly conflicting results, with BRCA1 implicated in both non-homologous end joining and homologous repair. BRCA1 interacts with proteins involved in both the non-homologous end-joining pathway (including the Mre11, Rad50, Nbs1 complex) (Greenberg et al., 2006) and homologous repair (RAD51 and BRCA2, among others) (Chin et al., 1998; Scully et al., 1997b) and forms damage-induced foci irrespective of the cell cycle. In addition, a number of cell-based experiments support involvement of BRCA1 in both pathways. Studies of BRCA1 using a reporter for homology-directed repair have shown that BRCA1 promotes both single-strand annealing and homologous recombination, suggesting that BRCA1 is involved in homology-directed repair upstream of the divergence of SSA and HR (Moynahan et al., 1999; Snouwaert et al., 1999; Stark et al., 2004). On the other hand, extracts from BRCA1-deficient cells are deficient in end-joining (Zhong et al., 2002). Together, these data suggest that BRCA1 is either involved in double strand break repair upstream of both NHEJ and HDR, or BRCA1 functions in a manner common to both types of DNA repair. 4. BRCA1 and other forms of DNA damage repair BRCA1 has also been linked with a number of other DNA repair processes, including mismatch repair (through interactions with the mismatch repair proteins MSH2, MSH6, and MLH1) and inter-strand crosslink repair (Wang et al., 2000). Intriguingly, there is a growing body of evidence linking BRCA1 with the Fanconi anemia pathway for inter-strand crosslink repair. Fanconi anemia, a disorder characterized by developmental defects, chromosomal abnormalities, and susceptibility to DNA cross-linking agents, is caused by recessive mutations in any one of at least twelve genes. Although BRCA1 does not appear to be a Fanconi protein, several BRCA1 interactors are linked to Fanconi anemia, including BRCA2 (FancD1), BACH1 (FancJ), and FancA (Cantor et al., 2001; Chen et al., 1998; Folias et al., 2002). Because inter-strand crosslinks may be converted to double-strand breaks in the course of repair (Figure 1b) (McHugh et al., 2001; Niedernhofer et al., 2001; Rothfuss and Grompe, 2004), BRCA1 may affect the Fanconi pathway after a partially-repaired DNA is shunted into a homologous recombination pathway. On the other hand, because BRCA1 appears to play a role in repairing a disparate collection of DNA lesions, it is possible that BRCA1 acts in a manner that is upstream of or common to many DNA repair pathways, such as acting as a sensor for DNA damage. http://www.cancer.gov/cancertopics/pdq/genetics/breast-and-ovarian/HealthProfessional/page1Figure 1. BRCA1 pedigree. This pedigree shows some of the classic features of a family with a deleterious BRCA1 mutation across three generations, including affected family members with breast cancer or ovarian cancer and a young age at onset. BRCA1 families may exhibit some or all of these features. As an autosomal dominant syndrome, transmission can occur through maternal or paternal lineages, as depicted in the figure.

Figure 2. BRCA2 pedigree. This pedigree shows some of the classic features of a family with a deleterious BRCA2 mutation across three generations, including affected family members with breast (including male breast cancer), ovarian, pancreatic, or prostate cancers and a relatively young age at onset. BRCA2 families may exhibit some or all of these features. As an autosomal dominant syndrome, transmission can occur through maternal or paternal lineages, as depicted in the figure.

Risk alleles: http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=113705

**ATM (ataxia telangiectasia mutated) Ways to reduce- defect in protein or promoterBriefly, p53 was first identified in 1979 as a cellular protein that bound to the simian virus (SV40) large T antigen and accumulated in the nuclei of cancer cells.The gene encoding p53 (TP53) was cloned from neoplastic rodent and human cells, and found to have weak oncogenic activity when expressed in rodent cells. In the late 1980s, however, researchers discovered that they were studying missense mutants of the TP53 gene instead of the wild-type gene. The missense mutations found in the original TP53 cDNA clones proved to be the key to understanding the pathobiological activity of p53. The ability of p53 to form tetramers allows this protein to behave in a dominant-negative fashion, where the allele-producing mutant p53 suppresses the activity of wild-type p53. Oncogenic human DNA viruses have also evolved a mechanism to inactivate p53 functions (e.g. enhanced ubiquitin-dependent proteolysis of p53 by the E6 protein of human papilloma virus types 16 and 18. Finally, certain missense p53 mutants can 'gain oncogenic activity', which could explain the high frequency of missense mutants (75%) in human cancers compared with more-frequent frame-shift and nonsense mutations found in other tumor suppressor genes, such as APC (adenomatosis polyposis coli). Tumor suppressor functions of p53 By the early 1990s, TP53 was widely recognized as a tumor suppressor gene, mutated or lost in ~50% of all human cancer cases worldwide. Not surprisingly, mice deficient in TP53 are susceptible to spontaneous tumorigenesis and germ-line TP53 mutations occur in individuals with the cancer-prone Li-Fraumeni syndrome . With this information, the search for the precise function of p53 as a tumor suppressor intensified, and there was an explosion of >20 000 scientific reports in the literature during the 1990s and early part of this millennium, aimed at improving our understanding of the role of p53 in tumorigenesis. p53 has multiple functions, many of which can be traced to its activity as a transcription factor. It was first shown to be involved in cell-cycle regulation and apoptosis, and then in development, differentiation, gene amplification, DNA recombination, chromosomal segregation and cellular senescence. In the mid- to late-1990s, it was discovered that wild-type p53 facilitates DNA repair, including nucleotide excision repair and base excision repair. Most recently, it was discovered that chronic constitutive expression of p53 accelerates aging in mice. However, mice age normally when transgenic TP53 is under the control of its own promoter and not constitutively expressed. *Most of the p53 mutations that cause cancer are found in the DNA-binding domain (turns into oncogene). The most common mutations are shown here, using PDB entry 1tup. This PDB entry includes three copies of the DNA-binding domain; only one (chain B in the file) is shown here. The mutations are found in and around the DNA-binding face of the protein. The most common mutation changes arginine 248, colored red here. Notice how it snakes into the minor groove of the DNA (shown in blue and green), forming a strong stabilizing interaction. When mutated to another amino acid, this interaction is lost. Other key sites of mutation are shown in pink, including arginine residues 175, 249, 273 and 282, and glycine 245. Some of these contact the DNA directly, and others are involved in positioning other DNA-binding amino acids. These make the mutated P53 an oncogene since it soaks up other proteins in pathway but does not bind DNA. This picture was created with RasMol. You can create similar illustrations by clicking on the accession codes and picking an option under View Structure. A list of all p53 tumor suppressor structures in the PDB as of July, 2002, is available here. For more information on p53 tumor suppressor, click here. http://p53.free.fr/Database/p53_cancer/p53_germline.htmlhttp://synapse.koreamed.org/DOIx.php?id=10.3343/kjlm.2008.28.6.493&vmode=FULLPedigree of the Li-Fraumeni like syndrome family. Solid symbols represent individual with tumors. Types of tumors are indicated, with ages (yr) at the time of diagnosis and death (if applicable). Asterisk (*) marks the individual analyzed and found to carry the germline TP53 mutation.We report a 26-yr-old female patient with bilateral breast cancer who was clinically diagnosed with Li-Fraumeni like syndrome (LFL) and subsequently found to have a germline mutation of the TP53 gene. The patient was initially diagnosed with right breast cancer at age 24 yr and then with left breast cancer at age 25 yr. Surgery and radiotherapy were performed accordingly. The patient had a family history of various types of early onset cancers and was referred to a genetic counseling clinic. She was clinically diagnosed with LFL. Genetic analysis of the TP53 tumor suppressor gene was performed with the patient's consent. Direct sequencing of TP53 gene exons 5, 6, 8, 9, and 11 revealed a ermline missense mutation, resulting in an amino acid change from an arginine to a histidine (g.13203G>A, p.R175H). Considering the family history, individualized cancer surveillance was performed including a gastroscopy and a brain MRI. Even though the patient had not shown any neurological symptoms, a huge mass on the temporal lobe was incidentally found and the patient received surgery and radiotherapy. Although the residual mass required further treatment, the patient decided on supportive care alone and was discharged. We report a case of LFL, with a germline TP53 mutation, which was confirmed by gene sequencing in Korea. This case shows how genetic predisposition screening and counseling in patients, suspected of having a familial cancer syndrome, can influence the course of the patient.**http://www.sciencedirect.com/science/article/pii/S0968000401019521http://www.nature.com/nrc/journal/v1/n1/fig_tab/nrc1001-055a_F5.html| In APC wild-type cells, APC accumulates at the kinetochore, where it may facilitate the binding of spindle microtubules to the kinetochore by interacting with the microtubule-associated protein EB1. b | In cells that express a truncated form of APC, the interaction between kinetochores and spindle microtubules is disrupted, leading to chromosomal instability (CIN). APC, adenomatous polyposis coli.

Related conditionsFamilial adenomatous polyposis (FAP) is caused by mutations in the APC gene. More than 800 mutations[citation needed]in the APC gene have been identified in families with classic and attenuated types of familial adenomatous polyposis. Most of these mutations cause the production of an APC protein that is abnormally short and nonfunctional. This short protein cannot suppress the cellular overgrowth that leads to the formation of polyps, which can become cancerous. The most common mutation in familial adenomatous polyposis is a deletion of five bases (the building blocks of DNA) in the APC gene. This mutation changes the sequence of amino acids (the building material of proteins) in the resulting APC protein beginning at position 1309.Another mutation is carried by approximately 6 percent of people of Ashkenazi (eastern and central European) Jewish heritage. This mutation results in the substitution of the amino acid lysine for isoleucine at position 1307 in the APC protein (also written as I1307K or Ile1307Lys). This change was initially thought to be harmless, but has recently been shown to be associated with a 10 to 20 percent increased risk of colon cancer.[edit] Regulation of ProliferationThe (Adenomatosis Polyposis Coli) APC protein normally builds a complex with glycogensynthasekinase 3beta(GSK 3) and Axin via interactions with the 20AA and SAMP repeats. This complex is then able to bind - catenins in the cytoplasm, that have dissociated from adherens contacts between cells. With the help of Casein Kinase 1 (CK1) which does the first phosphorylation of -catenin, there is subsequent phosphorylation by GSK-3. This targets -catenin for ubuiquitination and degradation by cellular proteosomes. This prevents it from translocating into the nucleus, where it acts as a transcription factor for proliferation genes. APC is also thought to be targeted to microtubules via the PDZ binding domain, stabilising them. The deactivation of the APC protein can take place after certain chain reactions in the cytoplasm are started, e.g. through the Wnt signals that destroy the conformation of the complex. In the nucleus it complexes with legless/BCL9, TCF, and Pygo and begins function of an RNA polymerase but for oncogenes.[edit] MutationsMutations in APC often occur early on in cancers such as colon cancer. Patients with familial adenomatous polyposis (FAP) have germline mutations, with 95% being nonsense/frameshift mutations leading to premature stop codons. 33% of mutations occur between amino acids 1061-1309. In somatic mutations, over 60% occur within a mutation cluster region (1286-1513), causing loss of axin binding sites in all but 1 of the 20AA repeats. Mutations in APC lead to loss of -catenin regulation, altered cell migration and chromosome instability.Mutations in APC gene impair actin cytoskeletal integrity, cell-cell adhesion and cell migration properties of colon cancer cells. Panel A shows the organization of cell-cell adhesion and cytoskeletal proteins in normal colonic epithelial cells. The APC gene product is shown to bind through its armadillo repeat domain to ASEF. Endogenous APC co-localizes with ASEF in colonic epithelial cells. APC regulates guanine nucleotide exchange factor (GEF) activity of ASEF and maintains actin cytoskeletal network, cell-cell adhesion and cell migration. Panel B shows how mutations in the APC gene product may impair actin cytoskeletal network, cell-cell adhesion and cell migration properties of colon cancer cells. Mutations in APC gene product disrupt binding with actin and -catenin; thus it affects actin cytoskeletal network and cell-cell adhesion, respectively. ASEF binds with most APC mutant proteins containing armadillo repeat sites, stimulates its own GEF activity, and promotes cell migration.Narayan and Roy Molecular Cancer 2003 2:41 doi:10.1186/1476-4598-2-41

*APC has several functions including to interact with the endsof the microtubulesthat associate with the kinetochore. With this defect, cells continue into mitosis before they are ready with the result of abnormal chormosomes - SEE NEXT Picture.http://www.nature.com/nrc/journal/v1/n1/fig_tab/nrc1001-055a_F5.html| In APC wild-type cells, APC accumulates at the kinetochore, where it may facilitate the binding of spindle microtubules to the kinetochore by interacting with the microtubule-associated protein EB1. b | In cells that express a truncated form of APC, the interaction between kinetochores and spindle microtubules is disrupted, leading to chromosomal instability (CIN). APC, adenomatous polyposis coli.

Related conditionsFamilial adenomatous polyposis (FAP) is caused by mutations in the APC gene. More than 800 mutations[citation needed]in the APC gene have been identified in families with classic and attenuated types of familial adenomatous polyposis. Most of these mutations cause the production of an APC protein that is abnormally short and nonfunctional. This short protein cannot suppress the cellular overgrowth that leads to the formation of polyps, which can become cancerous. The most common mutation in familial adenomatous polyposis is a deletion of five bases (the building blocks of DNA) in the APC gene. This mutation changes the sequence of amino acids (the building material of proteins) in the resulting APC protein beginning at position 1309.Another mutation is carried by approximately 6 percent of people of Ashkenazi (eastern and central European) Jewish heritage. This mutation results in the substitution of the amino acid lysine for isoleucine at position 1307 in the APC protein (also written as I1307K or Ile1307Lys). This change was initially thought to be harmless, but has recently been shown to be associated with a 10 to 20 percent increased risk of colon cancer.[edit] Regulation of ProliferationThe (Adenomatosis Polyposis Coli) APC protein normally builds a complex with glycogensynthasekinase 3beta(GSK 3) and Axin via interactions with the 20AA and SAMP repeats. This complex is then able to bind - catenins in the cytoplasm, that have dissociated from adherens contacts between cells. With the help of Casein Kinase 1 (CK1) which does the first phosphorylation of -catenin, there is subsequent phosphorylation by GSK-3. This targets -catenin for ubuiquitination and degradation by cellular proteosomes. This prevents it from translocating into the nucleus, where it acts as a transcription factor for proliferation genes. APC is also thought to be targeted to microtubules via the PDZ binding domain, stabilising them. The deactivation of the APC protein can take place after certain chain reactions in the cytoplasm are started, e.g. through the Wnt signals that destroy the conformation of the complex. In the nucleus it complexes with legless/BCL9, TCF, and Pygo and begins function of an RNA polymerase but for oncogenes.[edit] MutationsMutations in APC often occur early on in cancers such as colon cancer. Patients with familial adenomatous polyposis (FAP) have germline mutations, with 95% being nonsense/frameshift mutations leading to premature stop codons. 33% of mutations occur between amino acids 1061-1309. In somatic mutations, over 60% occur within a mutation cluster region (1286-1513), causing loss of axin binding sites in all but 1 of the 20AA repeats. Mutations in APC lead to loss of -catenin regulation, altered cell migration and chromosome instability.Mutations in APC gene impair actin cytoskeletal integrity, cell-cell adhesion and cell migration properties of colon cancer cells. Panel A shows the organization of cell-cell adhesion and cytoskeletal proteins in normal colonic epithelial cells. The APC gene product is shown to bind through its armadillo repeat domain to ASEF. Endogenous APC co-localizes with ASEF in colonic epithelial cells. APC regulates guanine nucleotide exchange factor (GEF) activity of ASEF and maintains actin cytoskeletal network, cell-cell adhesion and cell migration. Panel B shows how mutations in the APC gene product may impair actin cytoskeletal network, cell-cell adhesion and cell migration properties of colon cancer cells. Mutations in APC gene product disrupt binding with actin and -catenin; thus it affects actin cytoskeletal network and cell-cell adhesion, respectively. ASEF binds with most APC mutant proteins containing armadillo repeat sites, stimulates its own GEF activity, and promotes cell migration.Narayan and Roy Molecular Cancer 2003 2:41 doi:10.1186/1476-4598-2-41

*Translocations- caused by lack of H2Ax gene- it controls repair of stalled replication forks by homologous recombination. Increase in this leads to crossing over, but error prone.http://www.jbc.org/content/284/9/5994.fullhttp://www.ncbi.nlm.nih.gov/pubmed/12914701Histone H2AX becomes phosphorylated in chromatin domains flanking sites of DNA double-strand breakage associated with gamma-irradiation, meiotic recombination, DNA replication, and antigen receptor rearrangements. Here, we show that loss of a single H2AX allele compromises genomic integrity and enhances the susceptibility to cancer in the absence of p53. In comparison with heterozygotes, tumors arise earlier in the H2AX homozygous null background, and H2AX(-/-) p53(-/-) lymphomas harbor an increased frequency of clonal nonreciprocal translocations and amplifications. These include complex rearrangements that juxtapose the c-myc oncogene to antigen receptor loci. Restoration of the H2AX null allele with wild-type H2AX restores genomic stability and radiation resistance, but this effect is abolished by substitution of the conserved serine phosphorylation sites in H2AX with alanine or glutamic acid residues. Our results establish H2AX as genomic caretaker that requires the function of both gene alleles for optimal protection against tumorigenesis. *Representative karyotypes of non-small cell lung cancer (NSCLC) cell lines: Colo-699 (a), A427 (b), D54 (c), and D117 (d). Numbers adjacent to derivative chromosomes indicate the origin of the translocated or inserted material. "OL" in 2b indicates a color change caused by overlapping chromosomes. *APAF1 This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD40 repeat domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. The precise mechanism for this reaction is still debated though work published by Guy Salvesen suggests that the apoptosome may induce caspase 9 dimerization and subsequent autocatalysis.[5] Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis.

miRNA:http://nar.oxfordjournals.org/cgi/content/full/37/suppl_1/D98Also:http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WSN-4VNHRSC-5&_user=961305&_coverDate=02%2F20%2F2009&_rdoc=1&_fmt=high&_orig=search&_sort=d&_docanchor=&view=c&_searchStrId=1313029007&_rerunOrigin=scholar.google&_acct=C000049425&_version=1&_urlVersion=0&_userid=961305&md5=256bac4f53f26a2818df6d86dcc39c87

Her-2 : http://www.breastcancer.org/symptoms/diagnosis/her2.jsp Movie- 2008 Living Proof about Her2-specific drug: http://www.mylifetime.com/movies/living-proof/video

ER: http://www.breastcancer.org/symptoms/diagnosis/hormone_status/Triple negative cancers- no HER2, PR or ER: http://www.breastcancer.org/symptoms/diagnosis/trip_neg/http://www.mayoclinic.com/health/breast-cancer/AN00495 Her2-positivehttp://en.wikipedia.org/wiki/PARP_inhibitorPARP1 is a protein that is important for repairing single-strand breaks ('nicks' in the DNA). If such nicks persist unrepaired until DNA is replicated (which must precede cell division), then the replication itself will cause double strand breaks to form.[citation needed]Drugs that inhibit PARP1 cause multiple double strand breaks to form in this way, and in tumours with BRCA1, BRCA2 or PALB2 [6] mutations these double strand breaks cannot be efficiently repaired, leading to the death of the cells. Normal cells that don't replicate their DNA as often as cancer cells, and that lacks any mutated BRCA1 or BRCA2 still have homologous repair operating, which allows them to survive the inhibition of PARP.[7][8]Some cancer cells that lack the tumor suppressor PTEN may be sensitive to PARP inhibitors because of downregulation of Rad51, a critical homologous recombination component, although other data suggest PTEN may not regulate Rad51.[3][9] Hence PARP inhibitors may be effective against many PTEN-defective tumours[4] (e.g. some aggressive prostate cancers).http://www.nature.com/nrd/journal/v5/n6/box/nrd2039_BX3.htmlOverexpression or mutational activation of ERBB family members, such as the epidermal growth factor receptor (EGFR) and HER2/neu, is common in tumours. The figure shows pathways activated by EGFR and HER2/neu that can be affected by genetic mutations. EGFR ligation induces heterodimerization with HER2/neu and tyrosine phosphorylation, which activates both the phosphoinositide 3-kinase (PI3K)/AKT pathway and the mitogen-activated protein kinase (MAPK) pathway. AKT activation leads to up-regulation of hypoxia-inducible factor-1 (HIF1), which increases vascular endothelial growth factor (VEGF) production and angiogenesis; phosphatase and tensin homologue (PTEN) targets HIF1 for proteolytic degradation. MAPK activation induces cell proliferation and tumour growth74. Nature article 2013 review: Cancer pharmacogenomics http://www.nature.com/nrg/journal/v14/n1/full/nrg3352.html**The term multiforme signifies that GBM is a heterogeneous condition in which the same phenotype can result from mutations in different subsets of genes.*http://www.urmc.rochester.edu/medicine/genetics/colonCancer.aspxOne of the earliest steps is a mutation that inactivates the APC gene, which increases the rate of cell division, leading to a polyp. A person with familial adenomatous polyposis coli inherits one defective copy of the APC gene and defects in this gene are associated with the numerous polyps that appears in those who have the disorder. Mutations in APC are also found in the polyps that develop in people who don't have APC.However, proliferation of benign tumors in afflicted people increases chances that additional mutations occur.http://gut.bmj.com/content/56/3/417.extractThe flat surface of the colon is covered by an epithelium composed of four differentiated cell types (enterocytes, enteroendocrine, goblet and Paneth cells) that invaginates at regular intervals to form crypts (fig 1). The bottom of the crypts is occupied by a few stem cells that give rise to actively dividing precursor cells that populate the bottom two-thirds of the crypts.1 Proliferation occurs under the influence of growth factors from the Wnt family that may be produced by the underlying stromal cells underneath the stem cell compartment or by the epithelial cells themselves. The precursors migrate upward in an ordered fashion, which is also controlled by Wnt factors,2 and they stop proliferation when they reach the top third of the crypt, probably because they are too far from the Wnt source. Meanwhile, they continue their migration movement and colonise the surface of the colon. After about a week, epithelial cells undergo apoptosis and are shed in the lumen of the gut. The Paneth cells constitute an exception, as they migrate downward and occupy the very bottom of the crypt. Thus, the epithelium of the colon is under perpetual renewal. Wnt growth factors activate a cascade of intracellular events, which is known as the canonical Wnt pathway that ultimately leads to the expression of a genetic program controlling the co-ordinated expansion, fate and sorting of the epithelial cell population. In colorectal cancer, epithelial cells initially proliferate inappropriately because they acquired mutations in components of the pathway, thereby mimicking the effect of a permanent Wnt stimulation. Thus, the mutated cell recapitulates a progenitor-like phenotype, independent of its position in the epithelium.3 Canonical Wnt signalling has received considerable attention from cancer researchers over the years, because of its essential role in the homeostasis of the colonic epithelium and its deregulation *Mutations of the ras oncogene usually occur later, in larger polyps comprising cells that have acquired some genetic mutations. The protein produced by the normal ras proto-oncogene sits inside the cell membrane. From there it relays signals from growth factors that stimulate cell division. When ras is mutated, the protein that it encodes continually relays a stimulatory signal for cell division, even when growth factor is absentGroup of genes in 18q DCCDPC4, JV18-1- again both need to be deleted or silenced

75% have mutations in p53 Another tumor suppressor gene

http://www.nature.com/nrc/journal/v9/n7/full/nrc2645.html review on genetic progression and stages

many have mutations in ras proto-oncogeneMutations im p53 and other genes appear still later in tumor progression; these mutations are rare in polyps but common in malignant cells. B/c p53 prevents the replication of cells with genetic damage and controls proper chromosome segregation, mutations in p53 may allow a cell to rapidly acquire further gene and chromosome mutations, which then contribute to further proliferation and invation into surrounding tisses.*http://www.cancer.org/docroot/PED/ped_1_1.aspViruses- have protein that turns off P53 so that cell does not go into apoptosis when viral DNA is perceived. SV40 large T-antigen binds p53.P53 as a viral recognition- Interferon induced for apoptosisIn cases of viral oncogenesis, p53 has been demonstrated to interact with proteins encoded by tumor-associated viruses, many times providing a host evasion mechanism for bypassing cell cycle arrest and/or apoptosis (22). Destruction of this important cancer elimination checkpoint abrogates tumor suppressor activity in the infected cells and contributes to the oncogenic properties of tumor viruses. Connections between the p53 family and innate antiviral immunity have been recently established. Evidence indicates p53 pathways may be components of the antiviral responses mediated by interferon (IFN) (17, 35). Transcription of the p53 gene is induced by IFN, accompanied by an increase in p53 protein levels that prime cells toward enhanced p53 responses. The p53 protein can be activated in response to further virus infection, inducing a cellular apoptotic response that can restrict virus replication. Thus, there exists a relationship between death-inducing stress responses and innate antiviral immunity that transcends the tumor suppression properties of p53. This connection is also supported at the level of gene expression, as several gene targets of the IFN system are also subject to regulation by the p53 family (e.g., see references 2, 13, 24, and 25). Furthermore, influenza virus induces p53 activity, including p53-dependent apoptosis (37, 38), and cells deficient in p53 are defective in IFN responses (12, 38). In some cases, the viral protein that targets p53 is also linked to evasion of host innate immunity. For example, human papillomavirus E6 protein can enhance the ubiquitylation and degradation of p53 (32) and also can inhibit the induction of IFN through interaction with IFN regulatory factor 3 (31). Altogether, these findings support a role for the p53 family pathways in cellular regulation of virus infections. http://stke.sciencemag.org/cgi/content/full/jvi;80/11/5644*Http://en.wikipedia.org/wiki/Henrietta_LacksHas 5 HPV insertions- HPV a DNA virus. Usually HPV infection is cleared in a couple years. 5-10% of cases the virus infection continues and can cause cancer.*http://www.ncbi.nlm.nih.gov/pubmed/1322242The HPVs associated with anogenital cancers encode two oncoproteins, E6 and E7. Both E6 and E7 can form specific complexes with tumour suppressor gene products. The E7 protein binds to the retinoblastoma tumour suppressor gene product pRB, with a preference for the underphosphorylated, "active" form of pRB. The E7 proteins derived from the "high risk" HPVs bind to pRB with a higher affinity than the E7 proteins from the "low risk" HPVs. The "high risk" HPV E6 proteins can associate with the p53 tumour suppressor protein. This interaction promotes the degradation of p53 in vitro, which presumably accounts for the very low levels of p53 in cervical carcinoma cell lines. The functional inactivation of pRB and p53 by the HPV oncoproteins E7 and E6, respectively, are likely to be important steps in cervical carcinogenesis, since mutations in the RB and p53 genes were detected in HPV negative but not HPV positive cervical carcinoma cell lines. Cytogenetic studies strongly suggest, however, that additional chromosomal changes may be necessary for carcinogenic progression of HPV induced anogenital lesions. *In Chinas Jiangsu province, the rates of liver cancer far outpace the global averages, and its victims are far younger than elsewhere. At a population level, Jiangsu is an obvious outlier. Any time you see a lack of uniformity in disease, it smacks you in the face, and you realize that there must be dramatic exposures to something in the environment, says chemist and toxicologist John Groopman, PhD, chair of Environmental Health Sciences (EHS).Thirty years ago, Thomas Kensler, PhD, a toxicologist and professor in EHS, considered the questions posed by the epidemiological research in Jiangsu, and he began to look for answers on a molecular level. Hepatitis B (HBV), which is four times more prevalent in Asia than in developed nations, was part of the explanation.Could there be a chemical agent, a DNA damage product, operating in conjunction with HBV? Kensler and Groopman identified just such an agent, which works with HBV to create mutations in a tumor-suppressor gene known as TP53the most commonly mutated gene in all human cancers. The agent, aflatoxin, is a product of moldy crops such as peanuts and corn, is ubiquitous in Jiangsu, and cant be cooked out of food. By itself, it can mutate cells in small measure. But a person who has